Overview

Brief Summary

Passerella iliaca

A large (6 ¾ -7 ½ inches) bunting, the Fox Sparrow is most easily identified by its reddish-brown back, streaked breast, and gray face. Other field marks include a large conical bill, long tail, and white throat patch. Male and female Fox Sparrows are similar in all seasons. The Fox Sparrow breeds across Alaska and central Canada. In the west, this species’ range extends south at higher elevations into the United States as far south as southern California. In winter, this species migrates south to the Pacific coast from Washington south to Baja California, the eastern U.S., and parts of the desert southwest. Fox Sparrows breed in a variety of thick shrubby woodland habitats, particularly those with low willow, fir, and spruce bushes. During the winter, this species may be found in thickets in shrub lands and along woodland edges. Fox Sparrows primarily eat insects in summer, adding seeds and grains to their diets during the winter. In appropriate habitat, Fox Sparrows may be observed foraging for food on the ground below shrubs and small trees. Birdwatchers may also listen for this species’ song, a series of whistles and trills that is softer and more fluid than that of the Song Sparrow (Melospiza melodia). Fox Sparrows are most active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least Concern

  • Passerella iliaca. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Red Fox-sparrow (Passerella iliaca). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Weckstein, Jason D., Donald E. Kroodsma and Robert C. Faucett. 2002. Fox Sparrow (Passerella iliaca), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/715
  • eBird Range Map - Fox Sparrow. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Fox sparrows, Passerella iliaca, are found in much of northern and western North America. In the summer during their breeding season, they are found across northern Canada and Alaska, and also south through parts of western North America. During the winter they migrate towards the Pacific coast, from southern British Columbia and south to northern Baja California. They also extend across the southern area of the United States, from northern Mexico to Illinois and Connecticut.

Biogeographic Regions: nearctic (Native )

  • Byers, C., J. Curson, U. Olsson. 1995. Sparrows and Buntings. New York: Houghton Mifflin Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDING: western and northern Alaska, northern Yukon, Mackenzie, southwestern Keewatin, northern Manitoba, northern Ontario, northern Quebec, and northern Labrador south along the Pacific coast to northwestern Washington, in the western mountains to southern California, Nevada, Utah, and Colorado, and, east of the Rockies, to central Alberta, central Saskatchewan, central Manitoba, central Ontario, southern Quebec, New Brunswick, Nova Scotia, and Newfoundland (AOU 1983). Breeding strongly suspected in Sierra San Pedro Martir, Baja California (Erickson and Wurster 1998). NON-BREEDING: southern Alaska and southern British Columbia southward through Pacific states to northern Baja California, and from Arizona, New Mexico, Kansas, Iowa, Wisconsin, Indiana, southern Ontario, southwestern Quebec, New Brunswick, Nova Scotia, and southern Newfoundland south to northern Sonora (casually), New Mexico, Texas, Gulf coast, and Florida (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Fox sparrows are one of the largest of sparrows, measuring from 15 to 19 cm in length, and weighing from 26.9 to 49.0 grams. Their wingspan is typically from 26.67 to 29.85 cm and their basal metabolic rate is 66.9 cm^ oxygen per hour, on average. Fox sparrows are divided into 18 different races, all of which are large, but each looks slightly different. All fox sparrows also have a long tail and a bi-colored dark and pale yellow bill. They also have dark brown streaks on their breasts that meet at one common point. The 18 races are divided into three larger groups, including the northern and eastern birds, the southern Rocky Mountain and Sierra birds, and the northern Pacific coast birds. The eastern and northern races have a grayish head that is streaked with rust, and a red or rust rump and tail. They also have a blotchy white breast. The southern Rocky Mountain and Sierra group has a solid gray head, and also has a rust colored rump and tail. Finally, the northern Pacific coast group is very uniform and dark brown in color. Within each of the races, the individuals show no significant differences in coloration between males and females. The males are slightly larger than the females. Juvenile fox sparrows are very similar to the adults in appearance, however the upper-parts are slightly duller and the streaks on the breast are smaller and narrower.

Range mass: 26.9 to 49 g.

