Molecular Biology and Genetics

Molecular Biology

Barcode data: Coleophora albidella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACAATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTCTGACTTTTACCCCCCTCAATAACATTATTAATTTCAAGAAGAATAGTAGAAACAGGTACTGGTACCGGTTGAACAGTTTATCCCCCACTATCATCTAATATTGCTCATAGAGGTAGATCAGTAGACTTATCAATTTTTTCTCTCCATTTAGCTGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACTACTATTATTAATATACGATTAAATAATTTATCATTTGATCAATTACCTTTATTCGTTTGAGCTGTAGGTATTACAGCTGTTCTTCTCCTCCTTTCTCTTCCTGTTTTAGCAGGAGCTATTACCATATTATTAACAGACCGTAACTTAAATACCTCTTTTTTTGACCCTGCAGGAGGAGGAGATCCTATCTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Coleophora albidella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Coleophora albidella

Coleophora albidella is a moth of the Coleophoridae family. It is found in all of Europe, except the Balkan peninsula.

Case
Coleophora albidella.jpg

The wingspan is 13–16 mm. Adults are on wing from June to July.

The larvae feed on Salix repens, Salix aurita, Salix cinerea and sometimes Salix caprea. The larvae bore into expanding leaf buds and later skeletonize young leaves. Sometimes they mine a leaf in the usual manner of other Coleophora species. It builds a pistol shaped case from silk and fragments of leaf and frass which has a mouth angle of about 70°, thus standing almost erect on the leaf. The sides of the case are usually adorned with hairs from the leaf surface.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!