Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Description

 A perennial red seaweed which forms dense, tangled tufts. The fronds are very fine, tough and wiry with irregular or dichotomous branching and up to 21 cm in length. The holdfast is disc-like or encrusting, 0.5 to 2 cm in diameter. The fronds are dark brown when moist and appear almost black when dry. The uppermost branches are often green.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Gametangial fronds stiff, erect and wiry, almost black in colour, growing to a maximum of 15 cm long. The tetrasporangial phase (Porphyrodiscus simulans) is crustose and grows to 30 cms in diameter.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Arctic Ocean, Atlantic, Boulogne, Digue du Nord, Canada, Dutch Exclusive Economic Zone, European waters (ERMS scope), Gulf of Maine, Irish Exclusive economic Zone, North West Atlantic, Pointe du Nid de Corbet, Pointe du Riden, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, USA, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Long Island Sound to Strait of Belle Isle
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Generally common around the British Isles. Europe: Azores, Portugal, Atlantic coasts of Spain and France, Netherlands, Baltic Sea, Norway, Faroes, Spitzbergen and Iceland. Greenland. Atlantic coast of North America: Canada, Maine, New Hampshire, Massachusetts, Rhode Island, Connecticut and New Jersey. Further afield: Arctic Sea circumpolar to Baffin Bay, Pacific and Indian Oceans.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Diagnostic Description

Morphology

Red colour results from the dominance of the pigments phycoerythrin and phycocyanin; this masks the other pigments, chlorophyll a (no chlorophyll b), beta-caratene and a number of unique xanthophylls.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

tide pools of the mid to low littoral or in the sublittoral to 12 m
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from rocky shores.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 79 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0 - 25.6
  Temperature range (°C): 11.471 - 11.845
  Nitrate (umol/L): 4.850 - 5.063
  Salinity (PPS): 35.203 - 35.211
  Oxygen (ml/l): 6.138 - 6.200
  Phosphate (umol/l): 0.336 - 0.421
  Silicate (umol/l): 2.315 - 2.448

Graphical representation

Depth range (m): 0 - 25.6

Temperature range (°C): 11.471 - 11.845

Nitrate (umol/L): 4.850 - 5.063

Salinity (PPS): 35.203 - 35.211

Oxygen (ml/l): 6.138 - 6.200

Phosphate (umol/l): 0.336 - 0.421

Silicate (umol/l): 2.315 - 2.448
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Ahnfeltia plicata forms turfs on shallow sublittoral bedrock and in rockpools on the lower shore, often partly buried by sand. It may form part of the turf on soft or friable rocks which are too unstable for large fucoids. The tetrasporophyte phase is common on pebbles, whereas the mature gametophytes only occur on more stable substrata.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Epilithic in rock pools of the lower littoral and in the sublittoral to a depth of 12 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ahnfeltia plicata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 124 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTCTCTACTTAATATTTGGTGCCTTTTCAGGGGTACTAGGAGCGTGCATATCTATGCTAATTCGAATGGAATTAGCGCAGCCGGGTAACCATTTACTTTTAGGCAATCACCAAGTATACAATGTTTTAATTACAGCACACGCGTTTTTAATGATTTTTTTTATGGTAATGCCTGTAATGATTGGTGGTTTCGGTAATTGGTTAGTTCCTATTATGATAGGAAGTCCAGACATGGCTTTCCCTAGACTAAACAATATATCTTTTTGACTCCTTCCACCTTCTTTATGCTTACTTTTAGCTTCTTCAATGGTTGAAGTAGGCGTTGGAACAGGATGAACTGTTTACCCTCCTCTTAGTTCGATACAAAGCCATTCAGGCGGAGCCGTCGATCTAGCAATTTTTAGCTTACATTTATCTGGAGCTTCCTCAATTTTAGGAGCTGTTAATTTTATTTCTACGATTCTAAATATGCGTAATCCTGGTCAAAGTATGTATCGAATGCCACTATTTGTTTGATCTATTTTTGTAACGGCATTCTTATTACTACTAGCTGTCCCAGTATTAGCAGGTGGAATTACTATGTTACTAACAGATCGAAATTTTAATACTTCTTTCTTTGACCCTGCAGGCGGAGGTGATCCAATTTTATATCAGCATCTCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ahnfeltia plicata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 100
Specimens with Barcodes: 105
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ahnfeltia plicata

Ahnfeltia plicata, the landlady's wig, is a species of red alga in the family Ahnfeltiaceae. It grows in northern parts of the Atlantic Ocean.

Contents

Description

The landlady's wig forms tufted perennial plants with wiry, much branched, cylindrical fronds that branch irregularly in a dichotomous manner. Each plant is about 15 cm (6 in) tall and 10 cm (4 in) wide. The holdfast is up to 2.5 cm (1 in) wide and composed of a thin layer encrusting the rock substrate.[2] The frond's reddish-black colour results from the red pigments phycoerythrin and phycocyanin. Their colour is so intense that it masks the presence of other pigments, chlorophyll a and beta-carotene. Some unique xanthophylls are also present in this seaweed.[1] The landlady's wig could be confused with Cordylecladia erecta but that species is less common and is thicker with more rigid, regularly branched fronds.[3]

Distribution and habitat

The landlady's wig is found on either side of the north Atlantic Ocean [3] from the middle shore down to depths of about twelve metres (forty feet). It grows on hard surfaces and is common on rock covered with sand and also occurs in rock pools.[4] It is sometimes torn from the rock in storms, resulting in floating mats of weed. The base of the fronds continue to grow even when they are detached from their holdfasts.[2]

Biology

The landlady's wig is a slow-growing species that may survive for five to ten years. It has different forms at different stages of its life cycle. On male plants there are spermatangial sori that form swellings on the middle parts of the frond. On female plants there are gametangial sori which are up to 5 millimetres (0.20 in) long. After fertilization of the carpogonium, carpospores are formed on the female frond. These produce a second diploid generation, giving rise to a tetrasporophyte form that often encrusts pebbles. This produces tetraspores which develop into new gametophyte plants.[4] The encrusting tetrasporophyte form is known as Porphyrodiscus simulans.[3]

Uses

The landlady's wig is used in the Soviet Union for the production of agar. It can also be eaten raw or cooked and is said to have a crunchy texture and pleasant taste.[2]

References

  1. ^ a b c Guiry, Michael D. (2012). "Ahnfeltia plicata (Hudson) E.M.Fries, 1836". World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=144422. Retrieved 2012-09-05.
  2. ^ a b c Surey-Gent, Sonia; Morris, Gordon (1987). Seaweed: A user's guide. London: Whittet Books. pp. 56–57. ISBN 0-905483-60-X. 
  3. ^ a b c "Ahnfeltia plicata (Hudson) Fries". The seaweed site. http://www.seaweed.ie/descriptions/Ahnfeltia_plicata.php. Retrieved 2012-09-06.
  4. ^ a b Rayment Will (2004). "A red seaweed - Ahnfeltia plicata". Marine Life Information Network (MarLIN). http://www.marlin.ac.uk/speciesfullreview.php?speciesID=2417. Retrieved 2012-09-05.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!