Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Biology

This semi-aquatic species is a versatile opportunistic predator (2) (4), preying on rabbits (Oryctolagus cuniculus), water voles (Arvicola terrestris), and many other mammals, as well as a range of fish, birds, eggs, crayfish, and a variety of invertebrates (6). This species has had a devastating effect on native species; it has been implicated in the precipitous decline of the water vole, and poses a serious threat to game birds, fish and birds nesting on offshore islands (6). Although it can be active at any time during the 24-hour period, the activity of the American mink tends to peak at night and at dusk (6). They are solitary and territorial, with the male home range overlapping several female ranges (6). Mating occurs once a year, between February and April (6). During this time males leave their territories and increase their range in search of females (2). A single litter of four to seven young is produced between April and May (6). When they reach 13 to 14 weeks of age, the young disperse away from the place of birth (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

The American Mink, with its luxurious brown coat, is now bred on farms, or mink ranches, to provide fur to the clothing industry. This has relieved some of the stress natural populations endured from trapping over the past two centuries. The nocturnal, semi-aquatic Mink is now common along streams, lakes, and marshes throughout much of North America. Like other mustelids, Mink are good hunters. They consume crayfish, frogs, fish, birds, and small mammals. For some reason, few animals prey on them.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: "Schreber, J.C.D., 1777.  in Schreber's Die Säugthiere in Abbildungen nach der Natur mit Beschreibungen, Wolfgang Walther, Erlangen, 7 volumes, 1774-1846; 3(19):pl. 127.B[1777]; text, 3(26):463[1777]."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

The introduced American mink has a slender body, short legs and a tail that is about a third of the body length (4). The thick, glossy fur can vary in colour, but is generally dark brown or black, and becomes darker in winter (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Throughout most of North America north of Mexico except for southwestern U.S. Introduced in Iceland, north-central Europe, British Isles, Norway, Belarussia, Baltic States, Spain, and Siberia (Wozencraft, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The species occurs in North America from Alaska and Canada through the United States except Arizona and the dry
parts of California, Nevada, Utah, New Mexico, and western Texas. The American mink was deliberately introduced as a fur animal in Russia, and in other parts of Europe and, as a result of escapes and their intentional release in Russia and other countries, the species is now naturalised in many parts of Europe (Mitchell-Jones et al., 1999). The european range area increased rapidly and now it includes: Belarus, Belgium, China, Czech Republic, Denmark, Estonia, Finland, France, Germany, Great Britian, Iceland, Ireland, Italy, Japan (Hokkaido), Latvia, Lithuania, Netherlands, Norway, Poland, Portugal, Russia, Spain, Sweden. Feral populations of American mink have been reported also in South America (Previtali, 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Mink are found throughout the United States, appearing in parts of every state except Arizona. They are also present in most of Canada, including an introduced population on Newfoundland. Only along the Arctic coast and some offshore islands are they absent.

American mink have also been accidentally introduced to the British Isles, where they escaped from fur farms in the 1960's. As a non-native predator their effects on native wildlife there are serious.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AR CA CO CT DE FL GA ID
IL IN IA KS KY LA ME MD MA MI
MN MS MO MT NE NV NH NJ NM NY
NC ND OH OK OR PA RI SC SD TN
TX UT VT VA WA WV WI WY
AB BC MB NB NF NT NS ON PE PQ
SK YK
GENERAL DISTRIBUTION:
American mink range across Canada, excepting the high Arctic, west through Alaska
and south throughout the United States except for the southwestern
deserts [10].
  • 10. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Mink are found throughout the United States, appearing in parts of every state except Arizona. They are also present in most of Canada, including an introduced population on Newfoundland. Only along the Arctic coast and some offshore islands are they absent.

American mink have also been inadvertently introduced to the British Isles, where they escaped from fur farms in the 1960's. As a non-native predator their effects on native wildlife there are serious.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

American mink, native to North America, were first introduced to fur farms in Britain in 1929; the first official record of escapees breeding in the wild was in 1957 (5). Following many accidental and deliberate releases, the species is now widespread and common throughout Britain and much of Europe (6). In Britain they are spreading in terms of range and numbers, extending into East Anglia and Yorkshire (6). However, in some areas of England the population is declining, this may be due to the return of the native otter (Lutra lutra) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Mink fur is usually dark brown with white patches on the chin, chest, and throat areas. The fur is soft and thick, with oily outer hairs that waterproof the animal's coat. The body is long and slender with short legs and a pointy, flat face. The toes are partially webbed, showing the mink's semi-aquatic nature. Body length is usually around 2 feet or 610 mm with up to half of this length being the tail. Females, on average, are smaller than males. Adult females weigh between 0.7 to 1.1 kg, while males range from 0.9 to 1.6 kilograms. Body length varies as well, with males measuring from 580 to 700 mm and females from 460 to 575 mm.

Range mass: 700 to 1600 g.

Range length: 460 to 700 mm.

Average length: 610 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Chapman, J., G. Feldhamer. 1982. Wild Mammals of North America. Baltimore and London: The Johns Hopkins University Press.
  • Van Gelder, R. 1982. Mammals of the National Parks. Baltimore, MD: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Mink fur is usually dark brown with white patches on the chin, chest, and throat areas. The fur is soft and thick, with oily guard hairs that waterproof the animal's coat (Chapman and Feldhamer 1982). The body is long and slender with short legs and a pointy, flat face. The toes are partially webbed, showing the mink's semi-aquatic nature. Body length is usually around 2 feet or 610 mm (Van Gelder 1982) with up to half of this length being the tail. Females, on average, are substantially smaller than males. Adult females weigh between 0.7 to 1.1 kg, while males range from 0.9 to 1.6 kilograms (Chapman and Feldhamer 1982). Body length varies as well, with males measuring from 580 to 700 mm and females from 460 to 575 mm (Chapman and Feldhamer 1982).

Range mass: 700 to 1600 g.

Range length: 460 to 700 mm.

Average length: 610 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Chapman, J., G. Feldhamer. 1982. Wild Mammals of North America. Baltimore and London: The Johns Hopkins University Press.
  • Van Gelder, R. 1982. Mammals of the National Parks. Baltimore, MD: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 72 cm

Weight: 1600 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are about 20% heavier than females.

Length:
Range: 550-700 mm males; 470-600 mm females

Weight:
Range: 550-1,250 g males; 550-1,000 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from weasels in having brown rather than white or yellowish underparts. Differs from marten in having a white chin patch (marten has pale buff patch on throat and breast), generally darker pelage (marten's pelage generally is yellowish brown except on the feet and end of the tail), and 4 rather than 5 upper postcanine teeth. Differs from the fisher in having 4 rather than 5 upper postcanine teeth, a white chin patch, and smaller size. River otter is much larger (up to 130 cm total length and 11 kg).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Central Pacific Coastal Forests Habitat

This taxon is found in the Central Pacific Coastal Forests ecoregion, as one of its North American ecoregions of occurrence. These mixed conifer rainforests stretch from stretch from southern Oregon in the USA to the northern tip of Vancouver Island, Canada. These forests are among the most productive in the world, characterized by large trees, substantial woody debris, luxuriant growths of mosses and lichens, and abundant ferns and herbs on the forest floor. The major forest complex consists of Douglas-fir (Pseudotsuga menziesii) and Western hemlock (Tsuga heterophylla), encompassing seral forests dominated by Douglas-fir and massive old-growth forests of Douglas-fir, Western hemlock, Western red cedar (Thuja plicata), and other species. These forests occur from sea level up to elevations of 700-1000 meters in the Coast Range and Olympic Mountains. Such forests occupy a gamut of environments with variable composition and structure and includes such other species as Grand fir (Abies grandis), Sitka spruce (Picea sitchensis), and Western white pine (Pinus monticola).

Characteristic mammalian fauna include Elk (Cervus elaphus), Black-tailed Deer (Odocoileus hemionus), Coyote (Canis latrans), Black Bear (Ursus americanus), Mink (Mustela vison), and Raccoon (Procyon lotor).

The following anuran species occur in the Central Pacific coastal forests: Coastal tailed frog (Ascaphus truei); Oregon spotted frog (Rana pretiosa VU); Northern red-legged frog (Rana pretiosa); Pacific chorus frog (Pseudacris regilla); Cascade frog (Rana cascadae NT), generally restricted to the Cascade Range from northern Washington to the California border; Foothill yellow-legged frog (Rana boylii) and the Western toad (Anaxyrus boreas NT).  A newt found in the ecoregion is the Rough skinned newt (Taricha granulosa).

Salamanders within the ecoregion are: Del Norte salamander (Plethodon elongatus NT);  Van Dyke's salamander (Plethodon vandykei); Western redback salamander (Plethodon vehiculum); Northwestern salamander (Ambystoma gracile);  Olympic torrent salamander (Rhyacotriton olympicus VU), whose preferred habitat is along richly leafed stream edges; Long-toed salamander (Ambystoma macrodactylum), whose adults are always subterranean except during the breeding season; Dunn's salamander (Plethodon dunni), usually found in seeps and stream splash zones; Clouded salamander (Aneides ferreus NT), an aggressive insectivore; Monterey ensatina (Ensatina eschscholtzii), usually found in thermally insulated micro-habitats such as under logs and rocks; Pacific giant salamander (Dicamptodon tenebrosus), found in damp, dense forests near streams; and Cope's giant salamander (Dicamptodon copei), usually found in rapidly flowing waters on the Olympic Peninsula and Cascade Range.

There are a small number of reptilian taxa that are observed within this forested ecoregion, including: Pacific pond turtle (Emys marmorata); Common garter snake (Thamnophis sirtalis), an adaptable snake most often found near water; Northern alligator lizard (Elgaria coerulea); and the Western fence lizard.

