Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDING: western and central Alaska across Canada and south to northern California, eastern Oregon, Idaho, Utah, eastern Arizona, northern New Mexico, Colorado, southwestern South Dakota, northern Minnesota, northern Wisconsin, northern Michigan, northern New York, and northern New England. NON-BREEDING: mainly through breeding range (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Breeding range: The Gray Jay is found from tree line in northern Canada and Alaska south through boreal and subalpine forests to northern California on the west coast, Arizona and New Mexico in the Rocky Mountains, northern Wisconsin in the midwest, and New York in the east.

Winter range: The non-breeding range is essentially the same as the breeding range, as the Gray Jay does not migrate except for (in late fall and winter) occasional altitudinal movements in the Rockies and rare latitudinal movements elsewhere, probably due to food shortages.

Perisoreus_canadensis has never been recorded outside of North America.

(Sibley 2000, Strickland 1993, Ehrlich 1988)

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The gray jay is a native resident from northern Alaska east to Newfoundland and Labrador and south to northern California, Idaho, Utah, east-central Arizona, north-central New Mexico, central Colorado, and southwestern South Dakota. It is also a native resident in northern Minnesota, northern Wisconsin, northern Michigan, northern New York, and northern New England. The gray jay may wander north of the breeding range. In winter it travels irregularly to northwestern Nebraska, central Minnesota, southeastern Wisconsin, central Michigan, southern Pennsylvania, central New York, Connecticut, and Massachusetts [3,4,113].

Perisoreus canadensis albescens is a resident from northeastern British Columbia and northwestern Alberta southeastward, east of the Rocky Mountains to South Dakota (Black Hills). It< is casual in northwestern Nebraska [3].

Perisoreus c. arcus is a resident in the Rainbow Mountains area, and headwaters of the Dean and Bella Coola Rivers of the central Coast Ranges, British Columbia [3].

Perisoreus c. barbouri is a resident on Anticosti Island, Quebec [3].

Perisoreus c. bicolor is a resident in southeastern British Columbia, southwestern Alberta, eastern Washington, northeastern Oregon, northern and central Idaho, and western Montana [3].

Perisoreus c. canadensis breeds from northern British Columbia east to Prince Edward Island, and south to northern Minnesota, northern Wisconsin, northern Michigan, northeastern New York, northern Vermont, northern New Hampshire, and Maine. It winters at lower altitudes within the breeding range and south to southern Ontario and Massachusetts, casually to central Minnesota, southeastern Wisconsin, northwestern Pennsylvania, and central New York. Perisoreus c. canadensis is accidental in northeastern Pennsylvania (Philadelphia) [3].

Perisoreus c. capitalis is a resident in the southern Rocky Mountains from eastern Idaho, central south-central Montana, and western and southern Wyoming south through eastern Utah, and western and central Colorado, to central eastern Arizona and north-central New Mexico [3].

Perisoreus c. griseus is a resident from southwestern British Columbia and Vancouver Island south through central Washington and central Oregon to the mountains of north-central and northeastern California [3].

Perisoreus c. nigracapillus is a resident in northern Quebec (Fort Chimo, Whale River, and George River), throughout Labrador, and in southeastern Quebec (Mingan and Blanc Sablon) [3].

Perisoreus c. obscurus is a resident in the coastal belt from Washington (Crescent Lake, Seattle, and Columbia River) through western Oregon to northwestern California (Humboldt County) [3].

Perisoreus c. pacificus is a resident in north-central Alaska (Kobuk River, Endicott Mountains, and Fort Yukon), northern Yukon (Arctic Circle at the International Boundary), and northwestern Mackenzie (Mackenzie Delta and lower Horton River) south in Alaska to latitude 60° N [3].

Perisoreus c. sanfordi is a resident in Newfoundland and Nova Scotia [3].

  • 3. American Ornithologists' Union. 1957. Checklist of North American birds. 5th ed. Baltimore, MD: The Lord Baltimore Press, Inc. 691 p. [21235]
  • 113. Strickland, Dan; Ouellet, Henri. 1993. Gray jay. In: Poole, A.; Stettenheim, P.; Gill, F., eds. Birds of North America, No. 40. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [63063]
  • 4. American Ornithologists' Union. 2007. The A.O.U. check-list of North American birds, 7th edition, [Online]. American Ornithologists' Union (Producer). Available: http://www.aou.org/checklist/index.php3. [50863]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

States or Provinces

(key to state/province abbreviations)
UNITED STATES
AL AK AZ CA CO ID ME MI MN MT
NE NH NM NY ND OR SD UT VT WA
WI WY

CANADA
AB BC MB NB NF NT NS NU ON PE
PQ SK YK

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

BLM PHYSIOGRAPHIC REGIONS [17]:

1 Northern Pacific Border

2 Cascade Mountains

4 Sierra Mountains

5 Columbia Plateau

6 Upper Basin and Range

7 Lower Basin and Range

8 Northern Rocky Mountains

9 Middle Rocky Mountains

10 Wyoming Basin

11 Southern Rocky Mountains

12 Colorado Plateau

15 Black Hills Uplift
  • 17. Bernard, Stephen R.; Brown, Kenneth F. 1977. Distribution of mammals, reptiles, and amphibians by BLM physiographic regions and A.W. Kuchler's associations for the eleven western states. Tech. Note 301. Denver, CO: U.S. Department of the Interior, Bureau of Land Management. 169 p. [434]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Breeding range: The Gray Jay is found from tree line in northern Canada and Alaska south through boreal and subalpine forests to northern California on the west coast, Arizona and New Mexico in the Rocky Mountains, northern Wisconsin in the midwest, and New York in the east.

Winter range: The non-breeding range is essentially the same as the breeding range, as the Gray Jay does not migrate except for (in late fall and winter) occasional altitudinal movements in the Rockies and rare latitudinal movements elsewhere, probably due to food shortages.

Perisoreus canadensis has never been recorded outside of North America.

(Sibley 2000, Strickland 1993, Ehrlich 1988)

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Often described as resembling an oversized chickadee, Perisoreus canadensis is a fluffy, pale-gray, long-tailed, short-billed, crestless jay. Gray Jays, while sexually monomorphic, do show strong regional variation, with three distinguishable populations: Pacific, Rocky Mountain, and Taiga. All adult variations have black eyes, bills, legs, and feet and white auriculars (ear patches) and throats. Pacific birds show extensive dark on the head and brownish-tinged backs. Rocky Mountain birds south of Canada have a whiter head. Taiga birds resemble Pacific birds, but are grayer above and have a grayer (rather than whitish) belly. Juveniles from all populations are sooty overall and gray-billed with white malar stripes.

Perisoreus_canadensis is 11.5 inches (29 cm) long and has a wingspan of 18 inches (45 cm). Normal adult weight is 2.5 ounces (70 grams).

Gray Jays have a clear, pleasant whistle of wheeeooo or wheee-ah. Calls also include a low, husky chuf-chuf-weef and a very rough, dry kreh kreh kreh kreh alarm call. Like Blue Jays, Perisoreus canadensis sometimes sound a screeching jaaay. Gray Jays are known to mimic sounds.

(Sibley 2000, Peterson 1990)

Average mass: 70.3 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Often described as resembling an oversized chickadee, P. canadensis is a fluffy, pale-gray, long-tailed, short-billed, crestless jay. Gray Jays, while sexually monomorphic, do show strong regional variation, with three distinguishable populations: Pacific, Rocky Mountain, and Taiga. All adult variations have black eyes, bills, legs, and feet and white auriculars (ear patches) and throats. Pacific birds show extensive dark on the head and brownish-tinged backs. Rocky Mountain birds south of Canada have a whiter head. Taiga birds resemble Pacific birds, but are grayer above and have a grayer (rather than whitish) belly. Juveniles from all populations are sooty overall and gray-billed with white malar stripes.

Perisoreus canadensis is 11.5 inches (29 cm) long and has a wingspan of 18 inches (45 cm). Normal adult weight is 2.5 ounces (70 grams).

Gray Jays have a clear, pleasant whistle of wheeeooo or wheee-ah. Calls also include a low, husky chuf-chuf-weef and a very rough, dry kreh kreh kreh kreh alarm call. Like Blue Jays, P. canadensis sometimes sound a screeching jaaay. Gray Jays are known to mimic sounds.

(Sibley 2000, Peterson 1990)

Average mass: 70.3 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 29 cm

Weight: 71 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Coniferous and mixed coniferous-deciduous forest (primarily spruce), including open and partly open woodland and around bogs (AOU 1983). Often around campgrounds. BREEDING: Usually nests in a conifer, 1-9 m (usually 2-3 m) above ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gray Jays are associated with coniferous and coniferous-deciduous forests of the boreal and sub-alpine vegetative regions. They are most commonly found in spruce and fir woods (with occasional aspens or birch). Despite its association with humans, this jay does not live in towns or developments. It is exclusively a bird of remote forests. In fact, Gray Jays disappear as soon as a camp becomes a permanent settlement.

(Strickland 1993, Madge 1994, Goodwin 1986)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, density, forbs, selection, succession, tree

Conifers, particularly spruce (Picea spp.), are the preferred cover for the gray jay. The territory size for a pair of gray jays in Algonquin Provincial Park and La Verendrye Provincial Park was 0.25 square mile [97].

Stand age: Although gray jays prefer mature coniferous forests [56,73,87,97,106,113,120], they can be found occupying all forest age classes [121,124].

Mature forest: During winter months, gray jays preferred late-seral (325 to >500 years old) Douglas-fir (Pseudotsuga menziesii) stands in the southern Gifford Pinchot National Forest, Washington [56].

Gray jays surveyed in young (40-70 years old), mature (100-196 years), and old-growth (204-450 years) Douglas-fir/hardwood stands in northwestern California and southwestern Oregon reached peak abundance in the old-growth stands [87].

Gray jays were most abundant in mature stands and least abundant in young stands of a quaking aspen (Populus tremuloides) mixed-wood forest in Alberta. The 3 age classes studied were: young (20-30 years old); mature (50-65 years old); and old stands (120+ years old) [99].

Of 5 seral stages studied in a forest dominated by Douglas-fir, western hemlock (Tsuga heterophylla), and red alder (Alnus rubra) in the Oregon Coast Ranges, gray jays were significantly (P<0.05) positively associated with late-seral forest structure and were most abundant in large saw timber plots (>20% cover, >21 inch (>53.2 cm) mean DBH) [73].

All age classes: Habitat generalists including the gray jay were common in all 3 age classes (40-59 years, 60-79 years, and 80+ years) of mature balsam fir forest in Newfoundland [121].

In ponderosa pine (Pinus ponderosa) habitat in the Black Hills, South Dakota, gray jays utilized the sapling-pole, mature, and old-growth stages, but their habitat preference changed between the summer breeding season and winter [75,96]. During summer, optimal habitat included mature and old-growth ponderosa pine [75]. During winter, gray jays preferred mature and sapling-pole ponderosa pine stands [96].

As habitat generalists, gray jays may not be susceptible to changes in forest age distribution in jack pine (Pinus banksiana) forests near the White River in north-central Ontario. Jack pine stands were even-aged and ranged from 3 to 100 years old. Gray jays were most abundant on 18- to 20- year-old stands, but were not confined to that age class [124].

During the winter gray jay populations were greatest in the youngest stands (14 years old) compared to 30-year-old and 60-year-old stands in a mixed-age quaking aspen forest at Medicine Lake, Alberta [132].

Stand composition/structure: Most of the research on gray jays has compared various silvicultural strategies or analyzed succession after harvesting. Gray jays exhibit a range of responses to habitat fragmentation. They can be positively [51,62] or negatively affected [36,37] and, in most cases, show mixed or no response [10,25,44,46,84].

Positively affected by fragmentation: The mean number of bird species was measured in old-growth, fragmented old-growth and selectively harvested western redcedar (Thuja plicata)-western hemlock forests on the Priest Lake Ranger District of the Idaho Panhandle National Forest. Gray jay populations were greatest in the fragmented old-growth forest, characterized as an older-aged forest with 1- to 8-year-old clearcuts embedded [51]:

Mean number (s x ) of gray jays along 24 counting points in each area
Old growth Fragmented old growth Selectively harvested P
0.06 (0.03) 0.14 (0.09) 0.03 (0.02) 0.04

The mean abundance of gray jay was greater on clearcut stands than unfragmented stands in a forest dominated by Engelmann spruce (Picea engelmannii) and subalpine fir (Abies lasiocarpa) in the Medicine Bow National Forest, Wyoming, but the differences were not statistically significant [62].

Negatively affected by fragmentation: Birds such as the gray jay, which forage in the foliage of trees, may decline following logging due to the reduction of total biomass foliage rather than decreased foliage height diversity or loss of tree volume. A decline in insect prey may also occur following logging [36,37].

