Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Biology

This semi-aquatic species is a versatile opportunistic predator (2) (4), preying on rabbits (Oryctolagus cuniculus), water voles (Arvicola terrestris), and many other mammals, as well as a range of fish, birds, eggs, crayfish, and a variety of invertebrates (6). This species has had a devastating effect on native species; it has been implicated in the precipitous decline of the water vole, and poses a serious threat to game birds, fish and birds nesting on offshore islands (6). Although it can be active at any time during the 24-hour period, the activity of the American mink tends to peak at night and at dusk (6). They are solitary and territorial, with the male home range overlapping several female ranges (6). Mating occurs once a year, between February and April (6). During this time males leave their territories and increase their range in search of females (2). A single litter of four to seven young is produced between April and May (6). When they reach 13 to 14 weeks of age, the young disperse away from the place of birth (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

The American Mink, with its luxurious brown coat, is now bred on farms, or mink ranches, to provide fur to the clothing industry. This has relieved some of the stress natural populations endured from trapping over the past two centuries. The nocturnal, semi-aquatic Mink is now common along streams, lakes, and marshes throughout much of North America. Like other mustelids, Mink are good hunters. They consume crayfish, frogs, fish, birds, and small mammals. For some reason, few animals prey on them.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: "Schreber, J.C.D., 1777.  in Schreber's Die Säugthiere in Abbildungen nach der Natur mit Beschreibungen, Wolfgang Walther, Erlangen, 7 volumes, 1774-1846; 3(19):pl. 127.B[1777]; text, 3(26):463[1777]."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

The introduced American mink has a slender body, short legs and a tail that is about a third of the body length (4). The thick, glossy fur can vary in colour, but is generally dark brown or black, and becomes darker in winter (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Mink are found throughout the United States, appearing in parts of every state except Arizona. They are also present in most of Canada, including an introduced population on Newfoundland. Only along the Arctic coast and some offshore islands are they absent.

American mink have also been inadvertently introduced to the British Isles, where they escaped from fur farms in the 1960's. As a non-native predator their effects on native wildlife there are serious.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The species occurs in North America from Alaska and Canada through the United States except Arizona and the dry
parts of California, Nevada, Utah, New Mexico, and western Texas. The American mink was deliberately introduced as a fur animal in Russia, and in other parts of Europe and, as a result of escapes and their intentional release in Russia and other countries, the species is now naturalised in many parts of Europe (Mitchell-Jones et al., 1999). The european range area increased rapidly and now it includes: Belarus, Belgium, China, Czech Republic, Denmark, Estonia, Finland, France, Germany, Great Britian, Iceland, Ireland, Italy, Japan (Hokkaido), Latvia, Lithuania, Netherlands, Norway, Poland, Portugal, Russia, Spain, Sweden. Feral populations of American mink have been reported also in South America (Previtali, 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Throughout most of North America north of Mexico except for southwestern U.S. Introduced in Iceland, north-central Europe, British Isles, Norway, Belarussia, Baltic States, Spain, and Siberia (Wozencraft, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Mink are found throughout the United States, appearing in parts of every state except Arizona. They are also present in most of Canada, including an introduced population on Newfoundland. Only along the Arctic coast and some offshore islands are they absent.

American mink have also been accidentally introduced to the British Isles, where they escaped from fur farms in the 1960's. As a non-native predator their effects on native wildlife there are serious.

Biogeographic Regions: nearctic (Introduced , Native ); palearctic (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America

AL AK AR CA CO CT DE FL GA ID
IL IN IA KS KY LA ME MD MA MI
MN MS MO MT NE NV NH NJ NM NY
NC ND OH OK OR PA RI SC SD TN
TX UT VT VA WA WV WI WY
AB BC MB NB NF NT NS ON PE PQ
SK YK
GENERAL DISTRIBUTION:
American mink range across Canada, excepting the high Arctic, west through Alaska
and south throughout the United States except for the southwestern
deserts [10].
  • 10. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

American mink, native to North America, were first introduced to fur farms in Britain in 1929; the first official record of escapees breeding in the wild was in 1957 (5). Following many accidental and deliberate releases, the species is now widespread and common throughout Britain and much of Europe (6). In Britain they are spreading in terms of range and numbers, extending into East Anglia and Yorkshire (6). However, in some areas of England the population is declining, this may be due to the return of the native otter (Lutra lutra) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Mink fur is usually dark brown with white patches on the chin, chest, and throat areas. The fur is soft and thick, with oily guard hairs that waterproof the animal's coat (Chapman and Feldhamer 1982). The body is long and slender with short legs and a pointy, flat face. The toes are partially webbed, showing the mink's semi-aquatic nature. Body length is usually around 2 feet or 610 mm (Van Gelder 1982) with up to half of this length being the tail. Females, on average, are substantially smaller than males. Adult females weigh between 0.7 to 1.1 kg, while males range from 0.9 to 1.6 kilograms (Chapman and Feldhamer 1982). Body length varies as well, with males measuring from 580 to 700 mm and females from 460 to 575 mm (Chapman and Feldhamer 1982).

Range mass: 700 to 1600 g.

Range length: 460 to 700 mm.

Average length: 610 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Chapman, J., G. Feldhamer. 1982. Wild Mammals of North America. Baltimore and London: The Johns Hopkins University Press.
  • Van Gelder, R. 1982. Mammals of the National Parks. Baltimore, MD: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Mink fur is usually dark brown with white patches on the chin, chest, and throat areas. The fur is soft and thick, with oily outer hairs that waterproof the animal's coat. The body is long and slender with short legs and a pointy, flat face. The toes are partially webbed, showing the mink's semi-aquatic nature. Body length is usually around 2 feet or 610 mm with up to half of this length being the tail. Females, on average, are smaller than males. Adult females weigh between 0.7 to 1.1 kg, while males range from 0.9 to 1.6 kilograms. Body length varies as well, with males measuring from 580 to 700 mm and females from 460 to 575 mm.

Range mass: 700 to 1600 g.

Range length: 460 to 700 mm.

Average length: 610 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Chapman, J., G. Feldhamer. 1982. Wild Mammals of North America. Baltimore and London: The Johns Hopkins University Press.
  • Van Gelder, R. 1982. Mammals of the National Parks. Baltimore, MD: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 72 cm

Weight: 1600 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are about 20% heavier than females.