Numerous avian species are found in the ecoregion, both resident and migratory. Example taxa occurring here are the Belted kingfisher (Megaceryle alcyon); Wild turkey (Meleagris gallopavo); and the White-headed woodpecker (Picoides albolarvatus) and the Trumpeter swan (Cygnus buccinator), the largest of the North American waterfowl.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Favors forested, permanent or semipermanent wetlands with abundant cover, marshes, and riparian zones Dens in muskrat burrow, abandoned beaver den, hollow log, hole under tree roots, or in burrow dug by mink in streambank.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found along streams and lakes as well as in swamps and marshes. It prefers densely vegetated areas. It dens under stones or the roots of trees, in espropriated beaver or muskrat houses, or in self-excavated burrows (Nowak, 2005). The species can be found in xeric habitats if food is abundant (Arnold and Fritzell, 1990).
Strictly carnivorous, and its diet reflects the local prey base (Ben-David et al., 1997). Typical prey are fish, amphibians, crustaceans, muskrats, and small mammals (Birks and Dunstone, 1985; Bueno, 1994; Chanin and Linn, 1980; Cuthbert, 1979; Day and Linn, 1972). But other prey can be found occasionally (Larievière, 1999). Males have large home ranges that extend for a half mile or more along waterways and overlap with the smaller home ranges of several females (Wilson and Ruff, 1999).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although mink are found throughout North America, they tend to prefer forested areas that are close to water. Streams, ponds, and lakes, with some sort of brushy or rocky cover nearby are considered good mink habitat.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; savanna or grassland ; forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: riparian

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor, MI: The University of Michigan Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, density, marsh, shrub, shrubs, tree

Den sites are usually in thick cover and include hollow logs, natural
cavities under tree roots, or burrows along stream, marsh, and lake
edges [10]. Old beaver (Castor canadensis) lodges are occasionally used
as den sites [23]. In Idaho 53 percent of dens were in logjams [27].
In North Dakota marshlands, all dens were situated on shorelines and
appeared to be in abandoned muskrat burrows. Active dens were not
located where shorelines were heavily grazed. The absence of dry den
sites limits the use of some wetland habitats that are otherwise
suitable [1]. In Ontario dens were frequently found in areas with good
horizontal cover (31.4% obscurity at 3.5 m), and proportionally more
coniferous than deciduous shrubs. Dens were also in areas with
higher-than-average shrub density, deadfalls, stumps, and individual
trees [30].

In Michigan American mink were most commonly associated with brushy or wooded
cover adjacent to aquatic habitats [25]. In Quebec mink were normally
most active in wooded areas immediately adjacent to a stream channel
[6].
  • 1. Allen, Arthur W. 1986. Habitat suitability index models: mink. Biol. Rep. 82 (10.127). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 23 p. [11713]
  • 6. Burgess, S. A. 1978. Aspects of mink ecology in the southern Laurentians of Quebec. Montreal, PQ: McGill University. 87 p. Thesis. [27377]
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]
  • 25. Marshall, William H. 1936. A study of the winter activities of the mink. Journal of Mammalogy. 17(4): 382-392. [26030]
  • 30. Racey, G. D.; Euler, D. L. 1983. Changes in mink habitat and food selection as influenced by cottage development in central Ontario. Journal of Applied Ecology. 20(2): 387-402. [25984]
  • 27. Melquist, Wayne E.; Whitman, Jackson S.; Hornocker, Maurice G. 1981. Resource partitioning and coexistence of sympatric mink and river otter populations. In: Chapman, Joseph A.; Pursley, Duane, eds. Worldwide furbearer conference: Proceedings; 1980 August 3-11; Frostburg, MD. Volume I. [Place of publication unknow]: [Publisher unknown]: 187-220. [25995]
  • 10. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: cover, density, hydroperiod, shrub, succession

The critical habitat feature for American mink is water. American mink prefer
streambanks, lakeshores, and marshes [10]. Habitats associated with
small streams are preferred to habitats near large, broad rivers [1].
American mink favor forested wetlands with abundant cover such as shrub thickets,
fallen trees, and rocks [10]. In aspen (Populus spp.) parklands, male
American mink selected large, semipermanent and permanent wetlands with open
areas near shores, high water levels and irregular shorelines; these
characteristics are also associated with abundant avian prey [3]. American mink
are common where abundant downfall and debris creates cover for
foraging. Logjams in streams create crayfish and fish habitat and
shelter for American mink [1]. Peak American mink production in baldcypress (Taxodium
distichum) swamps occurred following extensive logging in the early part
of the twentieth century. Numbers have declined since then, probably
due to changed hydroperiod and decreased logging debris [23]. In Quebec
the majority of American mink activity takes place less than 3 miles (4.8 km)
from water [6]. In Michigan all American mink were observed within 100 feet
(30.4 m) of the water's edge [25]. In Minnesota all den sites were
within 231 feet (69.9 m) of open water [31]. In Idaho den sites were
16.5 to 330 feet (5-100 m) from water, and American mink were never observed more
than 660 feet (200 m) from water [27]. In southeastern Alaska mink
spend the summers along streams and in upland muskegs; they spend the
winter in a narrow ocean beach zone [26].

Wetlands with irregular, diverse shorelines are better American mink habitat than
those with straight, open, or exposed shorelines [1]. Marshall [25]
reported that 50 percent of American mink tracks in Michigan occurred in various
stages of hydrophytic succession, 37 percent in bushy and timbered
areas, and 13 percent in sedge (Carex spp.) and common cattail (Typhus
latifolia) type. In Alaska the highest American mink densities occurred in low
swampy terrain and in extensively interconnected waterways with abundant
fish [8].

More American mink are trapped in wooded swamps than in marshes. The reported
abundance of American mink in baldcypress-tupelo (Nyssa spp.) swamps is at least
partially attributable to the abundance of food [1].

In upland habitats, ecotones are most used; American mink avoid open areas and
prefer shrubby, dense thickets. Tall grass does not usually provide
adequate cover for American mink; however, sawgrass (Cladium jamaicense) marshes
in Louisiana support high American mink densities [1].

American mink are adaptable in their use of habitat, particularly where prey are
readily available. They are tolerant of human activity. American mink inhabit
suboptimal habitats if prey is available, but are more mobile and change
home ranges more frequently in suboptimal than in optimal habitats [1].

Home Range: American mink home ranges tend to approximate the shape of the body
of water the American mink uses most [1]. However, in the prairie pothole
region, American mink tend to use an area rather than a linear shoreline [2].
The use of the home range varies in intensity with respect to varying
prey availability. American mink tend to use a core area near a den site,
usually within 990 feet (300 m) of the shoreline. They move to another
den and core area several times a season; core areas tend to be places
of relatively high prey abundance. Usually only a small percentage of
the average or overall home range is used as the core area. In winter
fewer den sites are used, occupancy is of longer duration, and daily
travel distances are shorter than in summer [1].

Male American mink have larger average home ranges than females [1,23]. Females
tend to use a greater proportion of their home range as a core area then
males do [23]. Mitchell [29] reported the average home range for male
American mink in Montana was 2 to 3 miles (3.2-4.8 km) in diameter. Vegetative
cover has a substantial impact on home range size in Montana: female
home ranges in heavily vegetated areas averaged 19 acres (7.7 ha),
whereas in sparse, heavily grazed areas they averaged 50 acres (20.1 ha)
[29]. In Michigan male American mink average home range was less than 20 acres
(8 ha) [25]. In Idaho males used 0.6 to 1.25 miles (1-2 km) of
shoreline [27]. In British Columbia mink density on Vancouver Island
ranged from 1.5 to more than 3 American mink per kilometer of shoreline [18].
Gerell [15] reported that adult male American mink used an average of 8,679 feet
(2630 m) of shoreline, ranging from 5,940 to 16,500 feet (1800-5000 m).
Female adults used 3,300 to 9,240 feet (1000-2800 m), and juvenile males
used 3,465 to 4,620 feet (1050-1400 m).

In North Dakota prairie pothole regions, American mink home ranges were not
linear. Average home ranges were 1 to 1.5 square miles (2.59-3.8 sq km)
and typically included many individual wetlands [1]. In Manitoba
prairie pothole areas, male home ranges had maximum lengths of 3.1 miles
(5.1 km) and maximum widths of 1.9 miles (3.1 km); prairie American mink tended
to have larger home ranges than other American mink populations [2].

Home ranges of individuals rarely overlap, with the exception of the
breeding season when male home ranges overlap those of females [1].
  • 1. Allen, Arthur W. 1986. Habitat suitability index models: mink. Biol. Rep. 82 (10.127). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 23 p. [11713]
  • 2. Arnold, Todd W.; Fritzell, Erik K. 1987. Activity patterns, movements, and home ranges of prairie mink. Prairie Naturalist. 19(1): 25-32. [25980]
  • 3. Arnold, Todd W.; Fritzell, Erik K. 1990. Habitat use by male mink in relation to wetland characteristics and avian prey abundances. Canadian Journal of Zoology. 68(10): 2205-2208. [25985]
  • 6. Burgess, S. A. 1978. Aspects of mink ecology in the southern Laurentians of Quebec. Montreal, PQ: McGill University. 87 p. Thesis. [27377]
  • 8. Burns, John James. 1964. The ecology, economics and management of mink in the Yukon-Kuskokwim Delta, Alaska. Fairbanks, AK: University of Alaska. 114 p. Thesis. [26085]
  • 15. Gerell, Rune. 1967. Food selection in relation to habitat in mink (Mustela vison Schreber) in Sweden. Oikos. 18: 233-246. [26031]
  • 18. Hatler, David Francis. 1976. The coastal mink on Vancouver Island, British Columbia. Vancouver, BC: University of British Columbia. 376. Dissertation. [27113]
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]
  • 25. Marshall, William H. 1936. A study of the winter activities of the mink. Journal of Mammalogy. 17(4): 382-392. [26030]
  • 26. Meehan, William R. 1974. The forest ecosystem of southeast Alaska: 4. Wildlife habitats. Gen. Tech. Rep. PNW-16. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 32 p. [13479]
  • 29. Shafroth, Patrick B.; Auble, Gregor T.; Scott, Michael L. 1995. Germination and establishment of the native plains cottonwood (Populus deltoides ssp. monilifera) and the exotic Russian-olive (Elaeagnus angustifolia L.). Conservation Biology. 9(5): 1169-1175. [26012]
  • 31. Schladweiler, J. S.; Storm, G. L. 1969. Den-use by mink. Journal of Wildlife Management. 33(4): 1025-1026. [27112]
  • 27. Melquist, Wayne E.; Whitman, Jackson S.; Hornocker, Maurice G. 1981. Resource partitioning and coexistence of sympatric mink and river otter populations. In: Chapman, Joseph A.; Pursley, Duane, eds. Worldwide furbearer conference: Proceedings; 1980 August 3-11; Frostburg, MD. Volume I. [Place of publication unknow]: [Publisher unknown]: 187-220. [25995]
  • 10. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the terms: forb, fresh, hardwood, marsh

