Molecular Biology and Genetics

Molecular Biology

Barcode data: Bembecia ichneumoniformis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGL0302-06|AJ862896|Bembecia ichneumoniformis| CGAAAATGATTATTTTCTACAAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAATTTGAGCTGGTTTAGTTGGTACTACTCTC---AGACTCCTAATTCGTGCTGAATTGGGAACCCCGGGATCTTTAATTGGAGAT---GATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCCATCATAATTGGGGGATTTGGAAATTGATTAGTACCTCTAATA---TTGGGTGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCATTACTTTTATTAATTTCTAGAAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACTGTTTATCCCCCCCTTTCCTCTAATATTGCACATGGGGGGGGATCCGTAGATTTA---GCTATTTTTTCTCTCCATTTAGCGGGAATTTCATCAATTTTAGGAGCTGTTAATTTTATCACAACAATTATTAATATACGACCAATTAATATATCTCTTGATCAAATACCCCTATTTGTATGATCCGTAGGAATCACAGCTCTTCTTCTTCTTCTTTCACTGCCAGTTTTAGCGGGA---GCTATTACCATACTTTTAACAGATCGAAATTTAAATACTTCATTTTTTGATCCGGCAGGAGGGGGAGATCCCATTCTATATCAACATCTATTTTGATTTTTTGGACATCCAGAAGTCTATATTCTAATTTTACCTGGTTTTGGAATAATTTCCCACATTATTTTTCAAGAAAGAGGAAAAAAG---GAAACTTTTGGATGTTTAGGTATAATCTATGCTATATTAGCAATTGGATTATTAGGATTTGTTGTCTGAGCTCATCATATATTCACTGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bembecia ichneumoniformis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Species: 28
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bembecia ichneumoniformis

The Six-belted Clearwing (Bembecia ichneumoniformis) is a moth of the Sesiidae family. It is found in most of Europe and Asia Minor, the Caucasus, northern Iran and the Near East.

Illustration from John Curtis's British Entomology Volume 5

The wingspan is 15-21 mm. Adults are on wing from June to August in western Europe. It is a day-flying species.

The larvae feed on the roots of Lotus species and Anthyllis vulneraria. Other recorded foodplants include Lotus corniculatus, Ononis spinosa, Dorycnium pentaphyllum, Dorycnium germanicum, Dorycnium herbaceum, Dorycnium hirsutum, Medicago, Hippocrepis comosa, Lupinus polyphyllus, Tetragonolobus maritimus and Lathyrus pratensis.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!