Length:
Range: 550-700 mm males; 470-600 mm females

Weight:
Range: 550-1,250 g males; 550-1,000 g females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from weasels in having brown rather than white or yellowish underparts. Differs from marten in having a white chin patch (marten has pale buff patch on throat and breast), generally darker pelage (marten's pelage generally is yellowish brown except on the feet and end of the tail), and 4 rather than 5 upper postcanine teeth. Differs from the fisher in having 4 rather than 5 upper postcanine teeth, a white chin patch, and smaller size. River otter is much larger (up to 130 cm total length and 11 kg).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Although mink are found throughout North America, they tend to frequent forested areas that are in close proximity to water. Streams, ponds, and lakes, with some sort of brushy or rocky cover nearby are considered optimal territory.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; savanna or grassland ; forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: riparian

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor, MI: The University of Michigan Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is found along streams and lakes as well as in swamps and marshes. It prefers densely vegetated areas. It dens under stones or the roots of trees, in espropriated beaver or muskrat houses, or in self-excavated burrows (Nowak, 2005). The species can be found in xeric habitats if food is abundant (Arnold and Fritzell, 1990).
Strictly carnivorous, and its diet reflects the local prey base (Ben-David et al., 1997). Typical prey are fish, amphibians, crustaceans, muskrats, and small mammals (Birks and Dunstone, 1985; Bueno, 1994; Chanin and Linn, 1980; Cuthbert, 1979; Day and Linn, 1972). But other prey can be found occasionally (Larievière, 1999). Males have large home ranges that extend for a half mile or more along waterways and overlap with the smaller home ranges of several females (Wilson and Ruff, 1999).

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Central Pacific Coastal Forests Habitat

This taxon is found in the Central Pacific Coastal Forests ecoregion, as one of its North American ecoregions of occurrence. These mixed conifer rainforests stretch from stretch from southern Oregon in the USA to the northern tip of Vancouver Island, Canada. These forests are among the most productive in the world, characterized by large trees, substantial woody debris, luxuriant growths of mosses and lichens, and abundant ferns and herbs on the forest floor. The major forest complex consists of Douglas-fir (Pseudotsuga menziesii) and Western hemlock (Tsuga heterophylla), encompassing seral forests dominated by Douglas-fir and massive old-growth forests of Douglas-fir, Western hemlock, Western red cedar (Thuja plicata), and other species. These forests occur from sea level up to elevations of 700-1000 meters in the Coast Range and Olympic Mountains. Such forests occupy a gamut of environments with variable composition and structure and includes such other species as Grand fir (Abies grandis), Sitka spruce (Picea sitchensis), and Western white pine (Pinus monticola).

Characteristic mammalian fauna include Elk (Cervus elaphus), Black-tailed Deer (Odocoileus hemionus), Coyote (Canis latrans), Black Bear (Ursus americanus), Mink (Mustela vison), and Raccoon (Procyon lotor).

The following anuran species occur in the Central Pacific coastal forests: Coastal tailed frog (Ascaphus truei); Oregon spotted frog (Rana pretiosa VU); Northern red-legged frog (Rana pretiosa); Pacific chorus frog (Pseudacris regilla); Cascade frog (Rana cascadae NT), generally restricted to the Cascade Range from northern Washington to the California border; Foothill yellow-legged frog (Rana boylii) and the Western toad (Anaxyrus boreas NT).  A newt found in the ecoregion is the Rough skinned newt (Taricha granulosa).

Salamanders within the ecoregion are: Del Norte salamander (Plethodon elongatus NT);  Van Dyke's salamander (Plethodon vandykei); Western redback salamander (Plethodon vehiculum); Northwestern salamander (Ambystoma gracile);  Olympic torrent salamander (Rhyacotriton olympicus VU), whose preferred habitat is along richly leafed stream edges; Long-toed salamander (Ambystoma macrodactylum), whose adults are always subterranean except during the breeding season; Dunn's salamander (Plethodon dunni), usually found in seeps and stream splash zones; Clouded salamander (Aneides ferreus NT), an aggressive insectivore; Monterey ensatina (Ensatina eschscholtzii), usually found in thermally insulated micro-habitats such as under logs and rocks; Pacific giant salamander (Dicamptodon tenebrosus), found in damp, dense forests near streams; and Cope's giant salamander (Dicamptodon copei), usually found in rapidly flowing waters on the Olympic Peninsula and Cascade Range.

There are a small number of reptilian taxa that are observed within this forested ecoregion, including: Pacific pond turtle (Emys marmorata); Common garter snake (Thamnophis sirtalis), an adaptable snake most often found near water; Northern alligator lizard (Elgaria coerulea); and the Western fence lizard.

Numerous avian species are found in the ecoregion, both resident and migratory. Example taxa occurring here are the Belted kingfisher (Megaceryle alcyon); Wild turkey (Meleagris gallopavo); and the White-headed woodpecker (Picoides albolarvatus) and the Trumpeter swan (Cygnus buccinator), the largest of the North American waterfowl.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Favors forested, permanent or semipermanent wetlands with abundant cover, marshes, and riparian zones Dens in muskrat burrow, abandoned beaver den, hollow log, hole under tree roots, or in burrow dug by mink in streambank.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although mink are found throughout North America, they tend to prefer forested areas that are close to water. Streams, ponds, and lakes, with some sort of brushy or rocky cover nearby are considered good mink habitat.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; savanna or grassland ; forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: riparian

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor, MI: The University of Michigan Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, density, marsh, shrub, shrubs, tree

Den sites are usually in thick cover and include hollow logs, natural
cavities under tree roots, or burrows along stream, marsh, and lake
edges [10]. Old beaver (Castor canadensis) lodges are occasionally used
as den sites [23]. In Idaho 53 percent of dens were in logjams [27].
In North Dakota marshlands, all dens were situated on shorelines and
appeared to be in abandoned muskrat burrows. Active dens were not
located where shorelines were heavily grazed. The absence of dry den
sites limits the use of some wetland habitats that are otherwise
suitable [1]. In Ontario dens were frequently found in areas with good
horizontal cover (31.4% obscurity at 3.5 m), and proportionally more
coniferous than deciduous shrubs. Dens were also in areas with
higher-than-average shrub density, deadfalls, stumps, and individual
trees [30].