Mixed responses to habitat fragmentation: During the winter in Oregon, gray jay abundance did not differ between commercially thinned and unthinned Douglas-fir stands in the Tillamook State Forest and the central Coast Ranges. Four thinned and four unthinned stands that were 40 to 55 years old and 161 to 1,260 acres (65-510 ha) in size were chosen in each of 2 locations. During the summer gray jays were more abundant (P<0.01) in unthinned versus thinned stands in the Tillamook State Forest; however, they were more abundant (P=0.10) in thinned versus unthinned stands in the central Oregon Coast Ranges. The abundance of gray jays varied positively with red alder cover and negatively with pole layer height.

Bird populations were compared in 6 lodgepole pine (Pinus contorta) communities in the Uinta Mountains of Utah. The 6 communities were mature forest; stagnated forest composed of dense lodgepole pine stands; a 1940 clearcut that left no residual trees; a stagnated stand that was bulldozed and then broadcast burned; wet meadows along streams; and dry meadows with a dense mixture of grasses and forbs under widely scattered lodgepole pine. Gray jays were present in most of the communities and appeared to be uninfluenced by logging [10]:

Density of gray jays (individuals/100 acres (40 ha))
Mature forest Stagnated forest 1940 clearcut forest Bulldozed & burned forest Wet meadow Dry meadow
6 <1 <1 4 ---- 7

Breeding bird responses to 3 silvicultural alternatives were examined in a Douglas-fir forest on the McDonald-Dunn Forest, Oregon. The 3 treatments were: (1) small-patch group selection, in which ⅓rd of the wood volume was removed, representing low-severity disturbance; (2) 2-story treatment, in which ¾ths of the wood volume was removed, representing a moderate to high-severity disturbance; (3) modified clearcut treatment, in which 1.2 green trees/ha were retained, representing a high-severity disturbance; and (4) unharvested control for each treatment. One replicate was harvested each year for 3 years. The mean abundance of gray jays was highest in small-patch group selection cuts for each of the 3 years [25]:

Mean abundance of gray jays (no. of observations/5 ha (s x))
  Year 1 Year 2 Year 3
Control 0.3 (0.3) 1.3 (1.3) 1.0 (0.6)
Small-patch 1.8 (0.5) 1.6 (0.6) 1.1 (0.4)
2-story 1.7 (1.2) 0.5 (0.3) 0.2 (0.2)
Modified clearcut 1.5 (0.6) 0.0 (0.0) 0.2 (0.2)

Harrison and others [46] studied the effects of partial cutting on songbirds in mixed-wood forests near Peace River in northwestern Alberta. Dominant trees included quaking aspen, balsam poplar, and lodgepole pine. The mean abundance change for gray jay was not statistically significant.

Six seral stages within a sub-boreal spruce forest dominated by quaking aspen in valley bottoms and lowlands were surveyed to examine diversity of bird communities near Smithers, British Columbia. The seral stages were clearcut; shrub/herb; pole/sapling (<15 years); young quaking aspen (15- 49 years); mature quaking aspen (50+ years); and mature quaking aspen mixed with Engelmann spruce and lodgepole pine. Gray jays were present in the mixed quaking aspen stage and seen foraging in clearcuts, but were probably not nesting in the clearcut due to lack of suitable habitat [84].

  • 10. Austin, Dennis D.; Perry, Michael L. 1979. Birds in six communities within a lodgepole pine forest. Journal of Forestry. 77: 584-586. [15622]
  • 25. Chambers, Carol L., McComb, William C.; Tappeiner, John C., II. 1999. Breeding bird responses to three silvicultural treatments in the Oregon Coast Range. Ecological Applications. 9(1): 171-185. [61083]
  • 36. Franzreb, Kathleen E. 1977. Bird population changes after timber harvesting of a mixed conifer forest in Arizona. Res. Pap. RM-184. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 26 p. [19331]
  • 37. Franzreb, Kathleen E.; Ohmart, Robert D. 1978. The effects of timber harvesting on breeding birds in a mixed-coniferous forest. The Condor. 80(4): 431-441. [61097]
  • 44. Hagar, Joan C.; McComb, William C.; Emmingham, William H. 1996. Bird communities in commercially thinned and unthinned Douglas-fir stands of western Oregon. Wildlife Society Bulletin. 24(2): 353-366. [63088]
  • 46. Harrison, R. Bruce; Schmiegelow, Fiona K. A.; Naidoo, Robin. 2005. Stand-level response of breeding forest songbirds to multiple levels of partial-cut harvest in four boreal forest types. Canadian Journal of Forest Research. 35: 1553-1567. [61564]
  • 51. Hejl, Sallie J.; Paige, Christine. 1994. A preliminary assessment of birds in continuous and fragmented forests of western redcedar/western hemlock in northern Idaho. In: Baumgartner, David M.; Lotan, James E.; Tonn, Jonalea R., compilers. Interior cedar-hemlock-white pine forests: ecology and management: Symposium proceedings; 1993 March 2-4; Spokane, WA. Pullman, WA: Washington State University, Department of Natural Resources: 189-197. [25802]
  • 56. Huff, Mark H.; Manuwal, David A.; Putera, Judy A. 1991. Winter bird communities in the southern Washington Cascade Range. In: Ruggiero, Leonard F.; Aubry, Keith B.; Carey, Andrew B.; Huff, Mark H., technical coordinators. Wildlife and vegetation of unmanaged Douglas-fir forests. Gen. Tech. Rep. PNW-GTR-285. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 207-218. [17314]
  • 62. Keller, Mary E.; Anderson, Stanley H. 1992. Avian use of habitat configurations created by forest cutting in southeastern Wyoming. The Condor. 94(1): 55-65. [63241]
  • 73. McGarigal, Kevin; McComb, William C. 1995. Relationships between landscape structure and breeding birds in the Oregon Coast Range. Ecological Monographs. 65(3): 235-260. [61142]
  • 75. Mills, Todd R.; Rumble, Mark A.; Flake, Lester D. 2000. Habitat of birds in ponderosa pine and aspen/birch forest in the Black Hills, South Dakota. Journal of Field Ornithology. 71(2): 187-206. [61151]
  • 84. Pojar, Rosamund A. 1995. Breeding bird communities in aspen forests of the sub-boreal spruce (dk subzone) in the Prince Rupert Forest Region. Land Management Handbook No. 33. Victoria, BC: Province of British Columbia, Ministry of Forests Research Program. 59 p. [61159]
  • 87. Ralph, C. John; Paton, Peter W. C.; Taylor, Cathy A. 1991. Habitat association patterns of breeding birds and small mammals in Douglas-fir/hardwood stands in northwestern California and southwestern Oregon. In: Ruggiero, Leonard F.; Aubry, Keith B.; Carey, Andrew B.; Huff, Mark H., technical coordinators. Wildlife and vegetation of unmanaged Douglas-fir forests. Gen. Tech. Rep. PNW-GTR-285. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 379-393. [17329]
  • 96. Rumble, Mark A.; Mills, Todd R.; Flake, Lester D. 1999. Habitat capability model for birds wintering in the Black Hills, South Dakota. Res. Pap. RMRS-RP-19. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 11 p. [36409]
  • 97. Rutter, Russell J. 1969. A contribution to the biology of the gray jay (Perisoreus canadensis). Canadian Field-Naturalist,. 83(4): 300-316. [63081]
  • 99. Schieck, Jim; Nietfeld, Marie. 1995. Bird species richness and abundance in relation to stand age and structure in aspen mixedwood forests in Alberta. In: Stelfox, J. B., ed. Relationships between stand age, stand structure, and biodiversity in aspen mixedwood forests in Alberta. Vegreville, AB: Alberta Environmental Centre: 115-157. [60893]
  • 113. Strickland, Dan; Ouellet, Henri. 1993. Gray jay. In: Poole, A.; Stettenheim, P.; Gill, F., eds. Birds of North America, No. 40. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [63063]
  • 120. Theberge, John B. 1976. Bird populations in the Kluane Mountains, southwest Yukon, with special reference to vegetation and fire. Canadian Journal of Zoology. 54(8): 1346-1356. [41684]
  • 121. Thompson, Ian D.; Hogan, Holly A.; Montevicchi, William A. 1999. Avian communities of mature balsam fir forests in Newfoundland: age-dependence and implications for timber harvesting. The Condor. 101(2): 311-323. [63240]
  • 124. Venier, Lisa A.; Pearce, Jennie L. 2005. Boreal bird community response to jack pine forest succession. Forest Ecology and Management. 217(1): 19-36. [60326]
  • 132. Westworth, D. A.; Telfer, E. S. 1993. Summer and winter bird populations associated with five age-classes of aspen forest in Alberta. Canadian Journal of Forest Research. 23: 1830-1836. [22888]
  • 106. Silovsky, Gene D.; Pinto, Carlos. [n.d.]. Forest wildlife inventories: identification of conflicts and management needs. In: Wildlife and forest management in the Pacific Northwest: 53-61. [35399]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: density, hardwood, shrub

Gray jays are habitat generalists [62,73,75,96,99,102,120,121,124,132] but prefer mature coniferous habitats [56,87,97,106,113,120] and mixed conifer-deciduous forests with spruce (Picea spp.) typically present [113].

Pure hardwood stands are used for foraging but are not part of the defended territory [97].

Theberge [120] examined the density of gray jays in various vegetation communities in Kluane National Park, Yukon. Gray jays were most abundant in the mature white spruce community but were present in 7 distinctly different vegetation communities, indicating a lack of habitat specialization [120]:

Vegetation community Upland willow (Salix spp.) shrub Lowland willow shrub White spruce-balsam poplar (Populus balsamifera ssp. balsamifera) Mature white spruce Riparian balsam poplar Balsam poplar parkland Subalpine
Density of males per 40 ha 10.0 6.7 6.0 16.8 10.0 12.5 1.7
  • 56. Huff, Mark H.; Manuwal, David A.; Putera, Judy A. 1991. Winter bird communities in the southern Washington Cascade Range. In: Ruggiero, Leonard F.; Aubry, Keith B.; Carey, Andrew B.; Huff, Mark H., technical coordinators. Wildlife and vegetation of unmanaged Douglas-fir forests. Gen. Tech. Rep. PNW-GTR-285. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 207-218. [17314]
  • 62. Keller, Mary E.; Anderson, Stanley H. 1992. Avian use of habitat configurations created by forest cutting in southeastern Wyoming. The Condor. 94(1): 55-65. [63241]
  • 73. McGarigal, Kevin; McComb, William C. 1995. Relationships between landscape structure and breeding birds in the Oregon Coast Range. Ecological Monographs. 65(3): 235-260. [61142]
  • 75. Mills, Todd R.; Rumble, Mark A.; Flake, Lester D. 2000. Habitat of birds in ponderosa pine and aspen/birch forest in the Black Hills, South Dakota. Journal of Field Ornithology. 71(2): 187-206. [61151]
  • 87. Ralph, C. John; Paton, Peter W. C.; Taylor, Cathy A. 1991. Habitat association patterns of breeding birds and small mammals in Douglas-fir/hardwood stands in northwestern California and southwestern Oregon. In: Ruggiero, Leonard F.; Aubry, Keith B.; Carey, Andrew B.; Huff, Mark H., technical coordinators. Wildlife and vegetation of unmanaged Douglas-fir forests. Gen. Tech. Rep. PNW-GTR-285. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 379-393. [17329]
  • 96. Rumble, Mark A.; Mills, Todd R.; Flake, Lester D. 1999. Habitat capability model for birds wintering in the Black Hills, South Dakota. Res. Pap. RMRS-RP-19. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 11 p. [36409]
  • 97. Rutter, Russell J. 1969. A contribution to the biology of the gray jay (Perisoreus canadensis). Canadian Field-Naturalist,. 83(4): 300-316. [63081]
  • 99. Schieck, Jim; Nietfeld, Marie. 1995. Bird species richness and abundance in relation to stand age and structure in aspen mixedwood forests in Alberta. In: Stelfox, J. B., ed. Relationships between stand age, stand structure, and biodiversity in aspen mixedwood forests in Alberta. Vegreville, AB: Alberta Environmental Centre: 115-157. [60893]
  • 102. Shepperd, Wayne D.; Battaglia, Michael A. 2002. Ecology, silviculture, and management of Black Hills ponderosa pine. Gen. Tech. Rep. RMRS-GTR-97. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 112 p. [44794]
  • 113. Strickland, Dan; Ouellet, Henri. 1993. Gray jay. In: Poole, A.; Stettenheim, P.; Gill, F., eds. Birds of North America, No. 40. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [63063]
  • 120. Theberge, John B. 1976. Bird populations in the Kluane Mountains, southwest Yukon, with special reference to vegetation and fire. Canadian Journal of Zoology. 54(8): 1346-1356. [41684]
  • 121. Thompson, Ian D.; Hogan, Holly A.; Montevicchi, William A. 1999. Avian communities of mature balsam fir forests in Newfoundland: age-dependence and implications for timber harvesting. The Condor. 101(2): 311-323. [63240]
  • 124. Venier, Lisa A.; Pearce, Jennie L. 2005. Boreal bird community response to jack pine forest succession. Forest Ecology and Management. 217(1): 19-36. [60326]
  • 132. Westworth, D. A.; Telfer, E. S. 1993. Summer and winter bird populations associated with five age-classes of aspen forest in Alberta. Canadian Journal of Forest Research. 23: 1830-1836. [22888]
  • 106. Silovsky, Gene D.; Pinto, Carlos. [n.d.]. Forest wildlife inventories: identification of conflicts and management needs. In: Wildlife and forest management in the Pacific Northwest: 53-61. [35399]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the term: cover