Average mass: 36.9 g.

Range length: 15 to 19 cm.

Range wingspan: 26.67 to 29.85 cm.

Average basal metabolic rate: 66.9 cm3.O2/g/hr.

Sexual Dimorphism: sexes alike; male larger

Other Physical Features: endothermic ; bilateral symmetry

  • Canterbury, G. 2002. Metabolic adaptation and climatic constraints on winter bird distribution. Pp. 946-957 in Ecology, Vol. 83. Accessed April 02, 2004 at http://www.esapubs.org/archive/ecol/E083/014/appendix-A.htm.
  • Trerres, J. 1980. Finch Family. Pp. 342-343 in Encyclopedia of North American Birds, 1st Edition. United States Of America: Alfred A. Knopf, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 18 cm

Weight: 32 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fox sparrows commonly breed in coniferous or mixed forests, which have dense undergrowth and shrub. They also breed in woodland thickets, scrub, chaparral, and riparian woodland. During the winter months, fox sparrows are commonly found in forests, forest edges, woodlots, and other woodland habitats that have dense undergrowth.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: chaparral ; forest ; scrub forest ; mountains

Other Habitat Features: riparian

  • Alsop III, F., J. Hamilton, M. Clayton, C. Wills, R. Greenberg, S. DeLuca. 2001. Fox Sparrow. Pp. 901 in Birds Of North America, 1st Edition. DK Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Dense thickets in coniferous or mixed woodlands, chaparral, parks, and gardens, wooded bottomlands along rivers and creeks. Requires dense brushy cover during the nesting season.

May nest on ground or in shrubs and trees. Nest usually at height below 2 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Mostly a long-distance migrant; moves northward in March-April. Migrations more localized on west coast.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Fox sparrows are omnivorous. They forage on the ground by double scratching and quickly kicking backwards with both feet simultaneously. They dig holes in the leaf litter and ground, which allows them to reach buried seeds or insects. They look for weed seeds, blueberries, other wild fruit and especially Polygonum (knotweed). They also look for spiders (Araneae), insects, millipedes (Diplopoda), and small snails (class Gastropoda). Nestlings are fed primarily insects.

Animal Foods: insects; terrestrial non-insect arthropods; mollusks

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Forages on the ground for seeds (e.g., smartweed, ragweed). Also eats berries (e.g., blueberries, elderberries) grapes and other fruits. May eat invertebrates (e.g., beetles, spiders, millipedes and crane flies).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Fox sparrows act as predators of insects, spiders, millipedes and small snails and are important prey for their predators. It is also interesting to note that fox sparrows are occasionally parasitized by brown-headed cowbirds (Molothrus ater).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Because their nests are placed on the ground, fox sparrows face predation by hawks (family Accipitridae), mammalian carnivores (order Carnivora), and possibly snakes (suborder Serpentes). In order to protect their young when there is a predator, adults give a broken wing display. During the display the adult limps around with one wing up, acting as if it was broken, and calls sharply. Once the predator is distracted, the adult flies back to the nest and young.

Known Predators:

  • hawks (Accipitridae)
  • mammalian carnivores (Carnivora)
  • snakes (Serpentes)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Passerella iliaca is prey of:
Carnivora
Serpentes
Accipitridae

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Passerella iliaca preys on:
Mollusca
Arthropoda
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Fox sparrows have a voice that is thought to be one of the finest among sparrows. The song is generally presented while the sparrow sits on the top of a bush or on a low branch in a tree. The male usually sings in a concealed area in the territory around its nest. Fox sparrows sing very often during breeding season, but keep themselves hidden at the same time. A distinctive song is one that is used when the bird is alarmed. It is commonly heard when fox sparrows are in some way disturbed near their nest. Singing is occasional, but not common, in the winter.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The oldest fox sparrow recovered at the Patuxent Wildlife Research Center was in 9 years and 8 months old.

Range lifespan

Status: wild:
9.6 (high) years.