In Michigan American mink were most commonly associated with brushy or wooded
cover adjacent to aquatic habitats [25]. In Quebec mink were normally
most active in wooded areas immediately adjacent to a stream channel
[6].
  • 1. Allen, Arthur W. 1986. Habitat suitability index models: mink. Biol. Rep. 82 (10.127). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 23 p. [11713]
  • 6. Burgess, S. A. 1978. Aspects of mink ecology in the southern Laurentians of Quebec. Montreal, PQ: McGill University. 87 p. Thesis. [27377]
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]
  • 25. Marshall, William H. 1936. A study of the winter activities of the mink. Journal of Mammalogy. 17(4): 382-392. [26030]
  • 30. Racey, G. D.; Euler, D. L. 1983. Changes in mink habitat and food selection as influenced by cottage development in central Ontario. Journal of Applied Ecology. 20(2): 387-402. [25984]
  • 27. Melquist, Wayne E.; Whitman, Jackson S.; Hornocker, Maurice G. 1981. Resource partitioning and coexistence of sympatric mink and river otter populations. In: Chapman, Joseph A.; Pursley, Duane, eds. Worldwide furbearer conference: Proceedings; 1980 August 3-11; Frostburg, MD. Volume I. [Place of publication unknow]: [Publisher unknown]: 187-220. [25995]
  • 10. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: cover, density, hydroperiod, shrub, succession

The critical habitat feature for American mink is water. American mink prefer
streambanks, lakeshores, and marshes [10]. Habitats associated with
small streams are preferred to habitats near large, broad rivers [1].
American mink favor forested wetlands with abundant cover such as shrub thickets,
fallen trees, and rocks [10]. In aspen (Populus spp.) parklands, male
American mink selected large, semipermanent and permanent wetlands with open
areas near shores, high water levels and irregular shorelines; these
characteristics are also associated with abundant avian prey [3]. American mink
are common where abundant downfall and debris creates cover for
foraging. Logjams in streams create crayfish and fish habitat and
shelter for American mink [1]. Peak American mink production in baldcypress (Taxodium
distichum) swamps occurred following extensive logging in the early part
of the twentieth century. Numbers have declined since then, probably
due to changed hydroperiod and decreased logging debris [23]. In Quebec
the majority of American mink activity takes place less than 3 miles (4.8 km)
from water [6]. In Michigan all American mink were observed within 100 feet
(30.4 m) of the water's edge [25]. In Minnesota all den sites were
within 231 feet (69.9 m) of open water [31]. In Idaho den sites were
16.5 to 330 feet (5-100 m) from water, and American mink were never observed more
than 660 feet (200 m) from water [27]. In southeastern Alaska mink
spend the summers along streams and in upland muskegs; they spend the
winter in a narrow ocean beach zone [26].

Wetlands with irregular, diverse shorelines are better American mink habitat than
those with straight, open, or exposed shorelines [1]. Marshall [25]
reported that 50 percent of American mink tracks in Michigan occurred in various
stages of hydrophytic succession, 37 percent in bushy and timbered
areas, and 13 percent in sedge (Carex spp.) and common cattail (Typhus
latifolia) type. In Alaska the highest American mink densities occurred in low
swampy terrain and in extensively interconnected waterways with abundant
fish [8].

More American mink are trapped in wooded swamps than in marshes. The reported
abundance of American mink in baldcypress-tupelo (Nyssa spp.) swamps is at least
partially attributable to the abundance of food [1].

In upland habitats, ecotones are most used; American mink avoid open areas and
prefer shrubby, dense thickets. Tall grass does not usually provide
adequate cover for American mink; however, sawgrass (Cladium jamaicense) marshes
in Louisiana support high American mink densities [1].

American mink are adaptable in their use of habitat, particularly where prey are
readily available. They are tolerant of human activity. American mink inhabit
suboptimal habitats if prey is available, but are more mobile and change
home ranges more frequently in suboptimal than in optimal habitats [1].

Home Range: American mink home ranges tend to approximate the shape of the body
of water the American mink uses most [1]. However, in the prairie pothole
region, American mink tend to use an area rather than a linear shoreline [2].
The use of the home range varies in intensity with respect to varying
prey availability. American mink tend to use a core area near a den site,
usually within 990 feet (300 m) of the shoreline. They move to another
den and core area several times a season; core areas tend to be places
of relatively high prey abundance. Usually only a small percentage of
the average or overall home range is used as the core area. In winter
fewer den sites are used, occupancy is of longer duration, and daily
travel distances are shorter than in summer [1].

Male American mink have larger average home ranges than females [1,23]. Females
tend to use a greater proportion of their home range as a core area then
males do [23]. Mitchell [29] reported the average home range for male
American mink in Montana was 2 to 3 miles (3.2-4.8 km) in diameter. Vegetative
cover has a substantial impact on home range size in Montana: female
home ranges in heavily vegetated areas averaged 19 acres (7.7 ha),
whereas in sparse, heavily grazed areas they averaged 50 acres (20.1 ha)
[29]. In Michigan male American mink average home range was less than 20 acres
(8 ha) [25]. In Idaho males used 0.6 to 1.25 miles (1-2 km) of
shoreline [27]. In British Columbia mink density on Vancouver Island
ranged from 1.5 to more than 3 American mink per kilometer of shoreline [18].
Gerell [15] reported that adult male American mink used an average of 8,679 feet
(2630 m) of shoreline, ranging from 5,940 to 16,500 feet (1800-5000 m).
Female adults used 3,300 to 9,240 feet (1000-2800 m), and juvenile males
used 3,465 to 4,620 feet (1050-1400 m).

In North Dakota prairie pothole regions, American mink home ranges were not
linear. Average home ranges were 1 to 1.5 square miles (2.59-3.8 sq km)
and typically included many individual wetlands [1]. In Manitoba
prairie pothole areas, male home ranges had maximum lengths of 3.1 miles
(5.1 km) and maximum widths of 1.9 miles (3.1 km); prairie American mink tended
to have larger home ranges than other American mink populations [2].