SAF COVER TYPES [32]:

1 Jack pine

5 Balsam fir

12 Black spruce

13 Black spruce-tamarack

15 Red pine

16 Aspen

18 Paper birch

21 Eastern white pine

22 White pine-hemlock

24 Hemlock-yellow birch

33 Red spruce-balsam fir

38 Tamarack

107 White spruce

201 White spruce

202 White spruce-paper birch

203 Balsam poplar

204 Black spruce

205 Mountain hemlock

206 Engelmann spruce-subalpine fir

208 Whitebark pine

210 Interior Douglas-fir

212 Western larch

217 Aspen

218 Lodgepole pine

219 Limber pine

224 Western hemlock

225 Western hemlock-Sitka spruce

227 Western redcedar-western hemlock

228 Western redcedar

229 Pacific Douglas-fir

230 Douglas-fir-western hemlock

232 Redwood

237 Interior ponderosa pine

239 Pinyon-juniper

243 Sierra Nevada mixed conifer

244 Pacific ponderosa pine-Douglas-fir

245 Pacific ponderosa pine

251 White spruce-aspen

252 Paper birch

253 Black spruce-white spruce

254 Black spruce-paper birch

256 California mixed subalpine
  • 32. Eyre, F. H., ed. 1980. Forest cover types of the United States and Canada. Washington, DC: Society of American Foresters. 148 p. [905]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: bog

KUCHLER [65] PLANT ASSOCIATIONS:

K001 Spruce-cedar-hemlock forest

K002 Cedar-hemlock-Douglas-fir forest

K003 Silver fir-Douglas-fir forest

K004 Fir-hemlock forest

K005 Mixed conifer forest

K006 Redwood forest

K008 Lodgepole pine-subalpine forest

K011 Western ponderosa forest

K012 Douglas-fir forest

K013 Cedar-hemlock-pine forest

K014 Grand fir-Douglas-fir forest

K015 Western spruce-fir forest

K016 Eastern ponderosa forest

K017 Black Hills pine forest

K018 Pine-Douglas-fir forest

K020 Spruce-fir-Douglas-fir forest

K021 Southwestern spruce-fir forest

K023 Juniper-pinyon woodland

K093 Great Lakes spruce-fir forest

K094 Conifer bog

K095 Great Lakes pine forest

K096 Northeastern spruce-fir forest

K106 Northern hardwoods

K107 Northern hardwoods-fir forest

K108 Northern hardwoods-spruce forest
  • 65. Kuchler, A. W. 1964. United States [Potential natural vegetation of the conterminous United States]. Special Publication No. 36. New York: American Geographical Society. 1:3,168,000; colored. [3455]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

ECOSYSTEMS [39]:

FRES10 White-red-jack pine

FRES11 Spruce-fir

FRES19 Aspen-birch

FRES20 Douglas-fir

FRES21 Ponderosa pine

FRES22 Western white pine

FRES23 Fir-spruce

FRES24 Hemlock-Sitka spruce

FRES25 Larch

FRES26 Lodgepole pine

FRES27 Redwood

FRES35 Pinyon-juniper
  • 39. Garrison, George A.; Bjugstad, Ardell J.; Duncan, Don A.; Lewis, Mont E.; Smith, Dixie R. 1977. Vegetation and environmental features of forest and range ecosystems. Agric. Handb. 475. Washington, DC: U.S. Department of Agriculture, Forest Service. 68 p. [998]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gray Jays are associated with coniferous and coniferous-deciduous forests of the boreal and sub-alpine vegetative regions. They are most commonly found in spruce and fir woods (with occasional aspens or birch). Despite its association with humans, this jay does not live in towns or developments. It is exclusively a bird of remote forests. In fact, Gray Jays disappear as soon as a camp becomes a permanent settlement.

(Strickland 1993, Madge 1994, Goodwin 1986)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Omnivorous. Feeds on insects, berries, lichen, mice, carrion, scraps from campsites. Probably eats birds' eggs. Stores hundreds of food items per day during summer; apparently relies heavily on that food in winter; food is cached (scatter-hoarded) in arboreal sites such as under a flake of bark, in a clump of lichen, or in a conifer needle-cluster (Condor 94:995-998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Gray Jays are omnivorous, commonly eating arthropods, berries, carrion, eggs, nestling birds, and fungi. Gray Jays use a variety of foraging techniques including flycatching, foliage gleaning, ground gleaning, and even aerial pursuit of rodents. Nestlings are fed partially digested food.

One of the most interesting traits of the Gray Jay is its food storage ability. This Jay has unusually large salivary glands that produce copious sticky saliva. They use this saliva to impregnate and encase food, creating a bolus that will adhere to trees. Away from ground scavengers and protected from the wind and snow, these caches allow efficient food hoarding. Gray Jays have been observed making over 1,000 caches in a single 17-hour day. This behavior may be the major adaptation enabling Perisoreus_canadensis to occupy the hostile boreal regions during the winter. Fittingly, the genus Perisoreus means "hoarder."

(Dow 1965, Ehrlich 1988, Strickland 1993, Terres 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the terms: density, lichen, natural, presence, selection, tree

Gray jays are omnivorous [76,97,98,113]. Foods eaten include arthropods [113], small mammals [68], nestling birds [21,22,116,123] (see Predation), carrion [97,113], fungi [113], fruits such as chokecherry (Prunus virginiana) [97], and seeds [97]. Two gray jays were seen eating slime mold (Fuligo septica) near Kennedy Hot Springs in the Glacier Peak Wilderness, Washington. This was the 1st report of any bird consuming slime mold in the field [117].

Occasionally, gray jays eat live prey. Lescher and Lescher [68] witnessed a gray jay kill an unidentified, live small rodent in Wisconsin. Barnard [12] was the 1st to witness an in-flight gray jay capture of a magnolia warbler (Dendroica magnolia) for consumption.

Gray jays have been seen landing on moose (Alces alces) to remove and eat engorged winter deer ticks (Dermacentor albipictus) during April and May in Algonquin Provincial Park. Researchers also found a gray jay nest containing a brooding female, 3 hatchlings, and 3 warm, engorged winter deer ticks. Because the winter deer ticks were too large for the hatchlings to eat, it was hypothesized that the ticks may have served as "hot water bottles", keeping hatchlings warm when parents were away from the nest [1].

Gray jays are suspected but not proven to prey on nests of the threatened marbled murrelet (Brachyramphus marmoratus) in coastal areas of the Pacific Northwest [88].

Foraging behavior: Gray jays do not hammer food with their bill as do other jays, but wrench, twist, and tug food apart. Gray jays commonly carry large food items to nearby trees to eat or process for storage, possibly as defense against large scavengers [113]. They are "scatterhoarders", caching food items among scattered sites for later consumption [69,71,128].

Any food intended for storage is manipulated in the mouth and formed into a bolus (rounded mass) that is coated with sticky saliva, adhering to anything it touches. The bolus is stored in bark crevices, under tufts of lichen, or among conifer needles [97].

Risk and energy expenditure are factors in food selection for gray jays. Gray jays select food on the basis of profitability to maximize caloric intake. Increased handling, searching, or recognition times for a preferred food item lowers its profitability [71].

The gray jay takes advantage of man-made sources of food, hence the names "camp robber" and "whiskey Jack". According to Maccarone and Montevecchi [71], human observers do not inhibit gray jay's feeding behavior; however, Rutter [97] claims that "once having identified man with food it does not forget". He found that after a nesting female was accustomed to being fed by humans she could be enticed to leave the nest during incubation and brooding [97].

Predation: Gray jays commonly prey on nestling birds [22,29,88,123]. Nests are located visually by moving from perch to perch and scanning surroundings [113]. Gray jay predation on nestling birds is temporally homogenous throughout the passerine breeding season [105]. Avian nest predation by gray jays is not necessarily higher in fragmented versus unfragmented forest [21,29,116,123].

Boulet and others [21] examined bird nest predation in a commercially fragmented boreal black spruce forest intermixed with jack pine, balsam fir, quaking aspen, and paper birch near Lake Saint-Jean, Quebec. Gray jays directed their attacks on artificial arboreal nests more often than artificial ground nests. Depredation of nests was positively related to the presence of the lake and jack pine. Gray jays may have preferred preying on avian nests in jack pine versus black spruce habitat because jack pine forests were more open, and trees did not conceal nests as well. Gray jays may have favored foraging along lakeshores and moist patches due to the high density of insects. No relationship was found between the fragmented forest and predation [21].

The potential for egg predation by gray jays was greater in riparian forest strips than in clearcuts in a second-growth boreal balsam fir forest in Montmorency Forest, Quebec [29].

Stuart-Smith and Hayes [116] examined the influence of residual tree density on predation of artificial and natural songbird nests. The study took place in the White River and Lussier River Watershed, southeastern British Columbia, in a forest dominated by Douglas-fir, white spruce, and western larch. Twenty-four plots of similar age were chosen (16 logged, 8 burned by wildfire); they varied in residual tree density between 0 and 180 trees/ha. Residual trees apparently did not increase predation on nesting songbirds by the gray jay. However, a moderate increase in nest predation occurred in logged plots adjacent to or surrounded by mature conifer forest, which is the preferred habitat for gray jays [56,87,97,106,113,120]. Retaining residual trees would outweigh the possible increased risk of nest predation, except in areas where nesting birds are at very low numbers and potential risk by gray jays is high [116].

When predation rates on bird nests by the gray jay were compared in clearcut, green-tree retention stands, and mature western hemlock stands in the west-central Oregon Cascade Ranges, predation rates were highest in green-tree retention stands. This may have been due to increased availability of perch sites for avian predators such as the gray jay [123].

Caching: Gray jays cache thousands of food items every day during the summer for use the following winter [112,126,127,129]. Caching behavior is thought to have evolved for several reasons. It allows for permanent residence in boreal and subalpine forests [113], ensures a food source in areas with high elevations and cyclic availability of food resources, and favors the retention of young and a kin-selected social organization [92]. In southern portions of the gray jay's range, food is not cached during summer because of the chance of spoilage and the reduced need for winter stores [113]. Cached items can be anything from carrion to bread crumbs and are formed into a bolus before being cached [97]. Cached food is sometimes used to feed nestlings and fledglings [97].

Caching is inhibited by the presence of Steller's jays [23] and gray jays from adjacent territories [126,127], which follow resident gray jays to steal cached food [23]. Gray jays carry large food items to distant cache sites for storage more often than small food items. To prevent theft, they also tend to carry valuable food items further from the source when caching in the company of 1 or more gray jays [127]. Scatterhoarding discourages pilferage by competitors. Cache thievery increases with increased cache density [126].

When exploiting distant food sources found in clearings, gray jays temporarily concentrated their caches in an arboreal site along the edge of a black spruce forest in interior Alaska. This allowed a high rate of caching in the short term and reduced the jay's risk of predation. A subsequent recaching stage occurred, and food items were transferred to widely scattered sites to reduce theft [128].