203 Riparian woodland
217 Wetlands
409 Tall forb
411 Aspen woodland
421 Chokecherry-serviceberry-rose
422 Riparian
805 Riparian
806 Gulf Coast salt marsh
807 Gulf Coast fresh marsh
809 Mixed hardwood and pine
811 South Florida flatwoods
812 North Florida flatwoods
813 Cutthroat seeps
814 Cabbage palm flatwoods
815 Upland hardwood hammocks
816 Cabbage palm hammocks
817 Oak hammocks
818 Florida salt marsh
820 Everglades flatwoods
821 Pitcher plant bogs
822 Slough

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

American mink occur in most SAF cover types, except those in the
southwestern deserts.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

American mink occur in most Kuchler plant associations, except those in the
southwestern deserts.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES41 Wet grasslands
FRES44 Alpine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

American mink occur in a wide variety of plant communities. They are associated
with water rather than with particular habitat types. American mink are more
often associated with coniferous and mixed forests than deciduous
forests. They are also found in grassland environments if open water or
marshland is present [1].
  • 1. Allen, Arthur W. 1986. Habitat suitability index models: mink. Biol. Rep. 82 (10.127). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 23 p. [11713]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although mink are found throughout North America, they tend to frequent forested areas that are in close proximity to water. Streams, ponds, and lakes, with some sort of brushy or rocky cover nearby are considered optimal territory.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; savanna or grassland ; forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: riparian

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor, MI: The University of Michigan Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lives in aquatic habitats, but can spend some time away from water and can even live near urban areas (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Male home range considerably larger than that of female; average for female 20-50 acres (not more than 20 acres according to Layne 1978), for male 1900 acres plus (Banfield 1974, Schwartz and Schwartz 1981), up to 8 km (5 mi.) in diameter (Caire et al. 1989). In Tennessee, fall-early winter home range of three males (2 adults, 1 juvenile) was 5.6-11.1 km of stream; overnight movements were as large as 4.3 km (Stevens et al. 1997). In England, partial-year home range was 4.5-8.6 km (mean 6.0 km) of water course in males and 0.8-4.3 km (mean 2.7 km) in females (Yamaguchi and Macdonald 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Small mammals, other vertebrates (e.g., waterfowl), crayfish, and small vertebrates associated with aquatic/riparian ecosystems. Muskrats (ONDATRA ZIBETHICUS) particularly are favored in some areas, but diet reflects availability.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The diet of mink varies with the season. During the summer they eat Cambaridae and small anura, along with small mammals such as soricidae, leporidae, muridae, and ondatra zibethicus. actinopterygii, anatidae and other water fowl provide additional food choices. In the winter, they mostly prey on mammalia.

Animal Foods: birds; mammals; amphibians; reptiles; fish; aquatic crustaceans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

American mink are almost exclusively carnivorous. They are excellent swimmers
and pursue both aquatic and terrestrial prey. American mink diets vary with
season, habitat, and availability of prey [1]. No single food item is
consistently more important than others [23]. Commonly important items
include common muskrats (Ondatra zibethecus), voles (Microtus spp.),
cottontails (Sylvilagus spp.), fish (mostly Salmonidae), birds, frogs,
salamanders, crayfish, clams, and insects [1,10,23]. Carey [9] listed
American mink as a common predator of Townsend's chipmunks (Tamias townsendii) in
the Pacific Northwest. Allen [1] listed American mink prey preference in the
following order: 1) aquatic prey, including fish and crayfish, 2)
semi-aquatic prey including waterfowl and water-associated mammals such
as common muskrat, and 3) terrestrial prey including rabbits and
rodents.

In Idaho fish comprised 59 percent of American mink diets [27]. Birds are
important prey where fish and crayfish are scarce. In Louisiana
crayfish are so prominent in American mink diets that their abundance largely
determines American mink population size [1]. In Alaska coastal populations of
American mink tend to be higher than inland populations due to the ready
availability of prey in tide pools [1]. Eberhardt and Sargeant [12]
reported that American mink diets in North Dakota prairie marshes were dominated
by birds (78%); other prey included mammals (19%), amphibians (2%), and
reptiles (1%). Of the avian prey, the majority were waterfowl including
American coot (Fulica americana), ducks (Anatidae), and grebes
(Podicipedidae) [12]. In southern Manitoba mink are important nest
predators of waterfowl [11]. In North Dakota American mink predation on
ducklings typically occurs in semipermanent wetlands [1].

Seasonal Variation in Diet: Shallow water and low flow rates contribute
to effective aquatic foraging by American mink. American mink tend to eat more fish in
winter when fish are more accessible. In autumn terrestrial mammals
tend to increase in importance as prey. Terrestrial mammals comprised
43 percent of American mink diets in riparian areas in Idaho and comprised over
20 percent of American mink fall/winter diets in North Carolina [1]. In Quebec
crayfish were the most important dietary item in summer [6]. In winter
American mink hunting over ice can easily penetrate active common muskrat lodges,
but cannot get into common muskrat burrows so easily [28].
  • 1. Allen, Arthur W. 1986. Habitat suitability index models: mink. Biol. Rep. 82 (10.127). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 23 p. [11713]
  • 6. Burgess, S. A. 1978. Aspects of mink ecology in the southern Laurentians of Quebec. Montreal, PQ: McGill University. 87 p. Thesis. [27377]
  • 9. Carey, Andrew B. 1991. The biology of aboreal rodents in Douglas-fir forests. Gen. Tech. Rep. PNW-276. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 46 p. [18163]
  • 11. Diiro, Bruce Warren. 1982. Effects of burning and mowing on seasonal whitetop ponds in southern Manitoba. Ames, IA: Iowa State University. 48 p. Thesis. [23497]
  • 12. Eberhardt, Lester E.; Sargeant, Alan B. 1977. Mink predation on prairie marshes during the waterfowl breeding season. In: Proceedings of the predator symposium; 1975; Missoula, MT. Missoula, MT: University of Montana, School of Forestry, Montana Forest and Conservation Experiment Station: 33-43. [26032]
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]
  • 28. Messier, Francois; Virgl, John A. 1992. Differential use of bank burrows and lodges by muskrats, Ondatra zibethicus, in a northern marsh environment. Canadian Journal of Zoology. 70(6): 1180-1184. [18437]
  • 27. Melquist, Wayne E.; Whitman, Jackson S.; Hornocker, Maurice G. 1981. Resource partitioning and coexistence of sympatric mink and river otter populations. In: Chapman, Joseph A.; Pursley, Duane, eds. Worldwide furbearer conference: Proceedings; 1980 August 3-11; Frostburg, MD. Volume I. [Place of publication unknow]: [Publisher unknown]: 187-220. [25995]
  • 10. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The diet of mink varies with the season. During the summer it consists of crayfish and small frogs, along with small mammals such as shrews, rabbits, mice, and muskrats. Fish, ducks and other water fowl provide additional food choices. In the winter, they primarily prey on mammals.

Animal Foods: birds; mammals; amphibians; reptiles; fish; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Mink are important predators of small mammals throughout their range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Mink have few natural enemies. They are occasionally killed by canis latrans, lynx rufus and other carnivora, but their main threat remains humans. Mink, like most mustelidae, are aggressive and fearless predators. They do not hesitate to defend themselves against animals larger than themselves. Mink may be occasionally taken by falconiformes, or young in a nest may be taken by serpentes, but they are agile, secretive in nature, and they blend in with their background, so they can avoid most predators.

Known Predators:

  • canis latrans
  • lynx rufus
  • serpentes
  • falconiformes

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

American mink mortality due to predators other than humans is not substantial.
Occasional predators include fisher (Martes pennanti), red fox (Vulpes
vulpes), gray fox (Urocyon cinereoargenteus), bobcat (Lynx rufus), lynx
(L. lynx), gray wolf (Canis lupus), American alligator (Alligator
mississippiensis), and great horned owl (Bubo virginianus) [23].
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Animal / parasite / ectoparasite / blood sucker
Ixodes hexagonus sucks the blood of Mustela vison

Animal / parasite / ectoparasite / blood sucker
Ixodes ricinus sucks the blood of Mustela vison

Animal / predator
Mustela vison is predator of nest of Bombus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Mink are important predators of small mammals throughout their range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Mink have few natural enemies. They are occasionally killed by coyotes, bobcats and other carnivores, but their main threat remains humans. Mink, like most mustelids, are aggressive and fearless predators. They do not hesitate to defend themselves against animals larger than themselves. Mink may be occasionally taken by birds of prey, or young in a nest may be taken by snakes, but they are agile, cryptic in coloration, and secretive in nature, thereby avoiding most predation.

Known Predators:

  • coyotes
  • bobcats
  • snakes
  • birds of prey

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Numerous occurences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Solitary except during mating period and when females have young.

