Overview

Brief Summary

The White-throated Sparrow (Zonotrichia albicollis) breeds in coniferous and mixed coniferous-deciduous forests and around forest edges, clearings, bogs, brush, and open woodlands; in migration and on its wintering grounds, these sparrows are also found in deciduous forest and woodland, scrub, and parks and gardens. White-throated Sparrows breed mainly in Canada, with some additional breeding populations in the northernmost portions of the Great Lakes states and in parts of the northeastern United States. They winter along the Pacific coast of the United States (but are relatively rare here) and in approximately the southeastern half of the United States from New Mexico to Kansas, Ohio, and New Hampshire.

This common and widespread sparrow is named for its conspicuously and strongly outlined white throat. It has rusty brown upperparts, a dark bill, dark crown stripes, and a dark eyeline. The broad "eyebrow" (above the eye) is yellow in front of the eye, with the remainder either tan or white (two distinct color morphs). Juveniles have a grayish eyebrow and throat with heavily streaked breast and sides.

The song, which is often heard even in winter, is a thin pensive whistle, generally two single notes followed by three triple notes: "Oh sweet Canada Canada Canada" (or "Old Sam Peabody, Peabody, Peabody"). The sharp tink and lisping tseep calls are frequently heard from flocks of sparrows in thickets.

White-throated Sparrows eat mainly seeds and insects. Insects make up a large part of the diet during the breeding season (and young are fed mainly on insects), but the winter diet consists mainly of "weed" and grass seeds. Especially in fall, many berries may be consumed. White-throated Sparrows forage mainly on the ground under or close to dense thickets, scratching in the leaf litter with both feet.

White-throated Sparrows almost always nest on the ground, at a site well hidden by low shrubs, grass, or ferns. They may occasionally nest above ground up to a height of several meters. The nest (built by the female) is an open cup made of grass, twigs, weeds, and pine needles and lined with fine grass, rootlets, and animal hair. The 4 to 5 eggs (sometimes 3 or 6, rarely 2 or 7) are pale blue or greenish blue and marked with reddish brown and lavender. Eggs are incubated (by the female only) for around 11 to 14 days. Both parents feed the nestlings. Young typically leave the nest 8 to 9 days after hatching, but are tended by the parents for at least another 2 weeks.

Researchers have identified behavioral differences associated with the white-striped versus tan-striped morphs. Both males and females may exhibit either color, but adults nearly always mate with the opposite color morph. White-striped males tend to be more aggressive and to sing more than tan-striped males. White-striped females also sing, but tan-striped females generally do not. Pairs involving a tan-striped male and white-striped female usually form more quickly than the opposite combination. Tan-striped adults tend to feed their young more than white-striped adults.

Migration occurs mostly at night. White-throated Sparrows tend to migrate relatively late in the fall, gradually moving south to their wintering grounds.

(Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Dunn, J.L. and J. Alderfer. 2011. National Geographic Field Guide to the Birds of North America. National Geographic Society, Washington, D.C.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston
Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

During the summer, white-throated sparrows generally breed from northwestern Canada including Central Quebec and Newfoundland, all the way eastward to Minnesota and the Great Lakes, and southward to New England. In the winter, most white-throated sparrows overwinter in the eastern United States, ranging from New England in the north to northern Mexico in the south. In addition, a very small number of Zonotrichia albicollis migrate to West Oregon, occupying the Columbia and Klamath River Basins.

Biogeographic Regions: nearctic (Native )

  • Robbins, N. 1992. Breeding in White-Throated Sparrow. Journal of North American Birds, Conder 94, V21: 336-343.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: BREEDING: southeastern Yukon to Labrador, south to central British Columbia, southern Saskatchewan, Great Lakes region, West Virginia, and New Jersey. NON-BREEDING: southeastern Iowa to southern New England, south to northeastern Mexico, Gulf Coast, and southern Florida, west across southwestern U.S. to California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range

Breeds n North America; > to s US and n Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

White-throated sparrows are native only to the Nearctic region. During the summer, white-throated sparrows generally breed from northwestern Canada including Central Quebec and Newfoundland, all the way eastward to Minnesota and the Great Lakes, and southward to New England. Most white-throated sparrows migrate south to spend the winter in the eastern United States, ranging from New England in the north to northern Mexico in the south. A very small number of birds migrate to west Oregon, occupying the Columbia and Klamath River Basins.