  • 1. Addison, E. M.; Strickland, R. D.; Fraser, D. J. H. 1989. Gray jays, Perisoreus canadensis, and common ravens, Corvus corax, as predators of winter ticks, Dermacentor albipictus. The Canadian Field-Naturalist. 103(3): 406-408. [63068]
  • 12. Barnard, William H. 1996. Juvenile gray jay preys upon magnolia warbler. Journal of Field Ornithology. 67(2): 252-253. [63042]
  • 21. Boulet, Marylene; Darveau, Marcel; Belanger, Louis. 2000. A landscape perspective of bird nest predation in a managed boreal black spruce forest. Ecoscience. 7(3): 281-289. [63015]
  • 22. Boulet, Marylene; Darveau, Marcel; Belanger, Louis. 2003. Nest predation and breeding activity of songbirds in riparian and nonriparian black spruce strips of central Quebec. Canadian Journal of Forest Research. 33: 922-930. [44619]
  • 23. Burnell, Kristi L.; Tomback, Diane F. 1985. Steller's jays steal gray jay caches: field and laboratory observation. Auk. 102(2): 417-419. [63075]
  • 29. Darveau, Marcel; Belanger, Louis; Huot, Jean; Melancon, Eric; DeBellefeuille, Sonia. 1997. Forestry practices and the risk of bird nest predation in a boreal coniferous forest. Ecological Monographs. 7(2): 572-580. [63246]
  • 56. Huff, Mark H.; Manuwal, David A.; Putera, Judy A. 1991. Winter bird communities in the southern Washington Cascade Range. In: Ruggiero, Leonard F.; Aubry, Keith B.; Carey, Andrew B.; Huff, Mark H., technical coordinators. Wildlife and vegetation of unmanaged Douglas-fir forests. Gen. Tech. Rep. PNW-GTR-285. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 207-218. [17314]
  • 68. Lesher, Fred; Lesher, Jolene. 1984. Gray jay takes live mammal. The Loon. 56(1): 72-73. [63076]
  • 69. Ligon, J. David. 1978. Reproductive interdependence of pinyon jay and pinyon pines. Ecological Monographs. 48: 111-126. [1455]
  • 71. Maccarone, Alan D.; Montevecchi, W. A. 1986. Factors affecting food choice by gray jays. Bird Behavior. 6(2): 90-92. [63074]
  • 76. Morissette, J. L.; Cobb, T. P.; Brigham, R. M.; James, P. C. 2002. The response of boreal forest songbird communities to fire and post-fire harvesting. Canadian Journal of Forest Research. 32: 2169-2183. [43889]
  • 87. Ralph, C. John; Paton, Peter W. C.; Taylor, Cathy A. 1991. Habitat association patterns of breeding birds and small mammals in Douglas-fir/hardwood stands in northwestern California and southwestern Oregon. In: Ruggiero, Leonard F.; Aubry, Keith B.; Carey, Andrew B.; Huff, Mark H., technical coordinators. Wildlife and vegetation of unmanaged Douglas-fir forests. Gen. Tech. Rep. PNW-GTR-285. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 379-393. [17329]
  • 88. Raphael, Martin G.; Mack, Diane Evans; Marzluff, John M.; Luginbuhl, John M. 2002. Effects of forest fragmentation on populations of the marbled murrelet. Studies in Avian Biology. 25: 221-235. [50455]
  • 92. Roberts, Robert Chadwick. 1976. Ecological relationships in the acorn woodpecker (Melanerpes formicivorus), with reference to habitat characteristics, foraging strategies, and the evolution of food-storing behavior. Davis, CA: University of California. 100 p. Dissertation. [54898]
  • 97. Rutter, Russell J. 1969. A contribution to the biology of the gray jay (Perisoreus canadensis). Canadian Field-Naturalist,. 83(4): 300-316. [63081]
  • 98. Saab, Victoria A.; Powell, Hugh D. W. 2005. Fire and avian ecology in North America: process influencing pattern. In: Saab, Victoria A.; Powell, Hugh D. W., eds. Fire and avian ecology in North America. Studies in Avian Biology No. 30. Ephrata, PA: Cooper Ornithological Society: 1-13. [61678]
  • 105. Sieving, Kathryn E.; Willson, Mary F. 1998. Nest predation and avian species diversity in northwestern forest understory. Ecology. 79(7): 2391-2402. [63248]
  • 112. Strickland, Dan. 1991. Juvenile dispersal in gray jays: dominant brood member expels siblings from natal territory. Canadian Journal of Zoology. 69(12): 2935-2945. [63089]
  • 113. Strickland, Dan; Ouellet, Henri. 1993. Gray jay. In: Poole, A.; Stettenheim, P.; Gill, F., eds. Birds of North America, No. 40. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [63063]
  • 116. Stuart-Smith, A. Kari; Hayes, John P. 2003. Influence of residual tree density on predation of artificial and natural songbird nests. Forest Ecology and Management. 183: 159-176. [46106]
  • 117. Sutherland, John B.; Crawford, Ronald L. 1979. Gray jay feeding on slime mold. The Murrelet. 60(1): 28. [63077]
  • 120. Theberge, John B. 1976. Bird populations in the Kluane Mountains, southwest Yukon, with special reference to vegetation and fire. Canadian Journal of Zoology. 54(8): 1346-1356. [41684]
  • 123. Vega, Robyn M. S. 1993. Bird communities in managed conifer stands in the Oregon Cascades: habitat associations and nest predation. Corvallis, OR: Oregon State University. 83 p. Thesis. [27972]
  • 126. Waite, Thomas A. 1988. A field test of density-dependent survival of simulated gray jay caches. The Condor. 90(1): 247-249. [63070]
  • 127. Waite, Thomas A. 1992. Social hoarding and a load size-distance relationship in gray jays. The Condor. 94(4): 995-998. [63247]
  • 128. Waite, Thomas A.; Reeve, John D. 1997. Multistage scatter-hoarding decisions in the gray jay (Perisoreus canadensis). Bird Behavior. 12(1/2): 7-14. [63036]
  • 129. Waite, Thomas A.; Strickland, Dan. 1997. Cooperative breeding in gray jays: philopatric offspring provision juvenile siblings. The Condor. 99(2): 523-525. [63249]
  • 106. Silovsky, Gene D.; Pinto, Carlos. [n.d.]. Forest wildlife inventories: identification of conflicts and management needs. In: Wildlife and forest management in the Pacific Northwest: 53-61. [35399]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Gray Jays are omnivorous, commonly eating arthropods, berries, carrion, eggs, nestling birds, and fungi. Gray Jays use a variety of foraging techniques including flycatching, foliage gleaning, ground gleaning, and even aerial pursuit of rodents. Nestlings are fed partially digested food.

One of the most interesting traits of the Gray Jay is its food storage ability. This Jay has unusually large salivary glands that produce copious sticky saliva. They use this saliva to impregnate and encase food, creating a bolus that will adhere to trees. Away from ground scavengers and protected from the wind and snow, these caches allow efficient food hoarding. Gray Jays have been observed making over 1,000 caches in a single 17-hour day. This behavior may be the major adaptation enabling Perisoreus canadensis to occupy the hostile boreal regions during the winter. Fittingly, the genus Perisoreus means "hoarder."

(Dow 1965, Ehrlich 1988, Strickland 1993, Terres 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predators

Gray jays warn each other of predators by whistling alarm notes, screaming, chattering, or imitating, and/or mobbing predators [113].

Gray jays are consumed by several bird species including great gray owls (Strix nebulosa) [78], northern hawk-owls (Surnia ulula) [93], and Mexican spotted owls (Strix occidentalis lucida) [122,131].

Gray jay remains were found in the nest sites of fisher (Martes pennanti) [85] and American marten (Martes americana) [52]. Red squirrel (Tamiasciurus hudsonicus) eat gray jay eggs [97].

  • 52. Henry, Stephen E.; Raphael, Martin G.; Ruggiero, Leonard F. 1990. Food caching and handling by marten. The Great Basin Naturalist. 50(4): 381-383. [14376]
  • 78. Osborne, Timothy O. 1987. Biology of the great gray owl in interior Alaska. In: Nero, Robert W.; Clark, Richard J.; Knapton, Richard J.; Hamre, R. H., eds. Biology and conservation of northern forest owls: Symposium proceedings; 1987 February 3-7; Winnipeg, MB. Gen. Tech. Rep. RM-142. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 91-95. [17929]
  • 93. Rohner, Christoph; Smith, James N. M.; Stroman, Johan; Joyce, Miranda; Doyle, Frank I.; Boonstra, Rudy. 1995. Northern hawk-owls in the nearctic boreal forest: prey selection and population consequences of multiple prey cycles. The Condor. 97(1): 208-220. [63232]
  • 97. Rutter, Russell J. 1969. A contribution to the biology of the gray jay (Perisoreus canadensis). Canadian Field-Naturalist,. 83(4): 300-316. [63081]
  • 113. Strickland, Dan; Ouellet, Henri. 1993. Gray jay. In: Poole, A.; Stettenheim, P.; Gill, F., eds. Birds of North America, No. 40. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [63063]
  • 122. U.S. Department of the Interior, Fish and Wildlife Service. 1995. Recovery plan for the Mexican spotted owl: Vols. 1-2. Albuquerque, NM: U. S. Department of the Interior, Fish and Wildlife Service. 370 p. [27998]
  • 131. Ward, James P., Jr.; Block, William M. 1995. Mexican spotted owl prey ecology. In: Block, William M.; Clemente, Fernando; Cully, Jack F.; Dick, James L., Jr.; Franklin, Alan B.; Ganey, Joseph L.; Howe, Frank P.; Moir, W. H.; Spangle, Steven L.; Rinkevich, Sarah E.; Urban, Dean L.; Vahle, Robert; Ward, James P., Jr.; White, Gary C. Recovery plan for the Mexican spotted owl (Strix occidentalis lucida). Vol. 2. Albuquerque, NM: U.S. Department of the Interior, Fish and Wildlife Service: 1-48. [60368]
  • 85. Powell, Roger A.; Zielinski, William J. 1994. Fisher. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; [and others]. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 38-73. [29932]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Occupies, permanent, all-purpose territory. Usually seen in small family groups or in pairs. Gray Jays have home ranges of about 65-130 hectares in Ontario (Rutter 1969).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: cover, crown fire, density, frequency, indicator value, ladder fuels, natural, prescribed fire, severity, shrub, stand-replacing fire, succession, tree, underburn, wildfire

Modifications in the food supply and habitat of gray jays may occur following fire, as well as changes in the abundance of competitors and predators [95]. According to Finch and others [33], the effects of fire on birds and their habitat vary with: 1) the severity and extent of the fire; 2) temporal scales; 3) life history characteristics of the bird species; and 4) whether or not salvage logging occurs following fire. Severe fires alter the forest structure more than low-severity fires, and a stand-replacing fire may result in the successional replacement of a bird species with a different bird species. Large, severe fires may greatly alter bird habitat in the short term but may be necessary for long-term maintenance of some forest types [58]. Fire may be beneficial to cavity-nesting, timber-drilling, grain-collecting, and fly-catching birds due to increased nesting habitat and food supplies [18,19,24,45,50,58,111,119]. Salvage logging may reduce the benefits of fire to birds that utilize snags for cavity nesting and foraging [58].

A meta-analysis of studies of bird responses to fire showed that gray jays and other bird species that share the same nest type, nest layer, and foraging guild do not show a distinct positive or negative response to fire. The analysis is shown below; the table does not distinguish between fire types (wildland, prescribed, stand-replacing, understory, various severities), vegetation types, or time since fire [98]:

Response to fire (% of studies)
  n positive negative none mixed
Nest type: Open-cup nest 544 29 23 39 9
Nest layer: Canopy nest 423 31 18 42 9
Foraging guild: Omnivore 296 32 21 37 9

Gray jays are usually present in postfire habitats after fires of varying severities but experience lower abundance in burned than unburned areas. Results of studies examining gray jay responses to wildfire, prescribed burning, logging versus burning, and salvage logging follow.

Wildfire: Changes in bird abundance and species composition following mixed-severity wildfires were studied in low-elevation ponderosa pine/Douglas-fir habitat and mid-elevation mixed-conifer and lodgepole pine habitats in the Bitterroot National Forest in west-central Montana. In July and August 2000, dry lightning storms ignited fires of 99 to 135,900 acres (40-55,000 ha) in size; the fires ranged from low-severity to severe. Transects had been established in 1994 and 1995 before the wildfires occurred, and 1 year following the fires, burned and unburned transects of differing fire severities were compared. The mean relative abundance (number of gray jays detected within 100 m/point × 100 ± standard error) for gray jays was lowest following fire [109,110]:

Mean relative abundance ± s x

 

Before fire

After fire

Unburned points (n=120) 9.8 ± 2.2 8.1 ± 2.1
Burned points (n=122) 12.4 ± 2.7 4.2 ± 1.5

Gray jays were ubiquitous in various successional portions of lodgepole pine and Engelmann spruce-subalpine fir forests following wildfires in Grand Teton and Yellowstone National Parks, Wyoming; however, they were most abundant in severely burned areas 43 and 44 years following fire, which is typically when the canopy closes following severe wildfire. Ten areas were sampled in both Parks ranging from 1 to 304 years after fire and 40 to several hundred acres in size. In Grand Teton National Park, unburned, moderately burned, and severely burned areas were examined. In moderately burned areas, 40% or more of the tree understory was alive 1 year following the fire, and part of the grass-forb-shrub understory was unburned. In severely burned areas, all aboveground vegetation was killed by a severe crown fire. In Yellowstone National Park, all sampling areas were severely burned in 1667 and 1956 [119].

Gray jay densities were highest in unburned versus burned lodgepole pine and Engelmann spruce-subalpine fir forests in Yellowstone National Park, Wyoming. In 1974, the Trail Creek Wildfire burned 581 acres (235 ha) of 250-year-old lodgepole pine forest with an understory of Engelmann spruce and subalpine fir. In 1976, the Divide Wildfire burned 1,601 acres (648 ha) of 350+ year-old Engelmann spruce-subalpine fir forest. Fire severities were not documented. Avian communities were surveyed in 1978 and 1979 [83].

Gray jays preferred the ecotone and unburned areas of subalpine lodgepole pine forest 8 years following a high-severity wildfire on the Roosevelt National Forest, Colorado. The fire burned approximately 470 acres (190 ha), killing or top-killing virtually all aboveground vegetation. The total number of gray jays recorded on 6-point counts on three 49 acre (20 ha) plots is shown below [94]:

Total number of gray jays (and no. of territories)/ plot

Burned Ecotone Unburned
0 10 (2) 5 (1)

A literature review reported that gray jays were more abundant on unburned sites than on 23 severely burned conifer forests in the western United States [63].