In good habitat, density may be 9-22 per sq mile (Banfield 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: cover, density, shrub, snag

There are no reports in the literature linking fire-caused habitat
changes to American mink. Fire along streambanks that reduces cover and downed
logs would have a negative impact on American mink activity. Reduction of fish
and crayfish due to changes in stream conditions would adversely affect
American mink. Conversely, fire that resulted in increased snag numbers and
stream channel downfalls, shrub density, and herbaceous vegetation cover
would probably encourage American mink activity.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the term: litter

Diurnal Activity: American mink are chiefly nocturnal but also somewhat
crepuscular [1]. In Manitoba radio-collared American mink were most active at
night, with intermediate levels of activity at dawn and dusk. They were
more active, with more extensive movements, in April than in May, June,
or July [2].

Breeding season: In most areas the mating period occurs from late
February to early April, peaking in March [1,23]. In southern Florida,
however, American mink mate in the late wet season (autumn). Hydroperiod
determines prey abundance and availability in southern Florida, which
appear to determine breeding season. Female American mink were found to be
lactating in March and April, slightly earlier than populations farther
north [19].

Gestation and Development of Young: Gestation ranges from 40 to 75
days, depending on pre-implantation period. Young are born 28 to 30
days after implantation, in April or May [1,10,23]. Neonates are
altricial and have sparse, light-colored hairs. The first teeth emerge
at 2 to 3 weeks, eyes open at about 3 weeks, and solid food is first
taken at about the same time. By 35 days the young are fully
homeothermic. By 7 weeks they have achieved 40 percent of their adult
body weight and 60 percent of adult body length. Litters disperse in
early fall [23]. Females attain adult weight at 4 months; males do not
attained adult weight until 9 to 11 months [4].

Productivity: A typical litter consists of 3 or 4 kits and ranges from
2 to 10. The average age at sexual maturity is 12 months for females,
18 months for males [4]. Neonates have higher survival rates in warm
than in cold weather. American mink have been reported to remain fecund for 7 or
more years [23].
  • 1. Allen, Arthur W. 1986. Habitat suitability index models: mink. Biol. Rep. 82 (10.127). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 23 p. [11713]
  • 2. Arnold, Todd W.; Fritzell, Erik K. 1987. Activity patterns, movements, and home ranges of prairie mink. Prairie Naturalist. 19(1): 25-32. [25980]
  • 4. Banfield, A. W. F. 1974. The mammals of Canada. Toronto: University of Toronto Press. 438 p. [25152]
  • 19. Humphrey, Stephen R.; Zinn, Terry L. 1982. Seasonal habitat use by river otters and Everglades mink in Florida. Journal of Wildlife Management. 46(2): 375-381. [25986]
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]
  • 10. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Mink communicate using odors, visual signals, and sounds. They are fairly quiet, but rely heavily on odors for communicating territorial boundaries and for finding mates.

Mink have excellent senses of vision, smell, and hearing.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Mink communicate using a variety of cues, including chemical, visual, and auditory signals. They are fairly quiet, but rely heavily on chemical signaling for communicating territorial boundaries and reproductive status.

Mink have excellent senses of vision, smell, and hearing.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Mainly nocturnal and crepuscular. May reduce activity in severe winter weather.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The maximum lifespan for a mink is usually around 10 years.

Typical lifespan

Status: wild:
10 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The maximum lifespan for a mink is usually around 10 years.

Typical lifespan

Status: wild:
10 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11.4 years (captivity) Observations: In the wild, these animals may live up to 10 years (Bernhard Grzimek 1990). In captivity they may live 11.4 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeds in northern states late February to early May, peak in March. Gestation lasts 40-75 (average 51) days; implantation is delayed. Litter size is 2-10 (average 3-4). Young begin to venture from nest after about 7 weeks, weaned at 8-9 weeks. Male sometimes may help care for young. Sexually mature in 10 months.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the winter, female mink become fertile and mate with one or more males (who also have more than one mate).

Mating System: polygynandrous (promiscuous)

Both males and females begin mating at ten months. A female's pregnancy period varies from 40 to 75 days. The young are born in late spring (April or May), with litter sizes usually ranging between 1 to 8 individuals. Each newborn weighs 8 to 10 grams and appears pink and wrinkled, with a thin coat of white fur covering the body.

Breeding interval: Breeding occurs once yearly.

Breeding season: Mating occurs during the winter months.

Range number of offspring: 1 to 8.

Range gestation period: 40 to 75 days.

Average weaning age: 6 weeks.

Range time to independence: 6 to 10 months.

Average age at sexual or reproductive maturity (female): 10 months.

Average age at sexual or reproductive maturity (male): 10 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

The young open their eyes at three and a half weeks and are weaned at a month and a half. They remain with the mother through the summer until fall, when they leave to establish their own territories.

Parental Investment: altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor, MI: The University of Michigan Press.
  • Chapman, J., G. Feldhamer. 1982. Wild Mammals of North America. Baltimore and London: The Johns Hopkins University Press.
  • Van Gelder, R. 1982. Mammals of the National Parks. Baltimore, MD: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the winter, female mink become fertile and mate with one or more males (who are also promiscuous).

Mating System: polygynandrous (promiscuous)

Both males and females begin mating at ten months (Chapman and Feldhamer 1982). Once a female is impregnated, her gestation period varies from 40 to 75 days (Kurta 1995). The young are born in late spring (April or May), with litter sizes usually ranging between 1 to 8 individuals (Chapman and Feldhamer 1982). Each newborn weighs 8 to 10 grams and appears pink and wrinkled, with a thin coat of white fur covering the body.

Breeding interval: Breeding occurs once yearly.

Breeding season: Mating occurs during the winter months.

Range number of offspring: 1 to 8.

Range gestation period: 40 to 75 days.

Average weaning age: 6 weeks.

Range time to independence: 6 to 10 months.

Average age at sexual or reproductive maturity (female): 10 months.

Average age at sexual or reproductive maturity (male): 10 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

The young open their eyes at three and a half weeks and are weaned at a month and a half (Van Gelder 1982). They remain with the mother through the summer until fall, when they leave to establish their own territories.

Parental Investment: altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor, MI: The University of Michigan Press.
  • Chapman, J., G. Feldhamer. 1982. Wild Mammals of North America. Baltimore and London: The Johns Hopkins University Press.
  • Van Gelder, R. 1982. Mammals of the National Parks. Baltimore, MD: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neovison vison

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAATCGATGATTATTTTCTACTAACCATAAAGATATTGGCACCCTCTACCTTTTATTCGGCGCATGAGCCGGAATAGTAGGAACTGCTCTTAGTCTTCTAATCCGTGCTGAACTAGGTCAACCTGGCGCCCTGCTAGGAGACGACCAGATTTACAATGTAATCGTAACAGCCCACGCATTTGTAATAATTTTCTTCATAGTAATACCTATTATAATTGGGGGCTTTGGAAACTGACTCATCCCTCTGATAATCGGTGCACCTGATATAGCATTTCCACGAATAAATAATATAAGCTTCTGACTTCTACCCCCCTCTTTCCTTCTCCTTTTAGCTTCCTCAATGGTAGAGGCAGGCGCAGGAACAGGATGAACCGTTTATCCTCCCTTAGCAGGAAACCTAGCACACGCAGGAGCATCCGTAGACCTAGCAATTTTCTCCCTACACTTAGCAGGAATTTCATCTATTCTAGGGTCTATCAACTTTATCACTACTATTATTAACATAAAACCTCCCGCTATATCACAATACCAAACCCCCTTATTCGTATGATCTGTCTTAGTTACAGCTGTATTACTACTTCTATCCTTGCCAGTCCTAGCAGCAGGTATTACTATGTTACTCACGGACCGCAATCTGAATACTACTTTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTATATCAACACCTATTCTGATTTTTCGGACACCCCGAAGTTTATATCTTAATTCTACCAGGATTTGGCATTATTTCACATGTAGTAACTTACTACTCAGGAAAAAAAGAACCTTTTGGTTACATAGGGATAGTATGAGCAATGATATCAATCGGCTTCCTAGGATTTATTGTATGAGCCCACCATATGTTCACTGTAGGCCTAGACGTAGACACACGAGCATATTTCACTTCAGCTACCATAATTATTGCTATCCCAACAGGTGTAAAAGTATTTAGCTGATTAGCTACGCTGCACGGAGGGAACATCAAATGATCTCCAGCTATGCTATGGGCCTTAGGGTTTATCTTTTTATTTACAGTGGGTGGCTTAACGGGTATTGTATTATCAAACTCATCACTAGACATCGTTCTTCACGATACATATTACGTAGTAGCACATTTTCACTACGTTCTTTCAATAGGGGCAGTATTTGCAATCATAGGCGGATTCGTTCACTGGTTCCCATTATTTACAGGCTACACCCTAAATGATACTTGAGCAAAAATCCACTTTACAATCATATTTGTAGGAGTAAATATAACATTCTTTCCCCAACATTTCCTAGGATTATCAGGTATACCTCGACGCTACTCTGATTACCCAGACGCATACACAACATGAAACACAGTATCTTCCATAGGCTCATTCATTTCACTAACAGCAGTAATACTAATAATCTTCATAATTTGAGAAGCCTTTGCATCCAAACGAGAAGTATCTACAGTAGAATTAACCTCAACAAACATCGAATGACTACATGGATGTCCTCCCCCATACCACACATTCGAAGAACCAACCTATGTATTATCCAAGTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Neovison vison

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in North America, and introduced and established in the Old World; local declines have occurred, but the species is secure in many areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reid, F. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern as the species has a wide distribution range and is relatively common across its range. Although local declines have occurred, the species is secure in many areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The biggest threat towards mink survival is the continued existence of the fur market. Forty-seven states and all Canadian provinces now have limited trapping seasons on mink, with the length of the season varying from area to area. Limits on the number of mink that can be caught have also been set in many places. Both of these strategies allow the limited removal of mink in order that wild populations will remain constant.

Another threat includes the destruction of mink habitat. Mink depend heavily on wetlands. Creating, enhancing, and maintaining such habitat allows for the continued existence of healthy populations throughout the range of the species.

