Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Distribution

Range

Mountains of Assam to sw China, n Myanmar and n SE Asia.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Turdus dissimilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCTCTACCTAATCTTCGGCGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTCATTCGAGCAGAATTAGGCCAACCAGGCGCCCTACTAGGCGACGACCAAATCTACAACGTGGTTGTTACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTTATACCAATTATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTTTGACTCCTCCCCCCATCCTTCCTTCTCCTCCTAGCCTCCTCCACAGTAGAAGCCGGAGCAGGAACAGGCTGAACCGTCTATCCTCCCCTCGCTGGTAATCTAGCACACGCAGGGGCTTCAGTAGACTTAGCTATCTTCTCCCTACACCTAGCAGGAATCTCCTCAATCCTAGGTGCCATCAACTTCATCACAACAGCAATCAACATAAAACCGCCTGCCCTCTCACAATACCAAACCCCCCTGTTCGTCTGATCAGTTCTAATCACTGCAGTGCTACTCCTACTATCCCTCCCCGTCCTTGCCGCTGGTATCACTATGCTCCTCACCGACCGCAACCTAAACACAACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAGTACTATACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Turdus dissimilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as common to rare (del Hoyo et al. 2005).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black-breasted Thrush

The Black-breasted Thrush (Turdus dissimilis) is a species of bird in the family Turdidae. It is found in South Asia, Southeast Asia and China. Although both male and female birds have the same colour on their lower parts, the upper section of males is mostly black in colour, while females are mostly grey-brown. Thus, the bird's common name refers to the colour of the male bird's breast. They tend to live in forests located at high altitude.

Taxonomy[edit]

The Black-breasted Thrush belongs to the order Passeriformes and the family Turdidae. The species is a monotypic taxon – it has been hypothesized that it forms part of a larger superspecies, classified together with Tickell's Thrush (T. unicolor) and the Grey-backed Thrush (T. hortulorum). It was previously thought to have conspecificity with the latter species of thrush.[2] The Black-breasted Thrush was first described by Edward Blyth in 1847 and was found in the lower Bengal region.[2]

Description[edit]

The Black-breasted Thrush is 22 centimetres (8.7 in) to 23.5 centimetres (9.3 in) long in total, including its tail.[3][4] Whereas the lower parts are the same colour for both genders, the upper and middle parts are where they differ. For males, the section spanning from their head to the back of their neck and breast area is black, and the remaining areas at the top are slate gray. On the other hand, females are gray-brown from their eyes to their tail, and the section from their throat to their breast is a "diffused" shade of buff.[3]

Habitat[edit]

The bird is found in Bangladesh, China, India, Laos, Myanmar, Thailand and Vietnam.[1][5] Their preferred habitats are tropical and subtropical montane forests that are moist.[1] Other suitable habitats that are less important include tropical and subtropical dry forests – for native populations that are resident – as well as tropical/subtropical moist shrubland and mangroves located above the level of high tide.[1] In southwestern China, these birds can also be found in hilly areas.[6]

They are typically found at relatively high elevations of between 1,220 metres (4,000 ft) to 2,500 metres (8,200 ft) high. However, they tend to descend to lower altitudes during the winter at around 200 metres (660 ft).[4]

The Black-breasted Thrush has been placed on the Least Concern category of the IUCN Red List, even though its population has been decreasing throughout the last ten years. This is because the reduction in the estimated population is not swift enough to merit Vulnerable status under the IUCN criterion for population trend, which is a decline of more than 30% in ten years or three generations[1] The population decline has been attributed to continuing "destruction and degradation"[7] of the bird's natural habitat. The size of its distribution range is over 752,000 square kilometres (290,000 sq mi).[7]

Behavior[edit]

The call of the Black-breasted Thrush has been described as "sweet mellow"[4] and "melodious",[3] with their musical phrases spanning 3–8 notes.[4] They consume insects, molluscs and berries. The food they gather is usually from the ground, although they occasionally fly to fruit trees.[3] Their time of breeding differs depending on the country in which they are situated. Black-breasted Thrushes in India reproduce from April to July; those in Myanmar do so from April to June; in China, these birds mate from May until June.[3]

References[edit]

  1. ^ a b c d e BirdLife International (2012). "Turdus dissimilis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 16 January 2014. 
  2. ^ a b "Mangrove Robin (Peneoenanthe pulverulenta)". Handbook of the Birds of the World. Internet Bird Collection. 2003. Retrieved 16 January 2014. 
  3. ^ a b c d e "Black-breasted thrush". Toronto Zoo. Retrieved 16 January 2014. 
  4. ^ a b c d Robson, Craig; Allen, Richard (2005). New Holland Field Guide to the Birds of South-East Asia. New Holland Publishers. Retrieved 16 January 2014. 
  5. ^ MacKinnon, John Ramsay (8 June 2000). A Field Guide to the Birds of China. Oxford University Press. Retrieved 15 January 2014. 
  6. ^ Walters, Martin (2008). Chinese Wildlife: A Visitor's Guide. Bradt Travel Guides. Retrieved 16 January 2014. 
  7. ^ a b "Black-breasted Thrush (Turdus dissimilis)". BirdLife International. 2013. Retrieved 16 January 2014. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!