Canopy cover did not predict distribution of canopy foragers such as the gray jay between burned and unburned lodgepole pine forests in Grand Teton National Park. Two-year postfire and six-year postfire sites were compared with unburned sites. Details about the size and severity of the fires were not given. Gray jays utilized the 2-year burns, 6-year burns, and unburned sites most during the postbreeding season. The mean frequency of observations during the breeding and postbreeding season of the gray jay is shown below [108]:

Mean frequency of observations × 100 (frequency of observations)

Treatment

Postfire year 2

Postfire year 6 unburned
Breeding season 4 (3) 5 (3) 2 (1)
Postbreeding season 36 (17) 13 (5) 28 (8)

Prescribed burning: Bock and Bock [20] studied the effects of prescribed fire on birds in ponderosa pine forests in the southern Black Hills, South Dakota. One area was burned in October 1979, covering 156 acres (63 ha). Another study area was burned in April and May 1980, burning 806 acres (326 ha). Both burns were low-severity in local isolated spots. Point counts were conducted in June 1980 and June 1981 on burned and unburned plots. Gray jay abundance was greatest on unburned plots for both years [20]:

Mean no. of breeding birds
Year Burned Unburned
1980 0 0.7
1981 0.1 0.7

Logging versus wildfire: Clearcutting and stand-replacing fire both lead to early-successional forest; however, they do not provide the same habitat conditions [53]. Clearcuts and wildfires are distinct from each other for several reasons: 1) logging causes greater site disturbance due to road construction and logging equipment; 2) logging removes stems from a site; 3) wildfire leaves live residual stands, burned trees, and downed woody debris; 4) wildfire size, frequency, and distribution are different from cutblocks; and 5) wildfire is not predictable and does not target the most valuable trees [58]. Nevertheless, research comparing gray jays on logged and burned sites does not show any clear pattern of preferences.

Bird communities were compared between burned and harvested sites in a quaking aspen-dominated boreal mixed-wood forest in north-central Alberta. Three replicate stands were chosen from each class (1,14, and 28 postdisturbance years) and treatment (wildfire vs. harvest). More than 95% of the canopy trees were dead on burned sites. An average of 6% of preharvest trees remained on the harvested sites. Gray jay density was greater within 14-year-old postfire stands than in postharvest stands. Gray jays may have been responding to differences in the herb and shrub strata between postfire and postharvest stands [53]:

Density of gray jays (mean number of individuals (± s x)/25acres)
Postdisturbance year 1 14 28
Postfire 0.7 ± 0.7 4.3 ± 2.0 1.3 ± 0.3
Postharvest 1.7 ± 0.9 0.0 ± 0.0 0.0 ± 0.0

Avian response to forest management practices was examined in mature ponderosa pine forests mixed with Douglas-fir or grand fir (Abies grandis) in Montana. Three site categories were chosen: 1) control sites containing either ladder fuels or encroachment by small- or medium- diameter trees; 2) treated sites that had been logged, underburned, or a combination of the 2 to reduce fuels and create open structural conditions; and 3) sites with a natural underburn in 2000. Gray jays were present in all 3 sites but most abundant in the control [133].

In northwestern Lac Saint Jean, Quebec, gray jays showed no significant (P>0.05) difference in abundance in postfire and postlogging stages in stands formerly dominated by black spruce [59].

Avian abundance was compared in wildfire and clearcut areas in a former black spruce forest near Goose Bay, Newfoundland after 5,14, and 27 years of succession. Details about the size and severity of the burn were not documented. Gray jay was not a common species in the study area but may have slightly preferred clearcut plots over burned plots [107].

Schulte and Niemi [100] surveyed bird communities in early-successional forests following logging and fire near Tower, Minnesota. Logged sites had been clearcut and contained residual trees and residual patches of trees. Wildfire sites were dominated by quaking aspen, and 5,189 acres (2,100 ha) of forest had burned. Logged sites were chosen to match the time of disturbance, predisturbance type, and soils of the burned sites. According to the vegetation analysis, habitat heterogeneity was greater in burned areas. The gray jay was 1 of 5 bird species highly associated with snags in this study; snags were probably utilized for foraging. Gray jay abundance did not differ significantly between logged and burned sites [100]:

Gray jay abundance (territorial males/ha)

Mean

s x P value
Logged 0.02 0.02 0.12
Burned 0.10 0.06

Salvage logging: Resident species such as the gray jay were less likely to be detected in salvaged areas of a burned mixed-wood forest (dominant trees were white spruce and quaking aspen), a jack pine forest, and a quaking aspen forest near Meadow Lake, Saskatchewan than in logged areas. In 1995, a wildfire burned 98,840 acres (40,000 ha), killing a majority of the trees in the burned areas. Salvage logging took place in 1997. In 1998, surveys were conducted in unburned, burned, and salvaged forests. The indicator value of gray jay for each treatment in the 3 habitat types is shown below [76]:

Habitat type Indicator value (% )
Unburned Burned Salvaged P
Mixed-wood 36 41 24 0.999
Jack pine 34 22 1 0.106
Quaking aspen 0 17 not salvaged 0.468

The following table provides fire return intervals for plant communities and ecosystems where the gray jay is important. For further information, see the FEIS review of the dominant species listed below.