The presence of pollution such as mercury and hydrocarbon compounds (e.g., DDT and PCBs) also threatens mink. These chemicals build up within the mink's tissues and can cause problems in reproduction or even threaten the animal's life. Closer regulation over the use and disposal of these chemicals is necessary.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Information on state- and province-level protection status of animals in the
United States and Canada is available at NatureServe, although recent
changes in status may not be included.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S. Federal Legal Status

None [34]
  • 34. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]. Available: http://www.fws.gov/endangered/. [86564]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The main threat towards mink survival is the continued existence of the fur market. Forty-seven states and all Canadian provinces currently conduct limited trapping seasons on mink, with the length of the season varying from area to area (Chapman and Feldhamer 1982). Quotas on catch size have also been set in many places. Both of these tactics allow the limited removal of mink in order that population densities will remain constant.

Another threat includes the destruction of mink habitat. Mink depend heavily on aquatic areas. Creating, enhancing, and maintaining such habitat allows for the continued existence of healthy populations throughout the range of the species (Chapman and Feldhamer 1982).

The presence of environmental contaminants such as mercury and hydrocarbon compounds (e.g., DDT and PCBs) pose an additional threat to mink (Kurta 1995). These chemicals accumulate within the mink's tissues and can cause problems in reproduction or even threaten the animal's life. Closer regulation over the use and disposal of these chemicals is necessary.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Introduced. Dispersal of American mink is controlled by the following legislation: Mink Keeping Order 2000 (separate Acts relevant for England, Wales and Scotland). Release of American mink is illegal under Schedule 9 (Part I) of the Wildlife and Countryside Act 1981 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Generally abundant throughout its distribution (Larivière, 1999). Population density of about 1-8/km2 have been recorded (Nowak, 2005). In good habitat, density may be 9-22 per sq mile (Banfield 1974).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Wild populations of American mink are still hunted for fur. Alteration of its habitat, namely densely vegetated river courses and other wetlands represents another threat for this species. The American mink is known to suffer from environmental pollution caused by chlorinated hydrocarbons (PCBs) which may even cause infertility (Schreiber et al., 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Other than preying on our native fauna, the American mink may also carry Aleutian disease, a virus of fur farms that can be transmitted to native carnivores (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
American mink is currently the most important species in fur-fanning operations (Peterson, 1966; Thompson, 1968). The American mink is among the most valuable fur animals, most of the mink fur used in commerce is produced on farms (Nowak, 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the terms: cover, density, shrubs

In Quebec Burgess [6] noted an increase in American mink activity with habitat
improvement consisting of the creation of pools at least 1 meter deep by
placing logs and/or rocks into the stream channel which formed small
dams. It was reported that 1) temperatures were similar in control and
improved sections of stream, 2) aquatic insect production was somewhat
higher in the improved section, and 3) trout and crayfish biomasses were
higher in the improved section [7].

Development of shorelines that reduces structural diversity and removes
snags and debris reduces American mink activity. Removal of downfall and other
debris from the water near shore, and reduction or elimination of
aquatic vegetation reduces crayfish production and contributes to
reduced American mink activity [1]. In Ontario residential development around
lakes resulted in decreased American mink activity due to loss of trees, decreased
density of shrubs, reduction of aquatic snags, and removal of submergent
and floating vegetation. In areas undergoing development, 52 of 59 dens
were on undeveloped sections of shoreline [30].

Stream channelization has a negative impact on American mink activity since
suitable prey abundance is reduced when shallow, detritus-rich sloughs
associated with meandering streams are replaced with abrupt, monotypic
interfaces between aquatic and terrestrial cover types. In Mississippi
and Alabama comparison of American mink activity was made among a newly
channelized segment, an old (55 years) channelized segment, and an
unchannelized segment of a river. American mink track counts were highest in the
unchannelized segment, lower in the old channelized segment, and very
sparse in the newly channelized areas. Abundance and density of
herbaceous vegetation were highest on the unchannelized segment [16].

There are controlled American mink trapping seasons in 47 states and all
provinces. Hunting is also allowed in five states as well as in Nova
Scotia [23]. Trapping rates fluctuate widely from year to year; price
and harvest are not significantly correlated. The extent to which
trapping affects populations is not known [23]. Fur harvest records,
though not necessarily direct indications of population levels, show
that Louisiana, Minnesota, and Wisconsin produce the most wild pelts in
the United States. Saskatchewan and Manitoba lead the numbers in
Canada. These harvest records reflect the relative amount of wetlands
in the leading American mink producing areas [1]. In southeastern Alaska mink is
the most abundantly harvested furbearer [26].

Linscombe and others [23] discuss parasites and diseases of American mink.
  • 1. Allen, Arthur W. 1986. Habitat suitability index models: mink. Biol. Rep. 82 (10.127). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 23 p. [11713]
  • 6. Burgess, S. A. 1978. Aspects of mink ecology in the southern Laurentians of Quebec. Montreal, PQ: McGill University. 87 p. Thesis. [27377]
  • 7. Burgess, Stephen A.; Bider, J. R. 1980. Effects of stream habitat improvements on invertebrates, trout populations, and mink activity. Journal of Wildlife Management. 44(4): 871-880. [25982]
  • 16. Gray, Marion H.; Arner, Dale H. 1977. The effects of channelization on furbearers and furbearer habitat. Proceedings, Annual Conference of Southeastern Association of Fish and Wildlife Agencies. 31: 259-265. [25340]
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]
  • 26. Meehan, William R. 1974. The forest ecosystem of southeast Alaska: 4. Wildlife habitats. Gen. Tech. Rep. PNW-16. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 32 p. [13479]
  • 30. Racey, G. D.; Euler, D. L. 1983. Changes in mink habitat and food selection as influenced by cottage development in central Ontario. Journal of Applied Ecology. 20(2): 387-402. [25984]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Eradication of mink throughout Britain is unlikely and would be extremely expensive; however, populations remain low where regular culling is carried out on a local basis. Sensitive areas could be fenced off (5), and on previously predator free islands, such as Harris, which supports internationally significant populations of nesting sea birds; eradication of mink is essential (5). It is now apparent that in areas where otters have made a recovery, mink have been declining (5), this is certainly encouraging news.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Raised and trapped for pelt, which yielded about $17 per pelt in the early 1980s in Oklahoma (Caire et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

The only negative affects that mink might have is the possible competition between mink and humans for water fowl or other game species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Mink pelts have for years been considered one of the most luxurious furs on the market. Originally all fur came from wild mink, causing a severe strain on the species. However, starting in the mid 1900s, mink ranches were set up to help bring a more constant pelt supply to the market. Ranching was very successful, with the number of mink ranches in the United States reaching a high of 7200 during the mid-1960s. While the number of ranches has declined nationally to 439 (1998), a total of 2.94 million pelts were still produced (both wild and domestic mink), that were valued at $72.9 million dollars. The quality of a pelt, which affects the price, is determined by its size, color, texture and density.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

The only negative affects that can be attributed to mink is the possible competition between mink and humans for water fowl or other game species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Mink pelts have for years been considered one of the most luxurious furs on the market. Originally all fur came from natural populations, causing a severe strain on the species. However, starting in the mid 1900s, mink ranches were established to help bring a more consistent pelt supply to the market. Ranching was very successful, with the number of mink ranches in the United States reaching a high of 7200 during the mid-1960s (Chapman and Feldhamer 1982). While the number of ranches has declined nationally to 439 (1998), a total of 2.94 million pelts were still produced (both wild and domestic mink), that were valued at $72.9 million dollars (USDA 1999). The quality of a pelt, which significantly affects the price, is determined by its size, color, texture and density.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

American mink

This article is about animal. For the trademark of the same name, see American Legend Cooperative.

The American mink (Neovison vison) is a semiaquatic species of mustelid native to North America, though human intervention has expanded its range to many parts of Europe and South America. Because of range expansion, the American mink is classed as Least Concern by the IUCN.[1] Since the extinction of the sea mink, the American mink is the only extant member of the genus Neovison. The American mink is a carnivore which feeds on rodents, fish, crustaceans, frogs, and birds. In its introduced range in Europe it has been classified as an invasive species linked to declines in European mink, Pyrenean desman, and water vole populations. It is the most frequently farmed animal for its fur, exceeding the silver fox, sable, marten, and skunk in economic importance.[3]

Indigenous names[edit]

Evolution[edit]

As a species, the American mink represents a more specialized form than the European mink in the direction of carnivory, as indicated by the more developed structure of the skull.[5] Fossil records of the American mink go back as far as the Irvingtonian, though the species is uncommon among Pleistocene animals. Its fossil range corresponds with the species' current natural range. The American minks of the Pleistocene did not differ much in size or morphology from modern populations, though a slight trend toward increased size is apparent from the Irvingtonian through to the Illinoian and Wisconsinan periods.[6]

Although superficially similar to the European mink, studies indicate the American mink's closest relative is the Siberian weasel (kolonok) of Asia. The American mink has been recorded to hybridize with European minks and polecats in captivity, though the hybrid embryos of the American and European minks are usually reabsorbed.[7]

Subspecies[edit]

As of 2005,[8] 15 subspecies are recognised.

Physical description[edit]

Build[edit]

Skeleton of an American mink from the Muséum national d'histoire naturelle
Skull, as illustrated by N. N. Kondakov.