Biogeographic Regions: nearctic (Native )

  • Robbins, N. 1992. Breeding in White-Throated Sparrow. Journal of North American Birds, Conder 94, V21: 336-343.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

White-throated sparrows are small birds. The head has black stripes on top, with grey below and on the sides. Some adults have tan between the black stripes, while others have white. Young birds in their first year always have tan on the head and have dark streaks on a pale chest and belly.

There are bright yellow blotches between the bill and the eyes on both males and females. True to their name, these sparrows have a "white-throat" with a black border, and a whitish belly. The back is brown with dark streaks and the wings are reddish-brown. White-throated sparrows have dark brown bills and pink legs. Females and males look very similar; female colors are only slightly duller than males.

White-crowned sparrows are other birds that look very similar, but do not have white throats and dark bills.

Average mass: 26 g.

Average length: 17 cm.

Average wingspan: 22.86 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male more colorful

Average mass: 21.1 g.

Average basal metabolic rate: 0.278 W.

  • Peterson, B. 1987. Abundance and Distribution of Birds in Canada. Canada Biological Survey, Biological Notes #19: 56-59.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

White-throated sparrows are approximately 2.6 - 2.9 cm long. The head has tan and black stripes on top, with grey below and on the sides of the head. Adults have both tan and white stripes, as opposed to first year birds which only have tan stripes but are heavily streaked underneath. White-throated sparrows are sexually dimorphic, meaning the male and female are somewhat different. There are small variations in the coloration between the males and females. Male sparrows have darker stripes on the head and brighter yellow blotches.

Between the bill and the eyes, on both males and females, there are bright yellow blotches. Zonotrichia albicollis has a "white-throat" with a black border, and a whitish belly. The back is brown with dark streaks and the wings are also brown. White-throated sparrows have dark bills and pink legs. The dark bill separates it from similar white-crowned sparrows.

Average mass: 26 g.

Average length: 17 cm.

Average wingspan: 22.86 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male more colorful

Average mass: 21.1 g.

Average basal metabolic rate: 0.278 W.

  • Peterson, B. 1987. Abundance and Distribution of Birds in Canada. Canada Biological Survey, Biological Notes #19: 56-59.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 17 cm

Weight: 26 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

White-throated sparrows are found mainly in coniferous forests and northern decidious forests. In the winter they can also be found off the western coasts of Oregon, as well as in dry deserts in the state of Texas. They favor partially open wooded areas that have shrubby growth or brush. White-throated sparrows love to hide in brushy fencerows, in blackberry tangles, forest edges, shrubby willows, and even borders of swamps with a dense overgrowth of brush.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest

Wetlands: swamp

  • Gilligan, H. 1994. Zonotrichia abicollis. Littleton, CO: Westfield Publishing Company, Inc..
  • Slivoski, J. 1998. "White-throated Sparrow" (On-line). Accessed October 24, 2000 at http://www.slivoski.com/birding/nindex.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zonotrichia albicollis is found mainly in coniferous forests and northern decidious forests. In the winter they can also be found off the western coasts of Oregon, as well as in dry deserts in Texas. Zonotrichia albicollis favors semi-open wooded areas that have sufficient and shrubby growth or brush. White-throated sparrows love to hide in brushy fencerows, in Himalayan blackberry tangles, forest edges, shrubby willows, and even borders of swamps with a dense overgrowth of brush.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest

Wetlands: swamp

  • Gilligan, H. 1994. Zonotrichia abicollis. Littleton, CO: Westfield Publishing Company, Inc..
  • Slivoski, J. 1998. "White-throated Sparrow" (On-line). Accessed October 24, 2000 at http://www.slivoski.com/birding/nindex.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Coniferous and mixed forest, forest edge, clearings, bogs, brush, thickets, open woodland. In migration and winter also in deciduous forest and woodland, scrub, shrubbery, gardens, parks, cattail marshes. BREEDING: Nests on ground at edge of clearing, usually by or under shrubs, tree branches, grass tufts, weed clumps, and ferns; exceptionally above ground in thick bushes or low in tree (Harrison 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

White-throated sparrows are omnivores. Their diet consists of seeds, fruits, and insects. Seeds come from the floor of forests, in bushy clearings and hidden in grasses and weeds. These sparrows also feed on wild fruits from blackberry tangles and shrubs. Insecta are eaten when they are available; parents also feed insects to their chicks.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Zonotrichia albicollis, like almost all members of Aves, are omnivores. Their diet consists of seeds, fruits, and insects. Seeds come from the floor of forests and bushy clearings. The white-throated sparrow also finds seeds hidden in grasses and weeds. Zonotrichia albicollis also feed on wild fruits from blackberry tangles, shrubbery, and insects when available and feed young in the nest almost exclusively insects.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mostly weeds seeds, also small fruits, buds, and insects; forages mostly on ground (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

White-throated sparrows are important members of their ecosystems, being important both as seed dispersers and predators and as prey to larger mammals and birds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Sparrow eggs, chicks, and even adults are vulnerable to many mammal and bird predators. A few are listed below. To avoid predators, they rely on cryptic coloration (camouflage) and the ability to fly. White-throated sparrow nests are always near trees, stumps, or logs. Sparrows use these places as perches to look out for predators.

Known Predators:

  • raccoons (Procyon_lotor)
  • least weasels (Mustela_nivalis)
  • Cooper's hawks (Accipiter_cooperii)
  • domestic cats (Felis_silvestris)
  • great horned owls (Bubo_virginianus)
  • American crows (Corvus_brachyrhynchos)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

White-throated sparrows are important members of their ecosystems, being important both as seed dispersers and predators and as prey to larger mammals and birds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Sparrow eggs, chicks, and even adults are vulnerable to many mammal and bird predators. A few are listed below. To avoid predators, they rely on cryptic coloration (camouflage) and the ability to fly. White-throated sparrow nests are always near trees, stumps, or logs. Sparrows use these places as perches to look out for predators.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

The voice or call of white-throated sparrows sounds like they are saying "Poor Sam Peabody." They use an array of other vocalizations as well.

White-throated sparrows have keen vision and hearing.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

The voice or call of white-throated sparrows sounds like they are saying "Poor Sam Peabody." They use an array of other vocalizations as well.

White-throated sparrows have keen vision and hearing.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

A white-throated sparrow banded in the United States lived at least 9 years and 8 months.

Range lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: wild:
116 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

A white-throated sparrow banded in the United States lived at least 9 years and 8 months.

Range lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: wild:
116 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9.7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

White-throated sparrows have their babies after the adult birds migrate north in the spring and have settled into northwestern Canada and northeastern United States. The birds build open-cup nests (shaped like a cup) in small trees or shrubs or on the ground. They prefer partially open shrubby areas or forests, mostly at the edges of clearings. Females lay 3 to 6 eggs, usually 4. Only the female sits on the eggs to keep them warm (called incubating the eggs). It takes approximately 3-4 weeks for the chicks to hatch. About 9 days after hatching the young birds can begin leaving the nest, which is called fledging.

Breeding interval: Usually females only lay eggs once each year, but sometimes after the first brood has left the nest, a female will lay eggs again and raise a second brood of chicks.

Breeding season: Breeding occurs each spring.

Range eggs per season: 3 to 6.

Average eggs per season: 4.

Range time to hatching: 3 to 4 weeks.

Range fledging age: 7 to 12 days.

