Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Blastobasis phycidella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Blastobasis phycidella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTCATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGTTCTTTAATTGGTGACGATCAAATTTATAATACTATTGTTACTGCTCATGCCTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTGATATTAGGAGCCCCCGATATAGCTTTCCCTCGTATAAATAATATAAGTTTTTGATTACTACCCCCTTCTCTTACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGTACCGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCACATAGAGGAAGATCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCCTCAATTTTAGGAGCCATTAATTTTATCACTACAATTATTAATATACGCCCTAATAATATATTCTTTGATCAAATAACTTTATTTGTTTGAGCAGTTGGTATTACAGCATTATTACTTCTTTTATCTCTTCCCGTATTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCCGCAGGAGGTGGTGATCCTATTCTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blastobasis phycidella

Blastobasis phycidella is a moth in the Blastobasidae family. It is found in most of Europe (except Fennoscandia, Latvia, Estonia, Ireland and Iceland).[1]

The wingspan is 17–19 mm.[2] There is probably one generation per year with adults on wing from the end of June to the beginning of early August.[3]

The larvae feed on decomposing wood of Quercus species, fallen pine needles[4] and dried fungus.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!