The American mink differs from members of the genus Mustela (stoats and weasels) by its larger size and stouter form, which closely approach those of martens. It shares with martens a uniformly enlarged, bushy and somewhat tapering tail, rather than a slenderly terete tail with an enlarged bushy tip, as is the case in stoats.[10] The American mink is similar in build to the European mink, but the tail is longer (constituting 38-51% of its body length).[11]

The American mink has a long body, which allows the species to enter the burrows of prey. Its streamlined shape helps it to reduce water resistance whilst swimming.[12] The skull is similar to that of the European mink, but is more massive, narrower, and less elongated, with more strongly developed projections and a wider, shorter cranium. The upper molars are larger and more massive than those of the European mink.[13] The dental formula is:

Dentition
3.1.3.1
3.1.3.2

Domestic mink, which are bred in fur farms, have 19.6% smaller brains, 8.1% smaller hearts, and 28.2% smaller spleens than wild mink.[14][15] The feet are broad, with webbed digits.[10] It generally has eight nipples, with one pair of inguinal teats and three pairs of abdominal teats.[11] The adult male's penis is 2.2 in (5.6 cm) long, and is covered by a sheath. The baculum is well-developed, being triangular in cross section and curved at the tip.[12]

Males measure 13–18 in (34–45 cm) in body length, while females measure 12–15 in (31–37.5 cm). The tail measures 6–10 inches (15.6–24.7 cm) in males and 6–8 in (14.8–21.5 cm) in females. Weights vary with sex and season, with males being heavier than females. In winter, males weigh 1–3 lb (500–1,580 g) and females 1–2 lb (400–780 g) Maximum heaviness occurs in autumn.[5]

American mink paws, as illustrated by Ernest Thompson Seton

Fur[edit]

The American mink's winter fur is denser, longer, softer, and more close-fitting than that of the European mink. The winter fur's tone is generally very dark blackish-tawny to light-tawny. Colour is evenly distributed over all the body, with the lower side being only slightly lighter than the upper body. The guard hairs are bright and dark-tawny, often approaching black on the spine. The underfur on the back is very wavy and greyish-tawny with a bluish tint. The tail is darker than the trunk and sometimes becomes pure black on the tip. The chin and lower lip are white. Captive individuals tend to develop irregular white patches on the lower surface of their bodies, though escaped individuals from Tartaria gradually lost these patches. The summer fur is generally shorter, sparser and duller than the winter fur.[11] The thick underfur and oily guard hairs render the pelage water-resistant, with the length of the guard hairs being intermediate between those of otters and polecats, thus indicating the American mink is incompletely adapted to an aquatic life. It moults twice a year, during spring and autumn.[12] It does not turn white in winter.[16] A variety of different colour mutations have arisen from experimental breeding on fur farms.[7]

Locomotion[edit]

On land, the American mink moves by a bounding gait, with speeds of up to 6.5 km/h (4.0 mph). It also climbs trees and swims well.[17] During swimming, the mink propels itself primarily through undulating movements of the trunk. When diving, it undergoes a state of rapid bradycardia, which is likely an adaptation to conserve oxygen.[12] In warm water (24 °C (75 °F)), the American mink can swim for three hours without stopping, but in cold water it can die within 27 minutes.[18] It generally dives to depths of 12 in (30 cm) for 10 seconds, though depths of 3 m lasting 60 seconds have been recorded. It typically catches fish after five- to 20-second chases.[17]

Senses and scent glands[edit]

The American mink relies heavily on sight when foraging. Its eyesight is clearer on land than underwater. Its auditory perception is high enough to detect the ultrasonic vocalisations (1-16 kHz) of rodent prey. Its sense of smell is comparatively weak. Its two anal glands are used for scent marking, either through defecation or by rubbing the anal region on the ground. The secretions of the anal glands are composed of 2,2-dimethylthietane, 2-ethylthietane, cyclic disulfide, 3,3-dimethyl-1,2-dithiacyclopentane, and indole. When stressed, the American mink can expel the contents of its anal glands at a distance of 12 in (30 cm).[12] Scent glands may also be located on the throat and chest.[19] The smell produced by these scent glands was described by Clinton Hart Merriam as more unbearable than that produced by skunks, and added it was "one of the few substances, of animal, vegetable, or mineral origin, that has, on land or sea, rendered me aware of the existence of the abominable sensation called nausea".[20]

Behaviour[edit]

Social and territorial behaviours[edit]

A southern mink (N. v. vulgivagus) in a threatening posture
American mink emerges from a pond.

American mink territories are held by individual animals with minimal intrasex overlap, but with extensive overlap between animals of the opposite sex. Most territories are located in undisturbed, rocky, coastal habitats with broad littoral zones and dense cover. They may also occur on estuaries, rivers and canals near urban areas. Home ranges are typically 1–6 kilometres (0.62–3.73 miles) long, with male territories being larger than those of females.[17] As long as it is close to water, the American mink is not fussy over its choice of den. Mink dens typically consist of long burrows in river banks, holes under logs, tree stumps, or roots and hollow trees, though dens located in rock crevices, drains, and nooks under stone piles and bridges are occasionally selected. The burrows they dig themselves are typically about four inches in diameter and may continue along for 10–12 feet (300–370 cm) at a depth of 2–3 feet (61–91 cm). The American mink may nest in burrows dug previously by muskrats, badgers and skunks, and may also dig dens in old ant hills. The nesting chamber is located at the end of a four-inch tunnel, and is about a foot in diameter. It is warm, dry and lined with straw and feathers.[21] The American mink's dens are characterized by a large number of entrances and twisting passages. The number of exits vary from one to eight.[18]

The American mink normally only vocalises during close encounters with other minks or predators. The sounds they emit include piercing shrieks and hisses when threatened and muffled chuckling sounds when mating. Kits squeak repeatedly when separated from their mothers.[19] Ernest Thompson Seton reported hearing minks growl and snarl when confronting a threat.[22] During aggressive interactions, this mink asserts its dominance by arching its back, puffing up, and lashing its tail, stamping and scraping the ground with its feet, and opening its mouth in a threat-gape. Should this be unsuccessful, fights may result, with injuries to the head and neck.[19]

American mink in a burrow

Reproduction and development[edit]

American mink kits

The American mink is a promiscuous animal, which does not form pair bonds.[17] The mating season begins from February in its southern range to April in the north.[12] In its introduced range, the American mink breeds one month earlier than the European mink.[23] Males commonly fight during the mating season, which may result in the formation of loose, temporary dominance hierarchies governing access to receptive females.[17] The mating season lasts for three weeks, with ovulation being induced by the presence of males. The mating process is violent, with the male typically biting the female on the nape of the neck and pinning her with his forefeet. Mating lasts from 10 minutes to four hours. Females are receptive for seven- to 10-day intervals during the three-week breeding season, and can mate with multiple males. Along with the striped skunk, the American mink is among the only mammals to mate in spring whilst possessing a short delay before the occurrence of implantation. This delayed implantation allows pregnant minks to keep track of environmental conditions and select an ideal time and place for parturition.[12]

The gestation period lasts from 40–75 days, with actual embryonic development taking place after 30–32 days, thus indicating delayed implantation can last from eight to 45 days. The young are born either in April or June, with litters consisting of four kits on average.[12] Exceptionally large litters of 11 kits have been recorded in Tartaria and 16 in the United States.[23] The kits are blind at birth, weighing six grams and possessing a short coat of fine, silver-white hairs.[12] The kits are dependent on their mother's milk, which contains 3.8% lipids, 6.2% protein, 4.6% lactose and 10.66% mineral salts.[23] Their eyes open after 25 days, with weaning occurring after five weeks. The kits begin hunting after eight weeks of age, but stay close to their mother until autumn, when they become independent. Sexual maturity is attained during the kit's first spring, when they are about 10 months old.[12]

Diet[edit]

American mink with fish, in Norway

The American mink is a carnivorous animal, which feeds on rodents, fish, crustaceans, amphibians, and birds. It kills vertebrate prey by biting the back of the head or neck, leaving canine puncture marks 9–11 mm (0.35–0.43 in) apart.[24] In its natural range, fish are their primary prey. Although inferior to the North American river otter in hunting fish, Audubon and Bachman once reported seeing a mink carrying a foot-long trout. Mink inhabiting the prairie sloughs primarily target frogs, tadpoles, and mice.[25] It is a formidable predator of muskrats, which are chased underwater and killed in their own burrows. Among the rodents killed by the American mink in its native range are rats and mice of the genera Hesperomys, Microtus, Sigmodon, and Neotoma. Marsh rabbits are frequently taken in marshy or swampy tracts.[26]

In Tartaria, the American mink's most important food items are voles, fish, crustaceans, frogs, and aquatic insects. In winter, aquatic foods predominate, while land-based prey increases in importance during the spring. Within the Altai Mountains, the American mink feeds predominantly on mammals such as rodents, shrews, and moles, as well as birds, reptiles, amphibians, and fish. Among the 11 different bird species preyed upon by minks in Altai are dippers and pine grosbeaks. Among fish, small species predominate in the diet of minks in Altai, and include; minnows, gudgeons, and wide-headed sculpins. In the Sverdlovsk and Irkutsk Oblasts, mouse-like rodents are their most important foods, followed by birds, fish and insects. In the Russian Far East, where crustaceans are scarce, the American mink feeds extensively on amphipods.[27] In the British Isles, dietary composition varies seasonally and regionally. European rabbits are the most commonly taken prey in areas where they are common, especially in summer. A range of small rodents and insectivores are preyed upon, but to a lesser degree. European hares are occasionally attacked. Minks in Britain prey on several bird species, with ducks, moorhens, and coots being most frequently targeted on lakes and rivers, while gulls are taken in coastal habitats. Aquatic species preyed upon in Britain include European eels, rock-pool fish such as blenny, shore crabs and crayfish.[28] American minks have been implicated in the decline of the water vole in the United Kingdom and linked to the decline of waterfowl across their range in Europe. They are now considered vermin in much of Europe and are hunted for the purpose of wildlife management.[29] In the Cape Horn Biosphere Reserve, mammals, including both native and exotic rodents, are the American mink's main prey throughout the year, though birds are of equal importance during their summer nesting periods.[30]

The American mink may pose a threat to poultry. According to Clinton Hart Merriam[31] and Ernest Thompson Seton,[32] although the American mink is a potential poultry thief, it is overall less damaging than the stoat. Unlike the stoat, which often engages in surplus killing, the mink usually limits itself to killing and eating one fowl during each attack. Studies in Britain indicate poultry and game birds only constitute 1% of the animals' overall diets.[28]