Community or Ecosystem Dominant Species Fire Return Interval Range (years)
silver fir-Douglas-fir Abies amabilis-Pseudotsuga menziesii var. menziesii >200
grand fir Abies grandis 35-200 [6]
tamarack Larix laricina 35-200 [81]
western larch Larix occidentalis 25-350 [7,14,30]
Great Lakes spruce-fir Picea-Abies spp. 35 to >200
northeastern spruce-fir Picea-Abies spp. 35-200 [31]
Engelmann spruce-subalpine fir Picea engelmannii-Abies lasiocarpa 35 to >200 [6]
black spruce Picea mariana 35-200
conifer bog* Picea mariana-Larix laricina 35-200 [31]
pinyon-juniper Pinus-Juniperus spp. <35 [81]
whitebark pine* Pinus albicaulis 50-200 [2,5]
jack pine Pinus banksiana <35 to 200 [28,31]
Rocky Mountain lodgepole pine* Pinus contorta var. latifolia 25-340 [13,14,118]
Colorado pinyon Pinus edulis 10-400+ [35,40,61,81]
Sierra lodgepole pine* Pinus contorta var. murrayana 35-200
Pacific ponderosa pine* Pinus ponderosa var. ponderosa 1-47 [6]
interior ponderosa pine* Pinus ponderosa var. scopulorum 2-30 [6,11,66]
red pine (Great Lakes region) Pinus resinosa 3-18 (x=3-10) [27,38]
red-white pine* (Great Lakes region) Pinus resinosa-P. strobus 3-200 [28,48,70]
eastern white pine Pinus strobus 35-200
eastern white pine-eastern hemlock Pinus strobus-Tsuga canadensis 35-200 [125]
aspen-birch Populus tremuloides-Betula papyrifera 35-200 [31,125]
quaking aspen (west of the Great Plains) Populus tremuloides 7-120 [6,41,74]
Rocky Mountain Douglas-fir* Pseudotsuga menziesii var. glauca 25-100 [6,8,9]
coastal Douglas-fir* Pseudotsuga menziesii var. menziesii 40-240 [6,77,90]
redwood Sequoia sempervirens 5-200 [6,34,115]
western redcedar-western hemlock Thuja plicata-Tsuga heterophylla >200
western hemlock-Sitka spruce Tsuga heterophylla-Picea sitchensis >200 [6]
*fire return interval varies widely; trends in variation are noted in the species review
  • 53. Hobson, Keith A.; Schieck, Jim. 1999. Changes in bird communities in boreal mixedwood forest: harvest and wildfire effects over 30 years. Ecological Applications. 9(3): 849-863. [36010]
  • 76. Morissette, J. L.; Cobb, T. P.; Brigham, R. M.; James, P. C. 2002. The response of boreal forest songbird communities to fire and post-fire harvesting. Canadian Journal of Forest Research. 32: 2169-2183. [43889]
  • 98. Saab, Victoria A.; Powell, Hugh D. W. 2005. Fire and avian ecology in North America: process influencing pattern. In: Saab, Victoria A.; Powell, Hugh D. W., eds. Fire and avian ecology in North America. Studies in Avian Biology No. 30. Ephrata, PA: Cooper Ornithological Society: 1-13. [61678]
  • 108. Skinner, N. G. 1989. Seasonal avifauna use of burned and unburned lodgepole pine forest ecotones. Missoula, MT: University of Montana. 84 p. Thesis. [60435]
  • 8. Arno, Stephen F.; Gruell, George E. 1983. Fire history at the forest-grassland ecotone in southwestern Montana. Journal of Range Management. 36(3): 332-336. [342]
  • 9. Arno, Stephen F.; Scott, Joe H.; Hartwell, Michael G. 1995. Age-class structure of old growth ponderosa pine/Douglas-fir stands and its relationship to fire history. Res. Pap. INT-RP-481. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station. 25 p. [25928]
  • 6. Arno, Stephen F. 2000. Fire in western forest ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 97-120. [36984]
  • 31. Duchesne, Luc C.; Hawkes, Brad C. 2000. Fire in northern ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 35-51. [36982]
  • 11. Baisan, Christopher H.; Swetnam, Thomas W. 1990. Fire history on a desert mountain range: Rincon Mountain Wilderness, Arizona, U.S.A. Canadian Journal of Forest Research. 20: 1559-1569. [14986]
  • 5. Arno, Stephen F. 1976. The historical role of fire on the Bitterroot National Forest. Res. Pap. INT-187. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station. 29 p. [15225]
  • 34. Finney, Mark A.; Martin, Robert E. 1989. Fire history in a Sequoia sempervirens forest at Salt Point State Park, California. Canadian Journal of Forest Research. 19: 1451-1457. [9845]
  • 2. Agee, James K. 1994. Fire and weather disturbances in terrestrial ecosystems of the eastern Cascades. Gen. Tech. Rep. PNW-GTR-320. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 52 p. (Everett, Richard L., assessment team leader; Eastside forest ecosystem health assessment; Hessburg, Paul F., science team leader and tech. ed., Volume III: assessment). [23656]
  • 74. Meinecke, E. P. 1929. Quaking aspen: A study in applied forest pathology. Tech. Bull. No. 155. Washington, DC: U.S. Department of Agriculture. 34 p. [26669]
  • 7. Arno, Stephen F.; Fischer, William C. 1995. Larix occidentalis--fire ecology and fire management. In: Schmidt, Wyman C.; McDonald, Kathy J., compilers. Ecology and management of Larix forests: a look ahead: Proceedings of an international symposium; 1992 October 5-9; Whitefish, MT. Gen. Tech. Rep. GTR-INT-319. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 130-135. [25293]
  • 18. Blackford, John L. 1955. Woodpecker concentration in burned forest. The Condor. 57: 28-30. [193]
  • 19. Bock, Carl E.; Lynch, James F. 1970. Breeding bird populations of burned and unburned conifer forest in the Sierra Nevada. The Condor. 72: 182-189. [5113]
  • 20. Bock, Jane H.; Bock, Carl E. 1981. Some effects of fire on vegetation and wildlife in ponderosa pine forests of the southern Black Hills. Final Report: Contracts CX-1200-9-B034, CX-1200-0-B018, CX-1200-1-B022. Grant No. RM-80-105 GR. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 58 p. [479]
  • 24. Caton, Elaine L. 1996. Effects of fire and salvage logging on the cavity-nesting bird community in northwestern Montana. Missoula, MT: The University of Montana. 115 p. Dissertation. [28661]
  • 27. Clark, James S. 1990. Fire and climate change during the last 750 yr in northwestern Minnesota. Ecological Monographs. 60(2): 135-159. [11650]
  • 30. Davis, Kathleen M. 1980. Fire history of a western larch/Douglas-fir forest type in northwestern Montana. In: Stokes, Marvin A.; Dieterich, John H., tech. coords. Proceedings of the fire history workshop; 1980 October 20-24; Tucson, AZ. Gen. Tech. Rep. RM-81. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 69-74. [12813]
  • 33. Finch, Deborah M.; Ganey, Joseph L.; Yong, Wang; Kimball, Rebecca T.; Sallabanks, Rex. 1997. Effects and interactions of fire, logging, and grazing. In: Block, William M.; Finch, Deborah M., tech. eds. Songbird ecology in southwestern ponderosa pine forests: a literature review. Gen. Tech. Rep. RM-GTR-292. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 103-136. [27990]
  • 35. Floyd, M. Lisa; Romme, William H.; Hanna, David D. 2000. Fire history and vegetation pattern in Mesa Verde National Park, Colorado, USA. Ecological Applications. 10(6): 1666-1680. [37590]
  • 38. Frissell, Sidney S., Jr. 1968. A fire chronology for Itasca State Park, Minnesota. Minnesota Forestry Research Notes No. 196. St. Paul, MN: University of Minnesota. 2 p. [34527]
  • 40. Gottfried, Gerald J.; Swetnam, Thomas W.; Allen, Craig D.; Betancourt, Julio L.; Chung-MacCoubrey, Alice L. 1995. Pinyon-juniper woodlands. In: Finch, Deborah M.; Tainter, Joseph A., eds. Ecology, diversity, and sustainability of the Middle Rio Grande Basin. Gen. Tech. Rep. RM-GTR-268. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 95-132. [26188]
  • 41. Gruell, G. E.; Loope, L. L. 1974. Relationships among aspen, fire, and ungulate browsing in Jackson Hole, Wyoming. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 33 p. In cooperation with: U.S. Department of the Interior, National Park Service, Rocky Mountain Region. [3862]
  • 45. Harris, Mary A. 1982. Habitat use among woodpeckers in forest burns. Missoula, MT: University of Montana. 63 p. Thesis. [23400]
  • 48. Heinselman, Miron L. 1970. The natural role of fire in northern conifer forests. In: The role of fire in the Intermountain West: Symposium proceedings; 1970 October 27-29; Missoula, MT. Missoula, MT: Intermountain Fire Research Council: 30-41. In cooperation with: University of Montana, School of Forestry. [15735]
  • 50. Hejl, Sallie J. 1994. Human-induced changes in bird populations in coniferous forests in western North America during the past 100 years. Studies in Avian Biology. 15: 232-246. [24205]
  • 58. Hutto, Richard L. 1995. Composition of bird communities following stand-replacement fires in northern Rocky Mountain (U.S.A.) conifer forests. Conservation Biology. 9(5): 1041-1058. [26003]
  • 59. Imbeau, Louis; Savard, Jean-Pierre L.; Gagnon, Rejean. 1999. Comparing bird assemblages in successional black spruce stands originating from fire and logging. Canadian Journal of Zoology. 77: 1850-1860. [38812]
  • 63. Kotliar, Natasha B.; Hejl, Sallie J.; Hutto, Richard L.; Saab, Victoria A.; Melcher, P.; McFadzen, Mary E. 2002. Effects of fire and post-fire salvage logging on avian communities in conifer-dominated forests of the western United States. In: George, T. Luke; Dobkin, David S., eds. Effects of habitat fragmentation on birds in western landscapes: contrasts with paradigms from the eastern United States. Studies in Avian Biology No. 25. Camarillo, CA: Cooper Ornithological Society: 49-64. [50440]
  • 66. Laven, R. D.; Omi, P. N.; Wyant, J. G.; Pinkerton, A. S. 1980. Interpretation of fire scar data from a ponderosa pine ecosystem in the central Rocky Mountains, Colorado. In: Stokes, Marvin A.; Dieterich, John H., tech. coords. Proceedings of the fire history workshop; 1980 October 20-24; Tucson, AZ. Gen. Tech. Rep. RM-81. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 46-49. [7183]
  • 70. Loope, Walter L. 1991. Interrelationships of fire history, land use history, and landscape pattern within Pictured Rocks National Seashore, Michigan. The Canadian Field-Naturalist. 105(1): 18-28. [5950]
  • 77. Morrison, Peter H.; Swanson, Frederick J. 1990. Fire history and pattern in a Cascade Range landscape. Gen. Tech. Rep. PNW-GTR-254. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 77 p. [13074]
  • 81. Paysen, Timothy E.; Ansley, R. James; Brown, James K.; Gottfried, Gerald J.; Haase, Sally M.; Harrington, Michael G.; Narog, Marcia G.; Sackett, Stephen S.; Wilson, Ruth C. 2000. Fire in western shrubland, woodland, and grassland ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-volume 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 121-159. [36978]
  • 83. Pfister, Allan Robert. 1980. Postfire avian ecology in Yellowstone National Park. Pullman, WA: Washington State University. 35 p. Thesis. [61009]
  • 90. Ripple, William J. 1994. Historic spatial patterns of old forests in western Oregon. Journal of Forestry. 92(11): 45-49. [33881]
  • 94. Roppe, Jerry A.; Hein, Dale. 1978. Effects of fire on wildlife in a lodgepole pine forest. The Southwestern Naturalist. 23(2): 279-287. [261]
  • 95. Rotenberry, John T.; Cooper, Robert J. ; Wunderle, Joseph M.; Smith, Kimberly G. 1995. When and how are population limited? The roles of insect outbreaks, fire, and other natural perturbations. In: Martin, Thomas E.; Finch, Deborah M., eds. Ecology and management of neotropical migratory birds: A synthesis and review of critical issues. New York: Oxford University Press, Inc: 55-84. [26445]
  • 100. Schulte, Lisa A.; Niemi, Gerald J. 1998. Bird communities of early-successional burned and logged forest. Journal of Wildlife Management. 62(4): 1418-1429. [36413]
  • 107. Simon, N. P. P.; Schwab, F. E.; Otto, R. D. 2002. Songbird abundance in clear-cut and burned stands: a comparison of natural disturbance and forest management. Canadian Journal of Forest Research. 32: 1343-1350. [42554]
  • 109. Smucker, Kristina M. 2003. Changes in bird abundance and species composition in a coniferous forest following mixed-severity wildfire. Missoula, MT: University of Montana. 52 p. Thesis. [60612]
  • 110. Smucker, Kristina M.; Hutto, Richard L.; Steele, Brian M. 2005. Changes in bird abundance after wildfire: importance of fire severity and time since fire. Ecological Applications. 15(5): 1535-1549. [60366]
  • 111. Stoddard, Herbert L., Sr. 1963. Bird habitat and fire. In: Proceedings, 2nd annual Tall Timbers fire ecology conference; 1963 March 14-15; Tallahassee, FL. Tallahassee, FL: Tall Timbers Research Station: 163-175. [18997]
  • 115. Stuart, John D. 1987. Fire history of an old-growth forest of Sequoia sempervirens (Taxodiaceae) forest in Humboldt Redwoods State Park, California. Madrono. 34(2): 128-141. [7277]
  • 118. Tande, Gerald F. 1979. Fire history and vegetation pattern of coniferous forests in Jasper National Park, Alberta. Canadian Journal of Botany. 57: 1912-1931. [18676]
  • 119. Taylor, Dale L.; Barmore, William J., Jr. 1980. Post-fire succession of avifauna in coniferous forests of Yellowstone and Grand Teton National Parks, Wyoming. In: DeGraaf, Richard M., technical coordinator. Workshop proceedings: Management of western forests and grasslands for nongame birds; 1980 February 11-14; Salt Lake City, UT. Gen. Tech. Rep. INT-86. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station: 130-145. [17902]
  • 125. Wade, Dale D.; Brock, Brent L.; Brose, Patrick H.; Grace, James B.; Hoch, Greg A.; Patterson, William A., III. 2000. Fire in eastern ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 53-96. [36983]
  • 133. Young, Jock S.; Hoffland, John R.; Hutto, Richard L. 2005. Monitoring for adaptive management in coniferous forests of the northern Rockies. In: Ralph, C. John; Rich, Terrell D., eds. Bird conservation implementation and integration in the Americas: proceedings of the 3rd international Partners in Flight conference. Vol. 1; 2002 March 20-24; Asilomar, CA. Gen. Tech. Rep. PSW-GTR-191. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 405-411. [63726]
  • 13. Barrett, Stephen W. 1993. FIRE REGIMES on the Clearwater and Nez Perce National Forests north-central Idaho. Final Report: Order No. 43-0276-3-0112. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 21 p. [41883]
  • 14. Barrett, Stephen W.; Arno, Stephen F.; Key, Carl H. 1991. FIRE REGIMES of western larch - lodgepole pine forests in Glacier National Park, Montana. Canadian Journal of Forest Research. 21: 1711-1720. [17290]
  • 28. Cleland, David T.; Crow, Thomas R.; Saunders, Sari C.; Dickmann, Donald I.; Maclean, Ann L.; Jordan, James K.; Watson, Richard L.; Sloan, Alyssa M.; Brosofske, Kimberley D. 2004. Characterizing historical and modern FIRE REGIMES in Michigan (USA): a landscape ecosystem approach. Landscape Ecology. 19: 311-325. [54326]
  • 61. Keeley, Jon E. 1981. Reproductive cycles and FIRE REGIMES. In: Mooney, H. A.; Bonnicksen, T. M.; Christensen, N. L.; Lotan, J. E.; Reiners, W. A., tech. coords. FIRE REGIMES and ecosystem properties: Proceedings of the conference; 1978 December 11-15; Honolulu, HI. Gen. Tech. Rep. WO-26. Washington, DC: U.S. Department of Agriculture, Forest Service: 231-277. [4395]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: altricial, cooperative breeding, frequency, lichens, phase, tree

Mating: Gray jays typically breed at 2 years of age. Pairs are monogamous and remain together for their lifetime, but a male or female will find another mate following the disappearance or death of their partner [113]. Gray jay pairs breed during March and April, depending on latitude [97,112,113], in permanent, all-purpose territories [53,76,97,112,113]. Second broods are not attempted, perhaps allowing greater time for food storage (see Caching) [97,113].

Gray jays cooperatively breed [112,114,129]. Strickland [112] studied cooperative breeding of gray jays in Algonquin Provincial Park, Ontario, and La Verendrye Provincial Park, Quebec. In early June, when broods were 55 to 65 days old, the young fought amongst themselves until dominant juveniles forced their siblings to leave the natal area. Dominant juveniles, known as "stayers", remained with their parents, and "leavers" left the natal territory to join an unrelated pair who failed to breed. Two-thirds of "stayers" were male [112].

During the nest-building phase of the subsequent breeding season, approximately 65% of gray jay trios included "stayers" from the previous spring and their parents, and approximately 30% of trios included an unrelated "leaver". Occasionally, 2 nonbreeders accompany a pair of adults. "Stayers" may eventually inherit the natal territory and breed, and "leavers" may eventually fill a vacancy nearby or form a new breeding pair on previously unoccupied ground [112]. The role of "stayers" is to retrieve caches and bring food to younger siblings [114,129]; however, this is only allowed by the parents during the postfledgling period [112,114,129]. Until then, parents are hostile toward the "stayer". This may reduce the frequency of predator-attracting visits to the nest when young are most vulnerable. The benefits of allofeeding may include "lightening the load" for the breeding pair, which may possibly increase longevity, reducing the probability of starvation of nestlings, and detecting and mobbing predators near the nest [114].

Nesting: Nesting typically occurs in March and April [97,113]. Male gray jays choose a nest site in a mature coniferous tree [53,76] and take the lead in construction [113]. Gray jay nests were found in black spruce (Picea mariana), white spruce (Picea glauca), and balsam fir (Abies balsamea) trees in Ontario and Quebec, with black spruce predominating [97,113]. Cup-shaped nests [53,64,76,98] were constructed with brittle dead twigs pulled off of trees, as well as bark strips and lichens. Cocoons of the forest tent caterpillar (Malacosoma dysstria) filled the interstitial spaces of the nest [113]. Nests are usually built on the southwestern side of a tree for solar warming and are usually <1 nest diameter from the trunk [97]. Nest height is typically 8 to 30 feet (2.4-9.1 m) above the ground [72,97]. The average height of 264 nests surveyed in Algonquin Provincial Park was 16 feet ± 9.2 (4.9 m ± 2.8) above ground [97].

Clutch size is 2 to 5 eggs. The mean clutch sizes of gray jays in Algonquin Provincial Park and La Verendrye Provincial Park were 3.03 and 3.18 eggs, respectively. Incubation is performed only by the female [97,113] and lasts an average of 18.5 days [113].

Fledging: Gray jay young are altricial.

Nestling growth is most rapid from the 4th through the 10th day following hatching. Young are fed food carried in the throats of both parents [97,113]. They are fed by the accompanying nonbreeding 3rd bird ("stayer") only during the postfledgling period (see Mating) [114,129]. Food is a dark brown, viscous paste containing primarily arthropods [97,113]. Young gray jays leave the nest between 22 and 24 days after hatching [113]. Juveniles reach full adult measurements within 5 months [43].

Natal dispersal distance for the gray jay is a median of 0.0 mile (0.0 km) for males, 1.7 miles (2.8 km) for females, and a maximum distance of 7.0 miles (11.3 km) for males and females [112].

Survival: In studies conducted in Ontario and Quebec, the mortality rate for nonbreeding dominant juveniles ("stayers") was 52%, and mortality was 85% for nonbreeding "leavers" between fledging in June to approximately mid-October. From fall to the following breeding season in March, further nonbreeder mortality was 50%. Territory-holding adult gray jays experienced low mortality rates (15.1% and 18.2% for males and females, respectively) [112]. The oldest known female gray jay was 16 years old, and one male was at least 14 years old [113]. Food-storing birds such as the gray jay may live longer than other species due to the increased probability of food availability [92].

