Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coleophora laticornella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACATTATACTTTATTTTTGGAATTTGAGCTGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCTGGATCATTAATTGGAGATGATCAAATTTATAACACTATTGTAACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTCGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTCCTTCCCCCATCATTAACTATTTTAATTTCAAGAAGAATTGTAGAAAATGGTAGAGGTACTGGTTGAACAGTTTATCCCCCTTTATCATCTAATATTGCTCATAGAGGAAGATCAGTTGATTTATCTATTTTCTCACTCCACTTAGCTGGTATTTCCTCTATTTTAGGAGCAATTAATTTTATTACTACCATTATTAATATACGATTAAATAATATATCATTTGATCAATTATCATTATTCATTTGAGCTGTTGGTATTACAGCTATTCTTCTTCTTCTTTCCCTTCCTGTATTAGCTGGAGCTATTACAATATTATTAACTGATCGTAATATTAATACTTCTTTTTTTGACCCTGCTGGTGGAGGAGATCCAATTTTATATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Coleophora laticornella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Coleophora laticornella

The Pecan Cigar Casebearer (Coleophora laticornella) is a moth of the Coleophoridae family. It is found in North America.

The wingspan is about 25 mm.

The larvae feed on Carya illinoinensis and other Carya species, as well as on Juglans nigra and Prunus americana. They create a spatulate leaf case.

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!