Molecular Biology and Genetics

Molecular Biology

Barcode data: Roeslerstammia erxlebella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACTCTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACTTCTTTAAGTTTACTAATTCGAGCAGAATTAGGAACTCCAGGGTCTTTAATTGGAGATGACCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCCATTATAATTGGTGGATTTGGAAATTGATTAGTACCACTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTCTGACTTCTCCCCCCTTCTTTAACTCTTTTAATTTCTAGAAGAGTAGTGGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCTCTATCATCTAATATTGCCCATGGGGGAAGATCAGTAGATTTAGCTATTTTTTCACTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAGCTAATGGAATATCATTTGATCGAATACCATTATTTGTGTGATCTGTTGGTATTACAGCTTTACTTTTATTACTATCTTTACCAGTTCTTGCGGGTGCAATTACTATACTTTTAACAGATCGAAATTTAAATACTTCTTTTTTTGACCCTGCTGGGGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Roeslerstammia erxlebella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Roeslerstammia erxlebella

Roeslerstammia erxlebella is a moth of the Yponomeutidae family. It is found in all of Europe (except Ireland, the Iberian Peninsula and the Balkan Peninsula), east to Japan.

Roeslerstammia erxlebella2.JPG

The wingspan is about 13 mm. There are two generations with adults on the wing in May and June and again in August and September.

The larvae feed on Tilia cordata, Tilia x vulgaris, Acer pseudoplatanus and sometimes Betula species. They mine the leaves of their host plant. The mine consists of a short, irregular, full depth corridor, which is always located at the leaf margin and generally in the tip of the leaf. The frass broadly scattered. The older larva lives free on the leaf.

Subspecies[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!