  • 43. Ha, James C.; Lehner, Philip N. 1990. Notes on gray jay demographics in Colorado. The Wilson Bulletin. 102(4): 698-702. [63066]
  • 53. Hobson, Keith A.; Schieck, Jim. 1999. Changes in bird communities in boreal mixedwood forest: harvest and wildfire effects over 30 years. Ecological Applications. 9(3): 849-863. [36010]
  • 64. Kreisel, Karen J.; Stein, Steven J. 1999. Bird use of burned and unburned coniferous forests during winter. Wilson Bulletin. 111(2): 243-250. [38233]
  • 72. Martin, N. D. 1960. An analysis of bird populations in relation to forest succession in Algonquin Provincial Park, Ontario. Ecology. 41(1): 126-140. [36199]
  • 76. Morissette, J. L.; Cobb, T. P.; Brigham, R. M.; James, P. C. 2002. The response of boreal forest songbird communities to fire and post-fire harvesting. Canadian Journal of Forest Research. 32: 2169-2183. [43889]
  • 92. Roberts, Robert Chadwick. 1976. Ecological relationships in the acorn woodpecker (Melanerpes formicivorus), with reference to habitat characteristics, foraging strategies, and the evolution of food-storing behavior. Davis, CA: University of California. 100 p. Dissertation. [54898]
  • 97. Rutter, Russell J. 1969. A contribution to the biology of the gray jay (Perisoreus canadensis). Canadian Field-Naturalist,. 83(4): 300-316. [63081]
  • 98. Saab, Victoria A.; Powell, Hugh D. W. 2005. Fire and avian ecology in North America: process influencing pattern. In: Saab, Victoria A.; Powell, Hugh D. W., eds. Fire and avian ecology in North America. Studies in Avian Biology No. 30. Ephrata, PA: Cooper Ornithological Society: 1-13. [61678]
  • 112. Strickland, Dan. 1991. Juvenile dispersal in gray jays: dominant brood member expels siblings from natal territory. Canadian Journal of Zoology. 69(12): 2935-2945. [63089]
  • 113. Strickland, Dan; Ouellet, Henri. 1993. Gray jay. In: Poole, A.; Stettenheim, P.; Gill, F., eds. Birds of North America, No. 40. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [63063]
  • 114. Strickland, Dan; Waite, Thomas A. 2001. Does initial suppression of allofeeding in small jays help to conceal their nests? Canadian Journal of Zoology. 79(12): 2128-2146. [63093]
  • 129. Waite, Thomas A.; Strickland, Dan. 1997. Cooperative breeding in gray jays: philopatric offspring provision juvenile siblings. The Condor. 99(2): 523-525. [63249]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Direct Effects of Fire

As of 2006, no research directly investigated gray jay mortality due to fire. Fire can kill gray jays [80], but mortality is generally minor for adult birds [95]. If fires occur during the breeding season, mortality of nestlings or fledglings is possible, so adult birds may experience reduced reproduction rates [80].
  • 80. Patton, David R.; Gordon, Janet. 1995. Fire, habitats, and wildlife. Final report. Flagstaff, AZ: U.S. Department of Agriculture, Forest Service, Coconino National Forest. 85 p. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT; RWU 4403 files. [61019]
  • 95. Rotenberry, John T.; Cooper, Robert J. ; Wunderle, Joseph M.; Smith, Kimberly G. 1995. When and how are population limited? The roles of insect outbreaks, fire, and other natural perturbations. In: Martin, Thomas E.; Finch, Deborah M., eds. Ecology and management of neotropical migratory birds: A synthesis and review of critical issues. New York: Oxford University Press, Inc: 55-84. [26445]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
185 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Average lifespan

Status: wild:
185 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Clutch size 2-5 (usually 3-4). Incubation 16-18 days, by female. Young tended by both adults, capable of first flight when about 15 days old. In Ontario and Quebec, broods broke up in June, when the young were 55-65 days old; dominant brood member expelled siblings from natal territory, shared in food stored by parents (Strickland 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Perisoreus_canadensis breeds in coniferous forests and sometimes in mixed coniferous-deciduous woodlands. The male chooses a nest site usually in a conifer (spruce or fir), at a height of 5 to 12 feet (1.5 - 3.6 m), sometimes as high as 30 feet (9.1 m). The male initiates building the nest - a thick cup of twigs, bark strips, grass, moss, lichen, and spider webs. The inside is lined with fine grasses, moss, hair, feathers, and fur. The female joins the building over a period of up to 3 weeks or more.

The breeding season begins in March, while snow is still on the ground and temperatures are well below freezing, and ends by mid-May. Curiously, second broods are not attempted in ostensibly favorable later months. Three to four eggs (29 X 21 mm) are laid (range 2-5) and incubated by the female alone. The eggs are pale greenish or gray-green and heavily speckled, spotted, or blotched with olive and paler gray. After a 16 to 18 day incubation period, the nestlings hatch slightly downy and altricial. The young are fed by both parents and fledge at 22 to 24 days.

Cowbird parasitism has not been observed.

(Baicich 1997, Veghte 1964)

Average time to hatching: 17 days.

Average eggs per season: 3.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Perisoreus canadensis breeds in coniferous forests and sometimes in mixed coniferous-deciduous woodlands. The male chooses a nest site usually in a conifer (spruce or fir), at a height of 5 to 12 feet (1.5 - 3.6 m), sometimes as high as 30 feet (9.1 m). The male initiates building the nest - a thick cup of twigs, bark strips, grass, moss, lichen, and spider webs. The inside is lined with fine grasses, moss, hair, feathers, and fur. The female joins the building over a period of up to 3 weeks or more.

The breeding season begins in March, while snow is still on the ground and temperatures are well below freezing, and ends by mid-May. Curiously, second broods are not attempted in ostensibly favorable later months. Three to four eggs (29 X 21 mm) are laid (range 2-5) and incubated by the female alone. The eggs are pale greenish or gray-green and heavily speckled, spotted, or blotched with olive and paler gray. After a 16 to 18 day incubation period, the nestlings hatch slightly downy and altricial. The young are fed by both parents and fledge at 22 to 24 days.

Cowbird parasitism has not been observed.

(Baicich 1997, Veghte 1964)

Average time to hatching: 17 days.

Average eggs per season: 3.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Perisoreus canadensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNNNNNNCCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCTGGTGCTCTACTAGGAGATGACCAAATCTATAATGTAATCGTTACAGCCCATGCCTTTGTTATGATCTTCTTTATAGTTATACCAATCATGATCGGAGGCTTTGGAAACTGACTAGTCCCTCTAATAATCGGAGCTCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTTCTCCCCCCTTCATTCCTTCTCCTCCTAGCTTCCTCTACAGTAGAAGCAGGAGCAGGTACAGGATGAACTGTATACCCACCACTGGCTGGCAACCTAGCTCACGCTGGAGCCTCAGTCGACCTAGCTATCTTCTCGCTTCATCTAGCAGGTATCTCATCCATTCTAGGAGCAATCAACTTCATTACAACAGCAATTAACATGAAACCTCCAGCCCTATCCCAATACCAAACTCCTCTGTTTGTTTGATCCGTGCTAATCACCGCAGTGCTACTTCTCCTCTCCCTCCCTGTCCTAGCTGCTGGAATTACCATGCTTCTAACAGACCGTAACCTTAACACCACCTTCTTCGACCCAGCAGGCGGAGGAGATCCAGTACTATACCAACATCTGTTCTGATTCTTTGGTCACCCAGAAGTCTACATCCTAATTCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Perisoreus canadensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Perisoreus_canadensis is locally common over its wide range, but there is little precise population data. The Breeding Bird Surveys (BBS) from 1966 to 1993 show a -0.6% decline over that period, but with a statistically insignificant sample. The short-term BBS data trend from 1984 to 1993 show a 51.8% increase during that time (P<.01). Gray Jays are very vulnerable to human-set terrestrial fur-bearer traps.

The Gray Jay is not listed as Endangered or Threatened in the United States or Canada. No special management measures have been implemented for the species.

(Madge 1994, Price 1995)

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Information on state-level protected status of animals in the United States is available at NatureServe, although recent changes in status may not be included.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Perisoreus canadensis is locally common over its wide range, but there is little precise population data. The Breeding Bird Surveys (BBS) from 1966 to 1993 show a -0.6% decline over that period, but with a statistically insignificant sample. The short-term BBS data trend from 1984 to 1993 show a 51.8% increase during that time (P<.01). Gray Jays are very vulnerable to human-set terrestrial fur-bearer traps.

The Gray Jay is not listed as Endangered or Threatened in the United States or Canada. No special management measures have been implemented for the species.

(Madge 1994, Price 1995)

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Use of Fire in Population Management

More info for the term: wildfire

The data currently available suggest that gray jays are present in burned forests but are usually more abundant in unburned habitats [20,63,83,94,109,110,133]. This may be due to their preference for mature trees for foraging and nesting [53,56,76,87,97,106,113,120]. Because gray jays are habitat generalists [62,73,75,96,99,102,120,121,124,132] and omnivores [76,97,98,113], they may exhibit greater flexibility in response to habitat disturbances such as fire and logging than other bird species. Most studies examining gray jay response to fire have been conducted several years following wildfire. More research needs to be conducted on the immediate effects of low- and high-severity wildfire on gray jay, as well as the best time of year to conduct prescribed burning for gray jay management.

The amount and orientation of residual live and dead trees is an important component of stand structure following disturbance [53]. Gray jays utilize snags for perch sites [53,113,116,123,130], so they may be negatively affected by salvage logging. Wakkinen and Reese [130] and Hobson and Schieck [53] suggest managing for both dead and partially dead snags of different sizes in a variety of stand types to provide nesting, feeding, and perching sites for birds such as the gray jay.