Average fledging age: 9 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

Newborn sparrows are helpless when they hatch. They do not have feathers, so they do not have one of the most important forms of insulation to keep warm and need to rely on their parents. They stay in the nest, waiting for both parents to feed them.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

White-throated sparrows reproduce seasonally, mainly during the spring when they have settled into northwestern Canada and northeastern United States. Zonotrichia albicollis lay 3 to 6 eggs, usually 4, in open-roofed nests they build for their young.

Young sparrows can breed in the first year after hatching.

Breeding interval: Usually females only lay eggs once each year, but sometimes after the first brood has left the nest, a female will lay eggs again and raise a second brood of chicks.

Breeding season: Breeding occurs each spring.

Range eggs per season: 3 to 6.

Average eggs per season: 4.

Range time to hatching: 3 to 4 weeks.

Range fledging age: 7 to 12 days.

Average fledging age: 9 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

It takes approximately 3 to 4 weeks for the young chick to hatch. Even then, first born sparrows are not well developed; they are altricial, missing feathers, one of the most important forms of insulation. Without feathers, Zonotrichia albicollis cannot fly. The newborn sparrow stays in the nest, waiting for its both parents to feed it and attend to its every need. It fledges 8 or 9 days after it hatches.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size 4-6. Rarely more than 1 brood per year. Incubation 11-14 days, by female. Young tended by both parents, leave nest at 7-12 days (usually 8-9), can fly about 2-3 days later.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Zonotrichia albicollis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 26 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATTTTCGGCGCATGAGCTGGAATAGTGGGTACCGCCCTAAGCCTTCTCATCCGGGCAGAACTAGGCCAACCCGGAGCCCTCCTGGGAGACGACCAGGTCTATAACGTAGTCGTCACAGCCCACGCCTTTGTAATAATCTTCTTCATAGTTATACCAATCATAATTGGAGGATTTGGAAACTGACTAGTTCCTCTAATAATTGGAGCCCCAGACATAGCGTTCCCACGAATAAATAACATAAGCTTTTGACTACTCCCCCCATCTTTCCTTCTCCTCCTAGCATCTTCTACCGTCGAAGCAGGTGTCGGCACAGGCTGAACAGTATACCCCCCACTAGCAGGCAATCTAGCCCATGCTGGAGCCTCAGTCGACCTTGCAATTTTCTCCCTACACCTAGCCGGTATCTCCTCAATCCTAGGAGCTATCAACTTCATTACAACAGCAATCAATATAAAACCCCCTGCCCTTTCACAATACCAAACCCCCTTATTCGTATGATCAGTCCTAATCACTGCAGTCCTCCTACTCCTATCCCTTCCAGTCCTCGCTGCAGGAATCACAATACTCCTTACAGACCGCAACCTTAACACCACATTCTTCGACCCTGCCGGAGGAGGGGACCCCGTCCTATACCAACACCTGTTCTGATTCTTCGGACACCCAGAAGTCTACATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Zonotrichia albicollis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 26
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

White-throated Sparrows are protected under the U.S. Migratory Bird Act.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

White-throated Sparrows are protected under the U.S. Migratory Bird Act.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

White-throated sparrows do not adversely affect humans, except perhaps by eating seeds and grain.

  • Robbins, C., B. Bruun, H. Zim. 1996. Birds of North America. New York, NY: Western Publishing Company, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

White-throated sparrows are beneficial to humans because they consume numerous insects that they find in trees, bushes, or shrubs. Eating certain insects that might cause harm to such trees, bushes or shrubs, protects the plants that people cultivate.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Although the white-throated sparrow does not have direct affects on humans for competition for food or habitat, Zonotrichia albicollis may affect humans by consumption of seeds that might otherwise produce plants that are useful to humans.

  • Robbins, C., B. Bruun, H. Zim. 1996. Birds of North America. New York, NY: Western Publishing Company, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Zonotrichia albicollis are beneficial to humans because they consume numerous insects that they find in trees, bushes, or shrubs. Eating certain insects that might cause harm to such trees, bushes or shrubs, protects the plants from disease, which indeed benefits humans and aids in the production of more plants.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-throated Sparrow

The White-throated Sparrow (Zonotrichia albicollis) is a passerine bird of the American sparrow family Emberizidae.