Home ranges of individuals rarely overlap, with the exception of the
breeding season when male home ranges overlap those of females [1].
  • 1. Allen, Arthur W. 1986. Habitat suitability index models: mink. Biol. Rep. 82 (10.127). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 23 p. [11713]
  • 2. Arnold, Todd W.; Fritzell, Erik K. 1987. Activity patterns, movements, and home ranges of prairie mink. Prairie Naturalist. 19(1): 25-32. [25980]
  • 3. Arnold, Todd W.; Fritzell, Erik K. 1990. Habitat use by male mink in relation to wetland characteristics and avian prey abundances. Canadian Journal of Zoology. 68(10): 2205-2208. [25985]
  • 6. Burgess, S. A. 1978. Aspects of mink ecology in the southern Laurentians of Quebec. Montreal, PQ: McGill University. 87 p. Thesis. [27377]
  • 8. Burns, John James. 1964. The ecology, economics and management of mink in the Yukon-Kuskokwim Delta, Alaska. Fairbanks, AK: University of Alaska. 114 p. Thesis. [26085]
  • 15. Gerell, Rune. 1967. Food selection in relation to habitat in mink (Mustela vison Schreber) in Sweden. Oikos. 18: 233-246. [26031]
  • 18. Hatler, David Francis. 1976. The coastal mink on Vancouver Island, British Columbia. Vancouver, BC: University of British Columbia. 376. Dissertation. [27113]
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]
  • 25. Marshall, William H. 1936. A study of the winter activities of the mink. Journal of Mammalogy. 17(4): 382-392. [26030]
  • 26. Meehan, William R. 1974. The forest ecosystem of southeast Alaska: 4. Wildlife habitats. Gen. Tech. Rep. PNW-16. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 32 p. [13479]
  • 29. Shafroth, Patrick B.; Auble, Gregor T.; Scott, Michael L. 1995. Germination and establishment of the native plains cottonwood (Populus deltoides ssp. monilifera) and the exotic Russian-olive (Elaeagnus angustifolia L.). Conservation Biology. 9(5): 1169-1175. [26012]
  • 31. Schladweiler, J. S.; Storm, G. L. 1969. Den-use by mink. Journal of Wildlife Management. 33(4): 1025-1026. [27112]
  • 27. Melquist, Wayne E.; Whitman, Jackson S.; Hornocker, Maurice G. 1981. Resource partitioning and coexistence of sympatric mink and river otter populations. In: Chapman, Joseph A.; Pursley, Duane, eds. Worldwide furbearer conference: Proceedings; 1980 August 3-11; Frostburg, MD. Volume I. [Place of publication unknow]: [Publisher unknown]: 187-220. [25995]
  • 10. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the terms: forb, fresh, hardwood, marsh

203 Riparian woodland
217 Wetlands
409 Tall forb
411 Aspen woodland
421 Chokecherry-serviceberry-rose
422 Riparian
805 Riparian
806 Gulf Coast salt marsh
807 Gulf Coast fresh marsh
809 Mixed hardwood and pine
811 South Florida flatwoods
812 North Florida flatwoods
813 Cutthroat seeps
814 Cabbage palm flatwoods
815 Upland hardwood hammocks
816 Cabbage palm hammocks
817 Oak hammocks
818 Florida salt marsh
820 Everglades flatwoods
821 Pitcher plant bogs
822 Slough

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

American mink occur in most SAF cover types, except those in the
southwestern deserts.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

American mink occur in most Kuchler plant associations, except those in the
southwestern deserts.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES16 Oak-gum-cypress
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES24 Hemlock-Sitka spruce
FRES25 Larch
FRES26 Lodgepole pine
FRES27 Redwood
FRES28 Western hardwoods
FRES37 Mountain meadows
FRES38 Plains grasslands
FRES39 Prairie
FRES41 Wet grasslands
FRES44 Alpine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

American mink occur in a wide variety of plant communities. They are associated
with water rather than with particular habitat types. American mink are more
often associated with coniferous and mixed forests than deciduous
forests. They are also found in grassland environments if open water or
marshland is present [1].
  • 1. Allen, Arthur W. 1986. Habitat suitability index models: mink. Biol. Rep. 82 (10.127). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 23 p. [11713]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lives in aquatic habitats, but can spend some time away from water and can even live near urban areas (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Male home range considerably larger than that of female; average for female 20-50 acres (not more than 20 acres according to Layne 1978), for male 1900 acres plus (Banfield 1974, Schwartz and Schwartz 1981), up to 8 km (5 mi.) in diameter (Caire et al. 1989). In Tennessee, fall-early winter home range of three males (2 adults, 1 juvenile) was 5.6-11.1 km of stream; overnight movements were as large as 4.3 km (Stevens et al. 1997). In England, partial-year home range was 4.5-8.6 km (mean 6.0 km) of water course in males and 0.8-4.3 km (mean 2.7 km) in females (Yamaguchi and Macdonald 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of mink varies with the season. During the summer it consists of crayfish and small frogs, along with small mammals such as shrews, rabbits, mice, and muskrats. Fish, ducks and other water fowl provide additional food choices. In the winter, they primarily prey on mammals.

Animal Foods: birds; mammals; amphibians; reptiles; fish; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Small mammals, other vertebrates (e.g., waterfowl), crayfish, and small vertebrates associated with aquatic/riparian ecosystems. Muskrats (ONDATRA ZIBETHICUS) particularly are favored in some areas, but diet reflects availability.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The diet of mink varies with the season. During the summer they eat Cambaridae and small anura, along with small mammals such as soricidae, leporidae, muridae, and ondatra zibethicus. actinopterygii, anatidae and other water fowl provide additional food choices. In the winter, they mostly prey on mammalia.

Animal Foods: birds; mammals; amphibians; reptiles; fish; aquatic crustaceans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

American mink are almost exclusively carnivorous. They are excellent swimmers
and pursue both aquatic and terrestrial prey. American mink diets vary with
season, habitat, and availability of prey [1]. No single food item is
consistently more important than others [23]. Commonly important items
include common muskrats (Ondatra zibethecus), voles (Microtus spp.),
cottontails (Sylvilagus spp.), fish (mostly Salmonidae), birds, frogs,
salamanders, crayfish, clams, and insects [1,10,23]. Carey [9] listed
American mink as a common predator of Townsend's chipmunks (Tamias townsendii) in
the Pacific Northwest. Allen [1] listed American mink prey preference in the
following order: 1) aquatic prey, including fish and crayfish, 2)
semi-aquatic prey including waterfowl and water-associated mammals such
as common muskrat, and 3) terrestrial prey including rabbits and
rodents.

