Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coleophora alnifoliae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACCTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGCTCATTAATTGGAGATGACCAAATTTATAATACTATTGTAACTGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTTCTTCCCCCATCATTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGTACTGGTACTGGTTGAACAGTTTATCCCCCTTTATCATCTAATATTGCACATAGAGGAAGATCAGTTGATTTATCTATCTTTTCCCTTCATTTAGCTGGAATTTCATCCATTTTAGGAGCAATTAATTTTATTACTACCATTATTAATATACGACTAAATAACATATTATTTGATCAATTATCATTATTTATTTGAGCTGTTGGTATTACAGCTATTCTTCTTCTTTTATCTCTACCTGTATTAGCTGGAGCCATTACTATATTATTAACTGATCGTAATCTTAACACTTCTTTTTTTGACCCTGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Coleophora alnifoliae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Coleophora alnifoliae

Coleophora alnifoliae is a moth of the Coleophoridae family. It is found in Europe, from Fennoscandia to the Pyrenees, Sardinia, Italy and Romania and from Great Britain to the Baltic States and Poland. It is also known from North America.

Coleophora alnifoliae.jpg

The wingspan is 12–13 mm. The moth flies from July to August depending on the location.

The larvae feed on Alder. They create a slender, brown spathulate leaf case, in the end about 13 mm long. The mouth angle is about 15°. Larvae appear in September and feed to the end of October, making two youth cases in this period, then go into hibernation. They resume feeding in May and make their final case, in which they pupate around June. In Britain, the larvae often hibernate a second time.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!