Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

Flowering Plants Visited by Synanthedon tipuliformis in Illinois

Synanthedon tipuliformis Clerck: Sesiidae, Lepidoptera
(observations are from Graenicher; this is the Currant Borer Moth)

Asteraceae: Eupatoriadelphus purpureus sn (Gr), Heliopsis helianthoides sn (Gr)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Synanthedon tipuliformis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGL0322-06|AJ864359|Synanthedon tipuliformis| CGAAAATGATTATTCTCTACAAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTGGGTACTACCCTA---AGTCTTTTAATTCGAGCTGAATTAGGTACTCCAGGCTCACTAATTGGAGAT---GATCAAATTTACAACACTATTGTCACTGCCCATGCTTTTATTATAATTTTTTTTATGGTAATACCTATTATAATTGGGGGATTTGGTAATTGATTGGTTCCCCTTATA---TTGGGAGCACCTGATATGGCTTTCCCCCGCATAAATAACATGAGATTTTGACTTTTACCCCCTTCTTTAATACTTTTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGTTGAACTGTTTATCCTCCCCTTTCTTCCAATATTGCCCATGGAGGAAGATCAGTAGATTTA---GCTATTTTTTCCCTACACTTAGCTGGAATTTCTTCAATTTTAGGGGCTGTAAATTTCATTACAACAATTATCAATATACGACCTATTAACATATCACTAGATCAAATACCCTTATTTGTTTGATCCGTGGGAATCACTGCTCTTCTTCTTCTTCTTTCCCTTCCAGTTTTAGCGGGA---GCTATTACCATATTATTAACAGACCGAAATTTAAATACATCATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGACACCCAGAAGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCACATTATTTTTCAAGAAAGAGGAAAAAAG---GAAACTTTTGGTTGTTTAGGTATAATTTATGCAATATTAGCAATTGGATTATTAGGATTTGTAGTTTGAGCCCATCATATATTTACTGTGGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Synanthedon tipuliformis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 20
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Synanthedon tipuliformis

Synanthedon tipuliformis, known as the Currant Clearwing, is a moth of the family Sesiidae. It is endemic to the Palearctic ecozone, but is an invasive species in the Nearctic ecozone and the Australasia ecozone.

Mating
Caterpillar
Pupa

The wingspan is 17–20 millimetres (0.67–0.79 in). The moth flies from April to July depending on the location.

The larvae feed on Ribes species, including Ribes nigrum, Ribes rubrum and Ribes uva-crispa. They bore into the stems to feed.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!