In Idaho fish comprised 59 percent of American mink diets [27]. Birds are
important prey where fish and crayfish are scarce. In Louisiana
crayfish are so prominent in American mink diets that their abundance largely
determines American mink population size [1]. In Alaska coastal populations of
American mink tend to be higher than inland populations due to the ready
availability of prey in tide pools [1]. Eberhardt and Sargeant [12]
reported that American mink diets in North Dakota prairie marshes were dominated
by birds (78%); other prey included mammals (19%), amphibians (2%), and
reptiles (1%). Of the avian prey, the majority were waterfowl including
American coot (Fulica americana), ducks (Anatidae), and grebes
(Podicipedidae) [12]. In southern Manitoba mink are important nest
predators of waterfowl [11]. In North Dakota American mink predation on
ducklings typically occurs in semipermanent wetlands [1].

Seasonal Variation in Diet: Shallow water and low flow rates contribute
to effective aquatic foraging by American mink. American mink tend to eat more fish in
winter when fish are more accessible. In autumn terrestrial mammals
tend to increase in importance as prey. Terrestrial mammals comprised
43 percent of American mink diets in riparian areas in Idaho and comprised over
20 percent of American mink fall/winter diets in North Carolina [1]. In Quebec
crayfish were the most important dietary item in summer [6]. In winter
American mink hunting over ice can easily penetrate active common muskrat lodges,
but cannot get into common muskrat burrows so easily [28].
  • 1. Allen, Arthur W. 1986. Habitat suitability index models: mink. Biol. Rep. 82 (10.127). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 23 p. [11713]
  • 6. Burgess, S. A. 1978. Aspects of mink ecology in the southern Laurentians of Quebec. Montreal, PQ: McGill University. 87 p. Thesis. [27377]
  • 9. Carey, Andrew B. 1991. The biology of aboreal rodents in Douglas-fir forests. Gen. Tech. Rep. PNW-276. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 46 p. [18163]
  • 11. Diiro, Bruce Warren. 1982. Effects of burning and mowing on seasonal whitetop ponds in southern Manitoba. Ames, IA: Iowa State University. 48 p. Thesis. [23497]
  • 12. Eberhardt, Lester E.; Sargeant, Alan B. 1977. Mink predation on prairie marshes during the waterfowl breeding season. In: Proceedings of the predator symposium; 1975; Missoula, MT. Missoula, MT: University of Montana, School of Forestry, Montana Forest and Conservation Experiment Station: 33-43. [26032]
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]
  • 28. Messier, Francois; Virgl, John A. 1992. Differential use of bank burrows and lodges by muskrats, Ondatra zibethicus, in a northern marsh environment. Canadian Journal of Zoology. 70(6): 1180-1184. [18437]
  • 27. Melquist, Wayne E.; Whitman, Jackson S.; Hornocker, Maurice G. 1981. Resource partitioning and coexistence of sympatric mink and river otter populations. In: Chapman, Joseph A.; Pursley, Duane, eds. Worldwide furbearer conference: Proceedings; 1980 August 3-11; Frostburg, MD. Volume I. [Place of publication unknow]: [Publisher unknown]: 187-220. [25995]
  • 10. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Mink are important predators of small mammals throughout their range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mink have few natural enemies. They are occasionally killed by coyotes, bobcats and other carnivores, but their main threat remains humans. Mink, like most mustelids, are aggressive and fearless predators. They do not hesitate to defend themselves against animals larger than themselves. Mink may be occasionally taken by birds of prey, or young in a nest may be taken by snakes, but they are agile, cryptic in coloration, and secretive in nature, thereby avoiding most predation.

Known Predators:

  • coyotes
  • bobcats
  • snakes
  • birds of prey

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Mink are important predators of small mammals throughout their range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Mink have few natural enemies. They are occasionally killed by canis latrans, lynx rufus and other carnivora, but their main threat remains humans. Mink, like most mustelidae, are aggressive and fearless predators. They do not hesitate to defend themselves against animals larger than themselves. Mink may be occasionally taken by falconiformes, or young in a nest may be taken by serpentes, but they are agile, secretive in nature, and they blend in with their background, so they can avoid most predators.

Known Predators:

  • canis latrans
  • lynx rufus
  • serpentes
  • falconiformes

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

American mink mortality due to predators other than humans is not substantial.
Occasional predators include fisher (Martes pennanti), red fox (Vulpes
vulpes), gray fox (Urocyon cinereoargenteus), bobcat (Lynx rufus), lynx
(L. lynx), gray wolf (Canis lupus), American alligator (Alligator
mississippiensis), and great horned owl (Bubo virginianus) [23].
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Animal / parasite / ectoparasite / blood sucker
Ixodes hexagonus sucks the blood of Mustela vison

Animal / parasite / ectoparasite / blood sucker
Ixodes ricinus sucks the blood of Mustela vison

Animal / predator
Mustela vison is predator of nest of Bombus

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Numerous occurences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Solitary except during mating period and when females have young.

In good habitat, density may be 9-22 per sq mile (Banfield 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: cover, density, shrub, snag

There are no reports in the literature linking fire-caused habitat
changes to American mink. Fire along streambanks that reduces cover and downed
logs would have a negative impact on American mink activity. Reduction of fish
and crayfish due to changes in stream conditions would adversely affect
American mink. Conversely, fire that resulted in increased snag numbers and
stream channel downfalls, shrub density, and herbaceous vegetation cover
would probably encourage American mink activity.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the term: litter

Diurnal Activity: American mink are chiefly nocturnal but also somewhat
crepuscular [1]. In Manitoba radio-collared American mink were most active at
night, with intermediate levels of activity at dawn and dusk. They were
more active, with more extensive movements, in April than in May, June,
or July [2].