Average lifespan

Status: wild:
124 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.3 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Fox sparrows tend to be monogamous and solitary while breeding. The male usually sings in the general area of the nest, while keeping himself hidden. The sounds created are identified as call-notes, and they have not been shown to be a way to attract females, but rather are a song as a protest against intrusion into the territory by other males. These typically shy birds only become defensive when their nest territory is invaded by other birds.

Mating System: monogamous

Fox sparrows may breed up to two times a year. The breeding season is from mid-May to July. The number of eggs laid per clutch ranges from 3 to 5. The eggs are pale blue to pale green with thick brown spots. The nests of fox sparrows are typically on the ground or in very low branches. They are typically no more than 7 feet above ground. The nests are made out of twigs, dried grass, stems, and bark. The cup shaped nest is lined with grass, animal hair and feathers. It takes from 12 to 14 days for the eggs to hatch; incubation is done mostly by females. The young are typically tended to and fed by both parents. The young fox sparrows fledge in 9 to 10 days after hatching. While there was no specific information on time to independence for this species, the time to independence for sparrows in general is about 10 days. On average, both sexes of fox sparrows reach reproductive maturity when they are about 1 year old.

Breeding interval: Fox Sparrows may breed up to two times a year.

Breeding season: Fox Sparrows breed from mid-May to July

Range eggs per season: 3 to 5.

Range time to hatching: 12 to 14 days.

Range fledging age: 9 to 10 days.

Average time to independence: 10 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Average birth mass: 2.7 g.

Average eggs per season: 4.

Fox sparrows are altricial. The eggs hatch after about 12 to 14 days (females do most of the incubation), and the young fledge about 9 to 10 days later. Fox sparrows are tended to by both parents. They provide food (mainly insects) and protection. While there was no specific information on time to independence for this species, the time to independence for sparrows in general is about 10 days. Both parents will use the broken-wing display to protect their young from predators.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Alsop III, F., J. Hamilton, M. Clayton, C. Wills, R. Greenberg, S. DeLuca. 2001. Fox Sparrow. Pp. 901 in Birds Of North America, 1st Edition. DK Publishing.
  • Baicich, P., C. Harrison. 1997. A Guide to the Nests, Eggs, and Nestlings of North American Birds. Academic Press.
  • Bent, A. 1968. Life Histories of North American Cardinals, Grosbeaks, Buntings, Towhees, Finches, Sparrows, and Allies. Washington D.C.: Smithsonian Institution.
  • Rising, J. 1996. A Guide to the Identification and Natural History of The Sparrows of the United States and Canada. Academic Press.
  • Trerres, J. 1980. Finch Family. Pp. 342-343 in Encyclopedia of North American Birds, 1st Edition. United States Of America: Alfred A. Knopf, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size 3-5. Incubation 12-14 days, mostly by female (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Passerella iliaca

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 21 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATTTTCGGTGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTGCTCATCCGGGCAGAACTAGGCCAACCTGGAGCCCTCCTAGGAGACGACCAAGTCTATAACGTAGTCGTCACAGCCCATGCCTTCGTAATAATCTTCTTCATAGTTATGCCAATCATAATCGGAGGATTCGGAAACTGACTAGTTCCCCTAATAATTGGAGCCCCGGACATAGCATTCCCACGAATAAATAATATAAGCTTCTGACTACTTCCCCCATCCTTCCTACTCCTCTTAGCATCCTCTACTGTTGAAGCAGGCGTCGGCACAGGCTGAACAGTGTACCCCCCACTAGCAGGCAACCTGGCCCACGCTGGAGCCTCAGTCGACCTTGCAATCTTCTCCCTACACCTAGCCGGTATCTCTTCAATCTTAGGGGCAATCAACTTCATTACAACAGCAATTAATATAAAACCCCCTGCCCTTTCACAATACCAAACCCCTTTATTTGTATGATCAGTCTTAATCACTGCAGTCCTCCTACTCNTATCTCTTCCAGTCCTTGCTGCAGGGATCACAATACTTCTTACAGACCGCAACCTCAACACCACATTTTTCGACCCTGCTGGGGGAGGAGACCCCGTTCTATACCAACATCTATTCTGATTCTTCGGCCATCCAGAAGTATATATCCTNATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Passerella iliaca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5