Articles on this page are available in 1 other language: Arabic (11) (learn more)

Overview

Comprehensive Description

General Description

A small Pyralid with an arched costa and rounded ends to the forewings giving it a "stubby”" appearance. The wingspan ranges from 11-15 mm. The inner half and subterminal area of the forewings is reddish brown or copper colored. A conspicuous dark band occurs between the median and subterminal areas. The hind wing is smoky gray. This Phycitine moth was originally described as Ephestia ochrifrontella.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Northeastern United States, Manitoba and British Columbia (Heinrich (1956). Listed as Euzophera ochrifrontella for Area 10 (Edmonton) in Alberta by Bowman (1951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Garden areas and woods in southern Alberta.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Pecan, oak and apple (Heinrich 1956). As pecans are not found in Alberta and oak trees are seldom planted in the province, apples and crabapples may be the main Alberta food plants. However, numerous collections have been made from areas where none of the known food plants occur. This suggests that saskatoon (Amelanchier alnifolia) may also serve as a food plant.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Cyclicity

Mainly June and July.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Unknown.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eulogia ochrifrontella

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTTATATTTTATTTTTGGTATTTGATCAGGATTAGTAGGTACTTCATTAAGATTATTAATTCGAGCAGAATTAGGAACCCCAGGATCTCTTATTGGAGATGATCAAATTTATAATACTATTGTTACTGGTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGCGGATTTGGAAATTGATTAGTCCCATTAATATTAGGAGCTCCTGATATAGCTTTTCCCCGTCTTAATAATATAAGATTTTGATTATTACCCCCCTCCATTATTCTCCTCATTTCAAGAAGAATTGTAGAAAACGGAGCAGGAACAGGATGAACTGTGTACCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGTTCTGTTGATTTAGCTATTTTCTCCCTTCATTTAGCTGGAATTTCTTCTATTCTAGGAGCTATTAATTTTATTACTACTATCATTAATATAAAATTAAATGGATTATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTTGGTATTACTGCATTATTATTACTTCTTTCATTACCAGTTCTAGCAGGAGCTATTACTATATTACTTACTGATCGTAATTTAAATACATCTTTTTTCGACCCTGCCGGAGGTGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Eulogia ochrifrontella

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 74
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Often common where present, of no concern.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eulogia ochrifrontella

Eulogia is a genus of the moth of the Pyralidae family containing only one species, the Broad-banded Eulogia Moth, Eulogia ochrifrontella. It is found in most of North America, including British Columbia, Florida, Illinois, Maine, Manitoba, Massachusetts, Minnesota, New Jersey, Oklahoma, Ontario, Pennsylvania, Tennessee, Virginia and Washington.[2]

The wingspan is 11-15 mm. The inner half and subterminal area of the forewings is reddish brown or copper colored. The hindwings are smoky gray. Adults are on wing in June and July.

The larvae feed on Carya illinoinensis, Quercus and Malus species and possibly Amelanchier alnifolia.[3]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!