Breeding season: In most areas the mating period occurs from late
February to early April, peaking in March [1,23]. In southern Florida,
however, American mink mate in the late wet season (autumn). Hydroperiod
determines prey abundance and availability in southern Florida, which
appear to determine breeding season. Female American mink were found to be
lactating in March and April, slightly earlier than populations farther
north [19].

Gestation and Development of Young: Gestation ranges from 40 to 75
days, depending on pre-implantation period. Young are born 28 to 30
days after implantation, in April or May [1,10,23]. Neonates are
altricial and have sparse, light-colored hairs. The first teeth emerge
at 2 to 3 weeks, eyes open at about 3 weeks, and solid food is first
taken at about the same time. By 35 days the young are fully
homeothermic. By 7 weeks they have achieved 40 percent of their adult
body weight and 60 percent of adult body length. Litters disperse in
early fall [23]. Females attain adult weight at 4 months; males do not
attained adult weight until 9 to 11 months [4].

Productivity: A typical litter consists of 3 or 4 kits and ranges from
2 to 10. The average age at sexual maturity is 12 months for females,
18 months for males [4]. Neonates have higher survival rates in warm
than in cold weather. American mink have been reported to remain fecund for 7 or
more years [23].
  • 1. Allen, Arthur W. 1986. Habitat suitability index models: mink. Biol. Rep. 82 (10.127). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 23 p. [11713]
  • 2. Arnold, Todd W.; Fritzell, Erik K. 1987. Activity patterns, movements, and home ranges of prairie mink. Prairie Naturalist. 19(1): 25-32. [25980]
  • 4. Banfield, A. W. F. 1974. The mammals of Canada. Toronto: University of Toronto Press. 438 p. [25152]
  • 19. Humphrey, Stephen R.; Zinn, Terry L. 1982. Seasonal habitat use by river otters and Everglades mink in Florida. Journal of Wildlife Management. 46(2): 375-381. [25986]
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]
  • 10. DeGraaf, Richard M.; Yamasaki, Mariko. 1986. New England wildlife: habitat, natural history, and distribution. Gen. Tech. Rep. NE-108. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 491 p. [21386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Mink communicate using a variety of cues, including chemical, visual, and auditory signals. They are fairly quiet, but rely heavily on chemical signaling for communicating territorial boundaries and reproductive status.

Mink have excellent senses of vision, smell, and hearing.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Mink communicate using odors, visual signals, and sounds. They are fairly quiet, but rely heavily on odors for communicating territorial boundaries and for finding mates.

Mink have excellent senses of vision, smell, and hearing.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Mainly nocturnal and crepuscular. May reduce activity in severe winter weather.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The maximum lifespan for a mink is usually around 10 years.

Typical lifespan

Status: wild:
10 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The maximum lifespan for a mink is usually around 10 years.

Typical lifespan

Status: wild:
10 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 11.4 years (captivity) Observations: In the wild, these animals may live up to 10 years (Bernhard Grzimek 1990). In captivity they may live 11.4 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

During the winter, female mink become fertile and mate with one or more males (who are also promiscuous).

Mating System: polygynandrous (promiscuous)

Both males and females begin mating at ten months (Chapman and Feldhamer 1982). Once a female is impregnated, her gestation period varies from 40 to 75 days (Kurta 1995). The young are born in late spring (April or May), with litter sizes usually ranging between 1 to 8 individuals (Chapman and Feldhamer 1982). Each newborn weighs 8 to 10 grams and appears pink and wrinkled, with a thin coat of white fur covering the body.

Breeding interval: Breeding occurs once yearly.

Breeding season: Mating occurs during the winter months.

Range number of offspring: 1 to 8.

Range gestation period: 40 to 75 days.

Average weaning age: 6 weeks.

Range time to independence: 6 to 10 months.

Average age at sexual or reproductive maturity (female): 10 months.

Average age at sexual or reproductive maturity (male): 10 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

The young open their eyes at three and a half weeks and are weaned at a month and a half (Van Gelder 1982). They remain with the mother through the summer until fall, when they leave to establish their own territories.

Parental Investment: altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor, MI: The University of Michigan Press.
  • Chapman, J., G. Feldhamer. 1982. Wild Mammals of North America. Baltimore and London: The Johns Hopkins University Press.
  • Van Gelder, R. 1982. Mammals of the National Parks. Baltimore, MD: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in northern states late February to early May, peak in March. Gestation lasts 40-75 (average 51) days; implantation is delayed. Litter size is 2-10 (average 3-4). Young begin to venture from nest after about 7 weeks, weaned at 8-9 weeks. Male sometimes may help care for young. Sexually mature in 10 months.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the winter, female mink become fertile and mate with one or more males (who also have more than one mate).

Mating System: polygynandrous (promiscuous)

Both males and females begin mating at ten months. A female's pregnancy period varies from 40 to 75 days. The young are born in late spring (April or May), with litter sizes usually ranging between 1 to 8 individuals. Each newborn weighs 8 to 10 grams and appears pink and wrinkled, with a thin coat of white fur covering the body.

Breeding interval: Breeding occurs once yearly.

Breeding season: Mating occurs during the winter months.

Range number of offspring: 1 to 8.

Range gestation period: 40 to 75 days.

Average weaning age: 6 weeks.

Range time to independence: 6 to 10 months.

Average age at sexual or reproductive maturity (female): 10 months.

Average age at sexual or reproductive maturity (male): 10 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

The young open their eyes at three and a half weeks and are weaned at a month and a half. They remain with the mother through the summer until fall, when they leave to establish their own territories.