Contents

Description

Birds of the white-striped form have tan only at the lores

The White-throated Sparrow is a passerine bird of the American sparrow family Emberizidae. The White-throated Sparrow measures 15 to 19 cm (5.9 to 7.5 in) in length with a wingspan of 23 cm (9 inches). Typical weight is 22 to 32 g (0.78 to 1.1 oz), with an average of 26 g (0.91 oz).[2][3] Among standard measurements, the wing chord is 6.3 to 7.9 cm (2.5 to 3.1 in), the tail is 6.8 to 7.7 cm (2.7 to 3.0 in), the bill is 1 to 1.2 cm (0.39 to 0.47 in) and the tarsus is 2.2 to 2.4 cm (0.87 to 0.94 in).[4]

There are two adult plumage variations known as the tan-striped and white-striped forms. On the white-striped form the crown is black with a white central stripe. The supercilium is white as well. The auriculars are gray with the upper edge forming a black eye line.[2]

On the tan form, the crown is dark brown with a tan central stripe. The supercilium is tan as well. The auriculars are gray/light brown with the upper edge forming a brown eye line. Both variations feature dark eyes, a white throat, yellow lores and gray bill.[2] There is variation and some individuals may show dark lateral stripes of each side of the throat.

They almost always pair with the opposite color morph for breeding. The two color morphs occur in approximately equal numbers. Both male and female white-striped birds are more aggressive than tan-striped birds during the breeding season.

The breast has gray/tan streaks and the streaks continue down the flanks but the belly is generally light gray. The wings are rufous with two distinct white wing bars. Sexes are morphologically similar.[2]

Behavior

Reproduction

White-throated Sparrows breed in central Canada and New England. They nest either on the ground under shrubs or low in trees in deciduous or mixed forest areas and lay 3-5 brown-marked blue or green-white eggs.

Wintering and Migration

In winter, it migrates to the southern and eastern USA. It stays year round in the atlantic provinces of Canada. This bird is a rare vagrant to western Europe.

Diet

These birds forage on the ground under or near thickets or in low vegetation. They mainly eat seeds, insects and berries, and are attracted to bird feeders.

Song and calls

Song of the White-throated Sparrow

There are at least two distinct songs sung by this species. One consists of an initial note, followed by three or so repeated notes at an interval of about a major third above. The second song consists of an initial note, a second a whole step lower, and a third note, repeated 2-3 times, about a minor third below that. This second song is commonly described by use of mnemonics with the cadence of "Po-or Sam Peabody, Peabody, Peabody" (or "O-oh sweet Canada, Canada, Canada") The rhythm is very regular, and the timbre could be described as pinched. These musical intervals are only approximate; to a human ear the song often sounds out of tune. The repeated note will often change in pitch very slightly, contributing to this effect.

The White-throated Sparrow also has at least two calls, in addition to its song.

Footnotes

  1. ^ BirdLife International (2012). "Zonotrichia albicollis". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c d Sibley, David A. (2000). National Audubon Society The Sibley Field Guide to Birds. New York: Alfred A. Knopf. p. 494. ISBN 0-679-45122-6. 
  3. ^ [1]
  4. ^ Sparrows and Buntings: A Guide to the Sparrows and Buntings of North America and the World by Clive Byers & Urban Olsson. Houghton Mifflin (1995). ISBN 978-0395738733.

References

  • Byers, Clive; Olsson, Urban & Curson, Jon (1995): Sparrows and Buntings: A Guide to the Sparrows and Buntings of North America and the World. Houghton Mifflin, Boston. ISBN 0-395-73873-3
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Mitochondrial DNA data indicate that relative to most congeneric avian comparisons, the five species of Zonotrichia are closely related (Zink et al. 1991). ZONOTRICHIA PENSYLVANICA (e.g., Oberholser 1974) is an invalid name for this species (Banks and Browning 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!