Relationships with other predators[edit]

The American mink replaces and sometimes kills the European mink wherever their ranges overlap.[33] The decline of European mink populations seems to coincide with the spread of the American mink.[34] The diets of the American mink and European otter overlap to a great extent. In areas where these two species are sympatric, competition with the otter for fish causes the American mink to hunt land-based prey more frequently.[35]

Intelligence[edit]

An early behavioral study was performed in the 1960s to assess visual learning ability in minks, ferrets, skunks, and house cats. Animals were tested on their ability to recognize objects, learn their valences and make object selections from memory. Minks were found to outperform ferrets, skunks, and cats in this task, but this letter (short paper) fails to account for a possible conflation of a cognitive ability (decision making, associative learning) with a largely perceptual ability (invariant object recognition).[36]

Range[edit]

Natural[edit]

The species' natural range encompasses North America from Alaska and Canada through the United States except Arizona and the more arid areas of California, Nevada, Utah, New Mexico, and West Texas.[1]

Introduced[edit]

Mainland Europe and British Isles[edit]

An American mink being released from a fur farm in Rome by a member of the ALF

Feral American minks in Europe are thought to be of domesticated stock derived from the N. v. vison, N. v. melampeplus and N. v. ingens subspecies. The first specimens were imported to Europe in 1920 for fur-farming purposes. The American mink was introduced in Italy in the 1950s, and currently resides mostly in the northeastern part of the Italian Peninsula. The majority of these populations do not appear to be self-sufficient, though minks in the Monti Prenestini and Simbruini in Lazio have reproduced successfully.[37]

Escapees of fur farming farms established a self-sustaining and expanding population in the Iberian peninsula by the second half of the 20th century. In 2013, the Spanish government announced an eradication plan of the species,[38] as a means to protect the falling populations of European mink and other endangered species affected such as the Pyrenean desman.

The first mink farm in Norway was built in 1927, with escapees establishing wild populations within 30 years of its establishment. The first feral mink populations arose in 1930, establishing territories in southwestern Norway. These feral minks, augmented by further escapees, formed the basis of a strong population in Hordaland by the end of World War II. Feral mink colonised eastern Norway in 1930 and had become established in most southeastern counties in the early 1940s. By 1950, feral mink reached central Norway, with further populations occurring in the northern counties of Nordland and Troms. During the post-World War II period until 1965, mink had colonised most of the country. In modern times, the American mink occupies all of the Norwegian mainland, but is absent on some islands.[39]

The American mink was first imported to Great Britain in 1929, though a series of escapes and releases lead to the establishment of a self-sufficient feral population in Devon by the late 1950s, and others by the early 1960s. In Ireland, the American mink was not farmed until the early 1950s, thus feral populations established themselves there much later. The species is now widespread in mainland Great Britain and Ireland, though some places remain uncolonised. It has established itself on a few islands, including Arran and Lewis and Harris.[17] Until 2005, mink hunting with packs of hounds occurred in the UK. The total mink population in Great Britain is estimated at 110,000 (England; 46,750, Scotland; 52,250, Wales; 9750). This population may be declining as European otter numbers increase. There are no estimates for the mink population in Ireland, but it is thought to be low, because of Ireland's strong otter population.[40]

Former USSR[edit]

An American mink in Lithuania's Kėdainiai district

In 1933, American minks were released into the Voronezh Oblast in European Russia. Until 1963, more minks were introduced in various quantities in the Voronezh and Arkhangelsk Oblasts, Karelia, in Kalininsk, Gorkovsk, Volgograd and Chelyabinsk Oblasts, and into Tatarstan and Bashkir, as well as the Lithuanian and Byelorussian SSRs. Beyond the Urals, American minks were introduced in the Sverdlovsk, Tyumen, Omsk, Kemerovo, Novosibirsk, Chita and Irkutsk Oblasts, in the Altai and Krasnoyarsk Krai, in the Tuvan, Buryat and Yakut Autonomous Soviet Socialist Republics, into the Magadan, Kamchatka and Amur Oblasts, into the Khabarovsk and Primorsky Krai, into the Chukotka Autonomous Okrug and several other locations, including Sakhalin and Urup Island. In the Caucasus, American minks were released into North Ossetia and Tien Shan. Originally, captive-bred minks were used, but wild specimens were later released to facilitate the species' acclimatisation within Soviet territories. Several years after the first release, introductions into the ranges already held by native European minks were discontinued, with most releases from then on taking place in Siberia and the Far East. Although considerable areas were occupied by the American mink by the early 1960s, the species' Soviet range was never continuous, as most released populations were isolated from one another.[41]

Iceland[edit]

The species has been present in Iceland since the 1930s, and has become well established, despite it being heavily hunted since 1939. However, its population underwent a 42% decline during the years 2002-2006, which coincided with a decline in sandeel populations resulting in a drop in the seabird populations on which the minks feed.[42]

South America[edit]

The American mink was deliberately introduced for commercial fur production in several provinces of Patagonia in 1930. The animals escaped or were released from farms in Chubut Province and now occur in the Chubut and Río Negro Provinces and Tierra del Fuego.[43]

Diseases and parasites[edit]

The American mink often carries light tick and flea infestations. Tick species known to infest minks include Ixodes hexagonus, I. canisuga, I. ricinus, and I. acuminatus. Flea species known to infest minks include Palaeopsylla minor, Malaraeus penicilliger, Ctenopthalmus noblis, Megabothris walkeri, Typhloceras poppei, and Nosopsyllus fasciatus. Endoparasites include Skrjabingylus nasicola and Troglotrema acutum.[40]

Transmissible mink encephalopathy (TME) is a prion disease of mink, similar to BSE in cattle and scrapie in sheep. A 1985 outbreak of TME in Stetsonville, Wisconsin resulted in a 60% mortality rate for the minks.[44] Further testing revealed this agent is transmissible between mink, cattle, and sheep. The Stetsonville outbreak may have been due to the animals being fed the carcasses of other infected animals.[45]

Decline of wild mink[edit]

Because of numerous incidents of domestic mink escaping from fur farms and establishing themselves in the wild, concern has arisen among conservationists of the possible repercussions such escapes may have on natural wild mink populations. Domestic mink are larger than wild mink, which may cause problems with the ecosystem when they escape. Minks are solitary, territorial animals and are intolerant of other minks. In times of overpopulation, they control their own numbers by either killing each other through direct conflict or by causing weaker minks to be driven from territory until starvation sets in.[46] When hundreds or thousands of released domestic minks flood an ecosystem, it causes a great disturbance for the wild minks, resulting in the deaths of the majority of the released mink and many of the wild ones from starvation or injuries incurred fighting over territory.[46] When a domestic mink survives long enough to reproduce, it may cause problems for the wild mink populations.[47] The adding of weaker domestic mink genes into wild mink populations is believed by some to have contributed to the decline of mink populations in Canada.[47]

A 2006 study in Denmark concluded, due to frequent escapes from existing mink farms, “Closing mink farms may result in a crash of the free-ranging population, or alternatively it may result in the establishment of a better-adapted, truly feral population that may ultimately outnumber the population that was present before farm closures.” The study reported more information would be necessary to determine the outcome.[48] Another Danish study reported a significant majority of the “wild” mink were mink which had escaped from fur farms. About 47% had escaped within two months, 31% had escaped prior to two months, and 21% “may or may not have been born in nature.” The survival rate for recently released minks is reportedly lower than for wild minks, but if feral minks survive at least two months, their survival rate is the same as for wild minks. The authors suggest this is due to the rapid behavioural adaptation of the animals.[49]

Relationships with humans[edit]

Fur use[edit]

American minks are primarily used in manufacturing ladies' fur coats, jackets, and capes. Pelts which are not able to be converted into these items are made into trimming for cloth and fur coats. Mink scarves and stoles are also manufactured. Jackets and capes are mostly made from small to medium-sized specimens, usually females and young males, while trimming, scarves and stoles are made from adult males.[50] The most valuable peltries come from eastern Canada which, although the smallest, are the silkiest and darkest.[51]

Trapping[edit]

Illustration of an American mink approaching a board or log trap

Although difficult to catch, the American mink, prior to being commercially farmed, was among the most frequently trapped furbearers as, unlike other furbearing mammals, it did not hibernate in winter, and could thus be caught on a nightly basis even in the far north.[52] Minks were legally trapped from early November to early April, when their pelts were prime.[53] Minks caught in traps cling to life with great tenacity, having been known to break their teeth in trying to extricate themselves from steel traps.[54] Elliott Coues described a trapped mink thus:

One who has not taken a Mink in a steel trap can scarcely form an idea of the terrible expression the animal's face assumes as the captor approaches. It has always struck me as the most nearly diabolical of anything in animal physiognomy. A sullen stare from the crouched, motionless form gives way to a new look of surprise and fear, accompanied with the most violent contortions of the body, with renewed champing of the iron till breathless, with heaving flanks, and open mouth dribbling saliva, the animal settles again, and watches with a look of concentrated hatred, mingled with impotent rage and frightful despair. The countenance of the Mink, its broad, low head, short ears, small eyes, piggish snout, and formidable teeth, is always expressive of the lower and more brutal passions, all of which are intensified at such times. As may well be supposed, the creature must not be incautiously dealt with when in such a frame of mind.