Parental Investment: altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Kurta, A. 1995. Mammals of the Great Lakes Region. Ann Arbor, MI: The University of Michigan Press.
  • Chapman, J., G. Feldhamer. 1982. Wild Mammals of North America. Baltimore and London: The Johns Hopkins University Press.
  • Van Gelder, R. 1982. Mammals of the National Parks. Baltimore, MD: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neovison vison

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAATCGATGATTATTTTCTACTAACCATAAAGATATTGGCACCCTCTACCTTTTATTCGGCGCATGAGCCGGAATAGTAGGAACTGCTCTTAGTCTTCTAATCCGTGCTGAACTAGGTCAACCTGGCGCCCTGCTAGGAGACGACCAGATTTACAATGTAATCGTAACAGCCCACGCATTTGTAATAATTTTCTTCATAGTAATACCTATTATAATTGGGGGCTTTGGAAACTGACTCATCCCTCTGATAATCGGTGCACCTGATATAGCATTTCCACGAATAAATAATATAAGCTTCTGACTTCTACCCCCCTCTTTCCTTCTCCTTTTAGCTTCCTCAATGGTAGAGGCAGGCGCAGGAACAGGATGAACCGTTTATCCTCCCTTAGCAGGAAACCTAGCACACGCAGGAGCATCCGTAGACCTAGCAATTTTCTCCCTACACTTAGCAGGAATTTCATCTATTCTAGGGTCTATCAACTTTATCACTACTATTATTAACATAAAACCTCCCGCTATATCACAATACCAAACCCCCTTATTCGTATGATCTGTCTTAGTTACAGCTGTATTACTACTTCTATCCTTGCCAGTCCTAGCAGCAGGTATTACTATGTTACTCACGGACCGCAATCTGAATACTACTTTCTTTGACCCAGCCGGAGGAGGAGACCCTATCCTATATCAACACCTATTCTGATTTTTCGGACACCCCGAAGTTTATATCTTAATTCTACCAGGATTTGGCATTATTTCACATGTAGTAACTTACTACTCAGGAAAAAAAGAACCTTTTGGTTACATAGGGATAGTATGAGCAATGATATCAATCGGCTTCCTAGGATTTATTGTATGAGCCCACCATATGTTCACTGTAGGCCTAGACGTAGACACACGAGCATATTTCACTTCAGCTACCATAATTATTGCTATCCCAACAGGTGTAAAAGTATTTAGCTGATTAGCTACGCTGCACGGAGGGAACATCAAATGATCTCCAGCTATGCTATGGGCCTTAGGGTTTATCTTTTTATTTACAGTGGGTGGCTTAACGGGTATTGTATTATCAAACTCATCACTAGACATCGTTCTTCACGATACATATTACGTAGTAGCACATTTTCACTACGTTCTTTCAATAGGGGCAGTATTTGCAATCATAGGCGGATTCGTTCACTGGTTCCCATTATTTACAGGCTACACCCTAAATGATACTTGAGCAAAAATCCACTTTACAATCATATTTGTAGGAGTAAATATAACATTCTTTCCCCAACATTTCCTAGGATTATCAGGTATACCTCGACGCTACTCTGATTACCCAGACGCATACACAACATGAAACACAGTATCTTCCATAGGCTCATTCATTTCACTAACAGCAGTAATACTAATAATCTTCATAATTTGAGAAGCCTTTGCATCCAAACGAGAAGTATCTACAGTAGAATTAACCTCAACAAACATCGAATGACTACATGGATGTCCTCCCCCATACCACACATTCGAAGAACCAACCTATGTATTATCCAAGTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Neovison vison

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The main threat towards mink survival is the continued existence of the fur market. Forty-seven states and all Canadian provinces currently conduct limited trapping seasons on mink, with the length of the season varying from area to area (Chapman and Feldhamer 1982). Quotas on catch size have also been set in many places. Both of these tactics allow the limited removal of mink in order that population densities will remain constant.

Another threat includes the destruction of mink habitat. Mink depend heavily on aquatic areas. Creating, enhancing, and maintaining such habitat allows for the continued existence of healthy populations throughout the range of the species (Chapman and Feldhamer 1982).

The presence of environmental contaminants such as mercury and hydrocarbon compounds (e.g., DDT and PCBs) pose an additional threat to mink (Kurta 1995). These chemicals accumulate within the mink's tissues and can cause problems in reproduction or even threaten the animal's life. Closer regulation over the use and disposal of these chemicals is necessary.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reid, F. & Helgen, K.

Reviewer/s
Duckworth, J.W. (Small Carnivore Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Contributor/s

Justification
This species is listed as Least Concern as the species has a wide distribution range and is relatively common across its range. Although local declines have occurred, the species is secure in many areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in North America, and introduced and established in the Old World; local declines have occurred, but the species is secure in many areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The biggest threat towards mink survival is the continued existence of the fur market. Forty-seven states and all Canadian provinces now have limited trapping seasons on mink, with the length of the season varying from area to area. Limits on the number of mink that can be caught have also been set in many places. Both of these strategies allow the limited removal of mink in order that wild populations will remain constant.

Another threat includes the destruction of mink habitat. Mink depend heavily on wetlands. Creating, enhancing, and maintaining such habitat allows for the continued existence of healthy populations throughout the range of the species.

The presence of pollution such as mercury and hydrocarbon compounds (e.g., DDT and PCBs) also threatens mink. These chemicals build up within the mink's tissues and can cause problems in reproduction or even threaten the animal's life. Closer regulation over the use and disposal of these chemicals is necessary.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Information on state- and province-level protection status of animals in the
United States and Canada is available at NatureServe, although recent
changes in status may not be included.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S. Federal Legal Status

None [34]
  • 34. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]. Available: http://www.fws.gov/endangered/. [86564]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Introduced. Dispersal of American mink is controlled by the following legislation: Mink Keeping Order 2000 (separate Acts relevant for England, Wales and Scotland). Release of American mink is illegal under Schedule 9 (Part I) of the Wildlife and Countryside Act 1981 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Generally abundant throughout its distribution (Larivière, 1999). Population density of about 1-8/km2 have been recorded (Nowak, 2005). In good habitat, density may be 9-22 per sq mile (Banfield 1974).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Wild populations of American mink are still hunted for fur. Alteration of its habitat, namely densely vegetated river courses and other wetlands represents another threat for this species. The American mink is known to suffer from environmental pollution caused by chlorinated hydrocarbons (PCBs) which may even cause infertility (Schreiber et al., 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Other than preying on our native fauna, the American mink may also carry Aleutian disease, a virus of fur farms that can be transmitted to native carnivores (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
American mink is currently the most important species in fur-fanning operations (Peterson, 1966; Thompson, 1968). The American mink is among the most valuable fur animals, most of the mink fur used in commerce is produced on farms (Nowak, 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the terms: cover, density, shrubs

In Quebec Burgess [6] noted an increase in American mink activity with habitat
improvement consisting of the creation of pools at least 1 meter deep by
placing logs and/or rocks into the stream channel which formed small
dams. It was reported that 1) temperatures were similar in control and
improved sections of stream, 2) aquatic insect production was somewhat
higher in the improved section, and 3) trout and crayfish biomasses were
higher in the improved section [7].

Development of shorelines that reduces structural diversity and removes
snags and debris reduces American mink activity. Removal of downfall and other
debris from the water near shore, and reduction or elimination of
aquatic vegetation reduces crayfish production and contributes to
reduced American mink activity [1]. In Ontario residential development around
lakes resulted in decreased American mink activity due to loss of trees, decreased
density of shrubs, reduction of aquatic snags, and removal of submergent
and floating vegetation. In areas undergoing development, 52 of 59 dens
were on undeveloped sections of shoreline [30].

Stream channelization has a negative impact on American mink activity since
suitable prey abundance is reduced when shallow, detritus-rich sloughs
associated with meandering streams are replaced with abrupt, monotypic
interfaces between aquatic and terrestrial cover types. In Mississippi
and Alabama comparison of American mink activity was made among a newly
channelized segment, an old (55 years) channelized segment, and an
unchannelized segment of a river. American mink track counts were highest in the
unchannelized segment, lower in the old channelized segment, and very
sparse in the newly channelized areas. Abundance and density of
herbaceous vegetation were highest on the unchannelized segment [16].

There are controlled American mink trapping seasons in 47 states and all
provinces. Hunting is also allowed in five states as well as in Nova
Scotia [23]. Trapping rates fluctuate widely from year to year; price
and harvest are not significantly correlated. The extent to which
trapping affects populations is not known [23]. Fur harvest records,
though not necessarily direct indications of population levels, show
that Louisiana, Minnesota, and Wisconsin produce the most wild pelts in
the United States. Saskatchewan and Manitoba lead the numbers in
Canada. These harvest records reflect the relative amount of wetlands
in the leading American mink producing areas [1]. In southeastern Alaska mink is
the most abundantly harvested furbearer [26].

Linscombe and others [23] discuss parasites and diseases of American mink.
  • 1. Allen, Arthur W. 1986. Habitat suitability index models: mink. Biol. Rep. 82 (10.127). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 23 p. [11713]
  • 6. Burgess, S. A. 1978. Aspects of mink ecology in the southern Laurentians of Quebec. Montreal, PQ: McGill University. 87 p. Thesis. [27377]
  • 7. Burgess, Stephen A.; Bider, J. R. 1980. Effects of stream habitat improvements on invertebrates, trout populations, and mink activity. Journal of Wildlife Management. 44(4): 871-880. [25982]
  • 16. Gray, Marion H.; Arner, Dale H. 1977. The effects of channelization on furbearers and furbearer habitat. Proceedings, Annual Conference of Southeastern Association of Fish and Wildlife Agencies. 31: 259-265. [25340]
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]
  • 26. Meehan, William R. 1974. The forest ecosystem of southeast Alaska: 4. Wildlife habitats. Gen. Tech. Rep. PNW-16. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 32 p. [13479]
  • 30. Racey, G. D.; Euler, D. L. 1983. Changes in mink habitat and food selection as influenced by cottage development in central Ontario. Journal of Applied Ecology. 20(2): 387-402. [25984]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Eradication of mink throughout Britain is unlikely and would be extremely expensive; however, populations remain low where regular culling is carried out on a local basis. Sensitive areas could be fenced off (5), and on previously predator free islands, such as Harris, which supports internationally significant populations of nesting sea birds; eradication of mink is essential (5). It is now apparent that in areas where otters have made a recovery, mink have been declining (5), this is certainly encouraging news.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

The only negative affects that can be attributed to mink is the possible competition between mink and humans for water fowl or other game species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mink pelts have for years been considered one of the most luxurious furs on the market. Originally all fur came from natural populations, causing a severe strain on the species. However, starting in the mid 1900s, mink ranches were established to help bring a more consistent pelt supply to the market. Ranching was very successful, with the number of mink ranches in the United States reaching a high of 7200 during the mid-1960s (Chapman and Feldhamer 1982). While the number of ranches has declined nationally to 439 (1998), a total of 2.94 million pelts were still produced (both wild and domestic mink), that were valued at $72.9 million dollars (USDA 1999). The quality of a pelt, which significantly affects the price, is determined by its size, color, texture and density.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Raised and trapped for pelt, which yielded about $17 per pelt in the early 1980s in Oklahoma (Caire et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

The only negative affects that mink might have is the possible competition between mink and humans for water fowl or other game species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Mink pelts have for years been considered one of the most luxurious furs on the market. Originally all fur came from wild mink, causing a severe strain on the species. However, starting in the mid 1900s, mink ranches were set up to help bring a more constant pelt supply to the market. Ranching was very successful, with the number of mink ranches in the United States reaching a high of 7200 during the mid-1960s. While the number of ranches has declined nationally to 439 (1998), a total of 2.94 million pelts were still produced (both wild and domestic mink), that were valued at $72.9 million dollars. The quality of a pelt, which affects the price, is determined by its size, color, texture and density.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Wozencraft (in Wilson and Reeder 2005) cited several sources supporting placement of the American mink and sea mink in the genus Neovison rather than in Mustela.

See Humphrey and Setzer (1989) for the description of a new subspecies, halilimnetes, from coastal northwestern Florida. A study of skull variation concluded that "Mustela vison evergladensis" is not a valid subspecies; the Everglades mink population apparently is a disjunct population of the subspecies mink (Humphrey and Setzer 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

American mink
mink
North American mink

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The currently accepted scientific name of American mink is Mustela vison
Schreber. It belongs to the weasel family (Mustelidae) [17]. There are
15 currently accepted American mink subspecies [17,23].
  • 23. Linscombe, Greg; Kinler, Noel; Aulerich, R. J. 1982. Mink: Mustela vison. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America: Biology, management, and economics. Baltimore, MD: The Johns Hopkins University Press: 629-643. [25234]
  • 17. Hall, E. Raymond. 1981. The mammals of North America. 2nd ed. Vol. 2. New York: John Wiley and Sons. 1271 p. [14765]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!