[54]

One Native American method involved using a bait (usually a slit open chicken carcass filled with fish oil and oysters) tied to a rope and dragged around an area laden with traps. A mink would thus follow the trail into one of the traps. Another indigenous method involved placing traps scented with muskrat and female mink musk on top of disused muskrat dens by water bodies. Attracted by the scent of food and a female, the mink would get caught in the trap and drown.[55] On the American prairies, only the steel trap was used, because of the lack of timber.[56]

Farming[edit]

Various American mink colour mutations

Breeding American minks for their fur began in the late 19th century, as increasing enthusiasm for mink pelts made the harvesting of wild minks insufficient to meet the new demands. American minks are easily kept in captivity, and breed readily.[57] In 2005, the U.S. ranked fourth in production behind Denmark, China and the Netherlands. Minks typically breed in March, and give birth to their litters in May. Farmers vaccinate the young kits for botulism, distemper, enteritis, and, if needed, pneumonia. They are harvested in late November and December. Methods for killing animals on fur farms, as on all farms, are detailed in the American Veterinary Medical Association's Report on Euthanasia which is used as a voluntary guideline for state departments of agriculture which have jurisdiction over all farms raising domesticated livestock, including minks.[58] In the past, some mink farms successfully provided pools of water for the mink to swim;[59] however, this practice is unheard-of in modern mink production. Minks are motivated to access swimming water, and the absence of water is a source of frustration on modern farms.[60] The ideal diet for farm-bred minks consists of four to five ounces of horse meat and a quarter-pint of milk once daily.[59]

Colour mutations[edit]

Selective breeding has produced a number of different colour shades in mink peltries, ranging from pure white, through beiges, browns, and greys, to a brown that is almost black. The two standard strains are brown and "black cross" which, when paired, produce numerous colour variations. When an albino mink is born, it is standard procedure in fur farms to breed it to other colour mutations to produce grey and light-brown pastel shades. The following graph is a simplification of the main colour strains:[61]

As pets[edit]

Mink as pet

Wild minks can be tamed if caught young, but can be difficult to handle and are usually not handled bare-handed.[62] In the late 19th century, tame American minks were often reared for ratting, much as ferrets were used in Europe. They are more effective ratters than terriers, as they can enter rat holes and drive rats from their hiding places. Because of their fondness for bathing, captive American minks may enter kettles or other open water-containing vessels. When minks of wild stock are confined with tame ones, the latter invariably dominate the former. They have also been known to dominate cats in confrontations.[63] Though intelligent, minks are not quick to learn tricks taught to them by their owners.[64] Though domestic minks have been bred in captivity for almost a century, they have not been bred to be tame. Domestic minks have been bred for size, fur quality, and color. However, the U.S. Fur Commission claims "mink are truly domesticated animals", based on the number of years they have been kept on fur farms.[65]

Literature[edit]

As an invasive species in the United Kingdom, minks have been the subject of at least two novels. Ewan Clarkson's 1968 Break for Freedom (published as Syla, the Mink in the USA) tells the story of a female mink escaped from a fur farm in a realistic style. On the other hand, A.R. Lloyd's 1982 Kine is a heroic fantasy with the minks as villains and weasels and other indigenous animals as heroes.[citation needed]

See also[edit]

References[edit]

Notes[edit]

  1. ^ a b c Reid, F. & Helgen, K. (2008). Neovison vison. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 21 March 2009. Database entry includes a brief justification of why this species is of least concern
  2. ^ Grubb, P. (16 November 2005). Wilson, D. E.; Reeder, D. M, eds. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ Heptner & Sludskii 2002, p. 745
  4. ^ a b c d e Seton 1909, p. 872
  5. ^ a b Heptner & Sludskii 2002, pp. 1397–1399
  6. ^ Kurtén 1980, p. 151
  7. ^ a b Harris & Yalden 2008, p. 488
  8. ^ Wozencraft, W. C. (2005). "Order Carnivora". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  9. ^ a b c d e f g h i j k Anthony 1928, pp. 109–110
  10. ^ a b Coues 1877, pp. 161–162
  11. ^ a b c Heptner & Sludskii 2002, pp. 1392–1394
  12. ^ a b c d e f g h i j Feldhamer, Thompson & Chapman 2003, pp. 663–664
  13. ^ Heptner & Sludskii 2002, pp. 1394–1395
  14. ^ Kruska, D. (1996) The effect of domestication on brain size and composition on the mink. J. Zoo., Lond. 239: 655.
  15. ^ Kruska, D. and A. Schreiber (1999) Comparative morphometrical and biochemical-genetic investigations in wild and ranch mink. Acta Theriologica 44(4): 382.
  16. ^ Seton 1909, p. 873
  17. ^ a b c d e f Harris & Yalden 2008, pp. 489–490
  18. ^ a b Heptner & Sludskii 2002, pp. 1410–1411
  19. ^ a b c Harris & Yalden 2008, p. 491
  20. ^ Merriam 1886, p. 67
  21. ^ Seton 1909, pp. 879–880
  22. ^ Seton 1909, p. 877
  23. ^ a b c Heptner & Sludskii 2002, p. 1413
  24. ^ Harris & Yalden 2008, p. 487
  25. ^ Seton 1909, pp. 883–884
  26. ^ Coues 1877, p. 178
  27. ^ Heptner & Sludskii 2002, pp. 1407–1408
  28. ^ a b Harris & Yalden 2008, p. 492
  29. ^ Haworth, Jenny (3 February 2009) "National cull may exterminate UK mink". Edinburgh. The Scotsman.
  30. ^ Ibarra, J.T., Fasola, L., Macdonald, D.W., Rozzi, R., Bonacic, C. (2009) Invasive American mink Mustela vison in wetlands of the Cape Horn Biosphere Reserve, southern Chile: what are they eating?. Oryx, Short communication, 43: 87-90.
  31. ^ Merriam 1886, p. 63
  32. ^ Seton 1909, p. 885
  33. ^ Heptner & Sludskii 2002, p. 1414
  34. ^ Maran, T. and Henttonen, H. 1995. Why is the European mink, Mustela lutreola disappearing? - A review of the process and hypotheses. Annales Fennici Zoologici 32: 47-54.
  35. ^ Bonesi, L., Chanin, P. and Macdonald, D. W. 2004. Competition between Eurasian otter Lutra lutra and American mink Mustela vison probed by niche shift. Oikos 106: 19/26.
  36. ^ Doty, Barbara A., C. Neal Jones and Larry A. Doty (1967) Learning-Set Formation by Mink, Ferrets, Skunks, and Cats. Science 155(3769): 1579–1580.
  37. ^ (Italian)Spagnesi M, Toso S, De Marinins AM (2002) I Mammiferi d'Italia. Ministero dell'Ambiente e della Tutela del Territorio e Istituto Nazionale per la Fauna Selvatica, Italy.
  38. ^ [1]
  39. ^ Bevanger, K. & G. Henriksen (1995)The distributional history and present status of the American mink (Mustela vison Schreber, 1777) in Norway. Annales Zoologici Fennici 32:1 1-14.
  40. ^ a b Harris & Yalden 2008, p. 493
  41. ^ Heptner & Sludskii 2002, pp. 1399–1403
  42. ^ The impact of climate change on the American mink in Iceland, Wildlife Conservation Research Unit
  43. ^ Bonino, Never, (1995) INTRODUCED MAMMALS INTO PATAGONIA, SOUTHERN ARGENTINA: consequences, problems and management strategies, Integrating peoples and wildlife for a sustainable future. International Wildlife Management Congress, 1ro.; Bethesda, Md; Wildlife Society: 406-409
  44. ^ Tenembaum, David (2007) Unfolding the Prion Mystery. Grow online
  45. ^ Scientific papers on Spongiform Disease by R.F. Marsh
  46. ^ a b Dunstone, N. (1993) The Mink. London.
  47. ^ a b Bowman, J., A. Kidd, R. Gorman, A. Schulte-Hostedde (2007) Assessing the potential for impacts by feral mink on wild mink in Canada. Biological Conservation 139: 12-18.
  48. ^ Hammershøj, Mette, Justin M.J. Travis and Catriona M. Stephenson (2006) Incorporating evolutionary processes into a spatially-explicit model: exploring the consequences of mink-farm closures in Denmark. Ecography 29(4): 465-476
  49. ^ Hammershøj, M. (2004) Population ecology of free-ranging American mink Mustela vison in Denmark. PhD thesis, National Environmental Research Institute, Kalø, Denmark. 30 pp.
  50. ^ Bachrach 1953, p. 326
  51. ^ Bachrach 1953, p. 327
  52. ^ Harding 1906, p. 19
  53. ^ Seton 1909, p. 895
  54. ^ a b Coues 1877, pp. 175–176
  55. ^ Harding 1906, pp. 53–56
  56. ^ Harding 1906, pp. 57–69
  57. ^ Seton 1909, pp. 896–897
  58. ^ AVMA Guidelines on Euthanasia, June 2007, American Veterinary Medical Association
  59. ^ a b Gates 1915, p. 50
  60. ^ Mason, Georgia; Cooper, Jonathon (2001). "Frustrations of fur-farmed mink". Nature 410 (6824): 35–36. doi:10.1038/35065157. 
  61. ^ a b c d e f g h Bachrach 1953, p. 335
  62. ^ Harding 1906, p. 2
  63. ^ Coues 1877, pp. 181–183
  64. ^ Gates 1915, p. 32
  65. ^ Fur Commission USA (2008) Mink Farming in the United States (revised edn). Colorado.

Bibliography[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Wozencraft (in Wilson and Reeder 2005) cited several sources supporting placement of the American mink and sea mink in the genus Neovison rather than in Mustela.

See Humphrey and Setzer (1989) for the description of a new subspecies, halilimnetes, from coastal northwestern Florida. A study of skull variation concluded that "Mustela vison evergladensis" is not a valid subspecies; the Everglades mink population apparently is a disjunct population of the subspecies mink (Humphrey and Setzer 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

American mink
mink
North American mink

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The currently accepted scientific name of American mink is Mustela vison
Schreber. It belongs to the weasel family (Mustelidae) [17]. There are
15 currently accepted American mink subspecies [17,23].
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]
  • 17. Hall, E. Raymond. 1981. The mammals of North America. 2nd ed. Vol. 2. New York: John Wiley and Sons. 1271 p. [14765]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!