Smucker and others [110] suggest that managers prescribe and allow for a range of fire severities to meet the needs of all bird species.
  • 53. Hobson, Keith A.; Schieck, Jim. 1999. Changes in bird communities in boreal mixedwood forest: harvest and wildfire effects over 30 years. Ecological Applications. 9(3): 849-863. [36010]
  • 56. Huff, Mark H.; Manuwal, David A.; Putera, Judy A. 1991. Winter bird communities in the southern Washington Cascade Range. In: Ruggiero, Leonard F.; Aubry, Keith B.; Carey, Andrew B.; Huff, Mark H., technical coordinators. Wildlife and vegetation of unmanaged Douglas-fir forests. Gen. Tech. Rep. PNW-GTR-285. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 207-218. [17314]
  • 62. Keller, Mary E.; Anderson, Stanley H. 1992. Avian use of habitat configurations created by forest cutting in southeastern Wyoming. The Condor. 94(1): 55-65. [63241]
  • 73. McGarigal, Kevin; McComb, William C. 1995. Relationships between landscape structure and breeding birds in the Oregon Coast Range. Ecological Monographs. 65(3): 235-260. [61142]
  • 75. Mills, Todd R.; Rumble, Mark A.; Flake, Lester D. 2000. Habitat of birds in ponderosa pine and aspen/birch forest in the Black Hills, South Dakota. Journal of Field Ornithology. 71(2): 187-206. [61151]
  • 76. Morissette, J. L.; Cobb, T. P.; Brigham, R. M.; James, P. C. 2002. The response of boreal forest songbird communities to fire and post-fire harvesting. Canadian Journal of Forest Research. 32: 2169-2183. [43889]
  • 87. Ralph, C. John; Paton, Peter W. C.; Taylor, Cathy A. 1991. Habitat association patterns of breeding birds and small mammals in Douglas-fir/hardwood stands in northwestern California and southwestern Oregon. In: Ruggiero, Leonard F.; Aubry, Keith B.; Carey, Andrew B.; Huff, Mark H., technical coordinators. Wildlife and vegetation of unmanaged Douglas-fir forests. Gen. Tech. Rep. PNW-GTR-285. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 379-393. [17329]
  • 96. Rumble, Mark A.; Mills, Todd R.; Flake, Lester D. 1999. Habitat capability model for birds wintering in the Black Hills, South Dakota. Res. Pap. RMRS-RP-19. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 11 p. [36409]
  • 97. Rutter, Russell J. 1969. A contribution to the biology of the gray jay (Perisoreus canadensis). Canadian Field-Naturalist,. 83(4): 300-316. [63081]
  • 98. Saab, Victoria A.; Powell, Hugh D. W. 2005. Fire and avian ecology in North America: process influencing pattern. In: Saab, Victoria A.; Powell, Hugh D. W., eds. Fire and avian ecology in North America. Studies in Avian Biology No. 30. Ephrata, PA: Cooper Ornithological Society: 1-13. [61678]
  • 99. Schieck, Jim; Nietfeld, Marie. 1995. Bird species richness and abundance in relation to stand age and structure in aspen mixedwood forests in Alberta. In: Stelfox, J. B., ed. Relationships between stand age, stand structure, and biodiversity in aspen mixedwood forests in Alberta. Vegreville, AB: Alberta Environmental Centre: 115-157. [60893]
  • 102. Shepperd, Wayne D.; Battaglia, Michael A. 2002. Ecology, silviculture, and management of Black Hills ponderosa pine. Gen. Tech. Rep. RMRS-GTR-97. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 112 p. [44794]
  • 113. Strickland, Dan; Ouellet, Henri. 1993. Gray jay. In: Poole, A.; Stettenheim, P.; Gill, F., eds. Birds of North America, No. 40. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [63063]
  • 116. Stuart-Smith, A. Kari; Hayes, John P. 2003. Influence of residual tree density on predation of artificial and natural songbird nests. Forest Ecology and Management. 183: 159-176. [46106]
  • 120. Theberge, John B. 1976. Bird populations in the Kluane Mountains, southwest Yukon, with special reference to vegetation and fire. Canadian Journal of Zoology. 54(8): 1346-1356. [41684]
  • 121. Thompson, Ian D.; Hogan, Holly A.; Montevicchi, William A. 1999. Avian communities of mature balsam fir forests in Newfoundland: age-dependence and implications for timber harvesting. The Condor. 101(2): 311-323. [63240]
  • 123. Vega, Robyn M. S. 1993. Bird communities in managed conifer stands in the Oregon Cascades: habitat associations and nest predation. Corvallis, OR: Oregon State University. 83 p. Thesis. [27972]
  • 124. Venier, Lisa A.; Pearce, Jennie L. 2005. Boreal bird community response to jack pine forest succession. Forest Ecology and Management. 217(1): 19-36. [60326]
  • 130. Wakkinen, Diane; Reese, Kerry P. 1992. Snag site characteristics and their associated use by avian wildlife in ponderosa pine forests: an executive summary. Unpublished report. 21 p. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [22545]
  • 132. Westworth, D. A.; Telfer, E. S. 1993. Summer and winter bird populations associated with five age-classes of aspen forest in Alberta. Canadian Journal of Forest Research. 23: 1830-1836. [22888]
  • 20. Bock, Jane H.; Bock, Carl E. 1981. Some effects of fire on vegetation and wildlife in ponderosa pine forests of the southern Black Hills. Final Report: Contracts CX-1200-9-B034, CX-1200-0-B018, CX-1200-1-B022. Grant No. RM-80-105 GR. Unpublished report on file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 58 p. [479]
  • 63. Kotliar, Natasha B.; Hejl, Sallie J.; Hutto, Richard L.; Saab, Victoria A.; Melcher, P.; McFadzen, Mary E. 2002. Effects of fire and post-fire salvage logging on avian communities in conifer-dominated forests of the western United States. In: George, T. Luke; Dobkin, David S., eds. Effects of habitat fragmentation on birds in western landscapes: contrasts with paradigms from the eastern United States. Studies in Avian Biology No. 25. Camarillo, CA: Cooper Ornithological Society: 49-64. [50440]
  • 83. Pfister, Allan Robert. 1980. Postfire avian ecology in Yellowstone National Park. Pullman, WA: Washington State University. 35 p. Thesis. [61009]
  • 94. Roppe, Jerry A.; Hein, Dale. 1978. Effects of fire on wildlife in a lodgepole pine forest. The Southwestern Naturalist. 23(2): 279-287. [261]
  • 109. Smucker, Kristina M. 2003. Changes in bird abundance and species composition in a coniferous forest following mixed-severity wildfire. Missoula, MT: University of Montana. 52 p. Thesis. [60612]
  • 110. Smucker, Kristina M.; Hutto, Richard L.; Steele, Brian M. 2005. Changes in bird abundance after wildfire: importance of fire severity and time since fire. Ecological Applications. 15(5): 1535-1549. [60366]
  • 133. Young, Jock S.; Hoffland, John R.; Hutto, Richard L. 2005. Monitoring for adaptive management in coniferous forests of the northern Rockies. In: Ralph, C. John; Rich, Terrell D., eds. Bird conservation implementation and integration in the Americas: proceedings of the 3rd international Partners in Flight conference. Vol. 1; 2002 March 20-24; Asilomar, CA. Gen. Tech. Rep. PSW-GTR-191. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 405-411. [63726]
  • 106. Silovsky, Gene D.; Pinto, Carlos. [n.d.]. Forest wildlife inventories: identification of conflicts and management needs. In: Wildlife and forest management in the Pacific Northwest: 53-61. [35399]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the terms: association, cover, hardwood

Gray jay populations are decreasing slightly. Breeding Bird Surveys conducted from 1966 to 1992 revealed that gray jay populations declined at a rate of 1.28%/year [82]. Gray jay abundance decreased in ponderosa pine forests in New Mexico from 1911 to 1961 [101].

The Nicolet National Forest Bird Survey in northeastern Wisconsin showed gray jay populations decreased from 1989 to 2002; however, the Breeding Bird Survey conducted in the same forest found gray jay populations increased during this time. This may be because Breeding Bird Survey routes were established randomly along roadsides [91], whereas the Nicolet National Forest Bird Survey routes were established within gray jay habitat [54].

Members of a guild are more likely to respond similarly when they are grouped according to their association with habitat zones instead of by the "guild approach", which groups bird species into guilds based on their foraging and nesting behavior. According to Skinner [108], the "guild approach" may be problematic for 2 reasons: a lack of consistency in how investigators assign bird species to guilds and a false assumption that the response of 1 species in a guild is representative of all species in that guild [108].

Silviculture: Because gray jays prefer mature forests [56,75,87,97,102,106,113,120], management activities such as harvesting mature and old-growth ponderosa pine stands [75], clearcutting, conversion of hardwood or mixed stands to pure conifer stands, and a maximum rotation period of 100 years may reduce the quantity or quality of preferred habitat for the gray jay [106]. Nevertheless, maintaining as much landscape diversity as possible is beneficial to the gray jay [102]. For more information on silvicultural treatments and the gray jay, (see Stand composition/structure).

The amount and orientation of residual live and dead trees is an important component of stand structure following disturbance [53]. Wakkinen and Reese [130] and Hobson and Schieck [53] suggest managing for both dead and partially dead snags of different sizes in a variety of stand types to provide nesting, feeding, and perching sites for birds.

Dwarf mistletoe: Gray jays are one of the most common vectors in the long-distance dispersal of dwarf mistletoe (Arceuthobium spp.) seeds [16,47,79]. Seeds are inadvertently picked up on gray jay feathers when birds forage or nest in infected trees [55,79,86]. Bennetts and others [16] suggest control of dwarf mistletoe "may not be justified, practical, or even desirable" in areas where management goals are not focused on timber production. Pineland dwarf mistletoe (A. vaginatum) in central Colorado may have positive effects on avian habitat, creating a mosaic of habitat patches for nesting and cover [16].

Some timber management practices may reduce the quantity or quality of preferred habitat for the gray jay. A 150- year-old, even-aged western hemlock forest on the Siuslaw National Forest, Oregon, was inventoried for wildlife management needs. The gray jay, which may require western hemlock forests older than 100 years, may be adversely affected by timber management activities that include clearcutting, conversion of hardwood or mixed stands to pure conifer stands, and rotation periods of less than 100 years [106].

Other: The impact of repeated human intrusions on gray jays was studied in a subalpine forest in the Snowy Mountains of Wyoming. The average number of gray jays was higher on intruded sites than on control sites, as was the probability of intrusion reoccurring. The potential for gray jay predation may be higher in human-intruded areas, but more studies are needed [42].

The gray jay has a high potential for damage from exposure to aerial insecticide treatments due to open-cup nests [89].
  • 16. Bennetts, Robert E.; White, Gary C.; Hawksworth, Frank G.; Severs, Scott E. 1996. The influence of dwarf mistletoe on bird communities in Colorado ponderosa pine forests. Ecological Monographs. 6(3): 899-909. [26509]
  • 42. Gutzwiller, Kevin J.; Riffell, Samuel K.; Anderson, Stanley H. 2002. Repeated human intrusion and the potential for nest predation by gray jays. Journal of Wildlife Management. 66(2): 372-380. [63009]
  • 47. Hawksworth, F. G.; Moir, W. H.; Janssen, J. E. 1992. Effects of dwarf mistletoe in old-growth lodgepole pine stands at Fraser Experimental Forest, Colorado. In: Kaufmann, Merrill R.; Moir, W. H.; Bassett, Richard L., technical coordinators. Old-growth forests in the Southwest and Rocky Mountain regions: Proceedings of a symposium; 1992 March 9-13; Portal, AZ. Gen. Tech. Rep. RM-213. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 60-65. [21979]
  • 53. Hobson, Keith A.; Schieck, Jim. 1999. Changes in bird communities in boreal mixedwood forest: harvest and wildfire effects over 30 years. Ecological Applications. 9(3): 849-863. [36010]
  • 54. Howe, Robert W.; Roberts, Lance J. 2005. Sixteen years of habitat-based bird monitoring in the Nicolet National Forest. In: Ralph, C. John; Rich, Terrell D., eds. Bird conservation implementation and integration in the Americas: proceedings of the 3rd international Partners in Flight conference: Vol. 2; 2002 March 20-24; Asilomar, CA. Gen. Tech. Rep. PSW-GTR-191. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 963-973. [63497]
  • 55. Hudler, George; Nicholls, Thomas; French, D. W.; Warner, Gloria. 1974. Dissemination of seeds of the eastern dwarf mistletoe by birds. Canadian Journal of Forest Research. 4(3): 409-412. [63087]
  • 56. Huff, Mark H.; Manuwal, David A.; Putera, Judy A. 1991. Winter bird communities in the southern Washington Cascade Range. In: Ruggiero, Leonard F.; Aubry, Keith B.; Carey, Andrew B.; Huff, Mark H., technical coordinators. Wildlife and vegetation of unmanaged Douglas-fir forests. Gen. Tech. Rep. PNW-GTR-285. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 207-218. [17314]
  • 75. Mills, Todd R.; Rumble, Mark A.; Flake, Lester D. 2000. Habitat of birds in ponderosa pine and aspen/birch forest in the Black Hills, South Dakota. Journal of Field Ornithology. 71(2): 187-206. [61151]
  • 79. Ostry, Michael E.; Nicholls, Thomas H.; French, D. W. 1983. Animal vectors of eastern dwarf mistletoe of black spruce. Research Paper NC-232. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 16 p. [63086]
  • 82. Peterjohn, Bruce J.; Sauer, John R.; Orsillo, Sandra. 1995. Breeding bird survey: population trends 1966-92. In: LaRoe, Edward T.; Farris, Gaye S.; Puckett, Catherine E.; Doran, Peter D.; Mac, Michael J., eds. Our living resources: a report to the nation on the distribution, abundance, and health of U.S. plants, animals, and ecosystems. Washington, DC: U.S. Department of the Interior, National Biological Survey: 17-21. [27175]
  • 86. Punter, David; Gilbert, Jeannie. 1989. Animal vectors of Arceuthobium americanum seed in Manitoba. Canadian Journal of Forest Research. 19(7): 865-869. [63090]
  • 87. Ralph, C. John; Paton, Peter W. C.; Taylor, Cathy A. 1991. Habitat association patterns of breeding birds and small mammals in Douglas-fir/hardwood stands in northwestern California and southwestern Oregon. In: Ruggiero, Leonard F.; Aubry, Keith B.; Carey, Andrew B.; Huff, Mark H., technical coordinators. Wildlife and vegetation of unmanaged Douglas-fir forests. Gen. Tech. Rep. PNW-GTR-285. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 379-393. [17329]
  • 91. Robbins, Chandler S.; Bystrak, Danny; Geissler, Paul H. 1986. The breeding bird survey: its first fifteen years, 1965-1979. Resource Publication 157. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 196 p. [24549]
  • 97. Rutter, Russell J. 1969. A contribution to the biology of the gray jay (Perisoreus canadensis). Canadian Field-Naturalist,. 83(4): 300-316. [63081]
  • 101. Scurlock, Dan; Finch, Deborah M. 1997. A historical review. In: Block, William M.; Finch, Deborah M., tech. eds. Songbird ecology in southwestern ponderosa pine forests: a literature review. Gen. Tech. Rep. RM-GTR-292. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 43-68. [27987]
  • 102. Shepperd, Wayne D.; Battaglia, Michael A. 2002. Ecology, silviculture, and management of Black Hills ponderosa pine. Gen. Tech. Rep. RMRS-GTR-97. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 112 p. [44794]
  • 108. Skinner, N. G. 1989. Seasonal avifauna use of burned and unburned lodgepole pine forest ecotones. Missoula, MT: University of Montana. 84 p. Thesis. [60435]
  • 113. Strickland, Dan; Ouellet, Henri. 1993. Gray jay. In: Poole, A.; Stettenheim, P.; Gill, F., eds. Birds of North America, No. 40. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union. 24 p. [63063]
  • 120. Theberge, John B. 1976. Bird populations in the Kluane Mountains, southwest Yukon, with special reference to vegetation and fire. Canadian Journal of Zoology. 54(8): 1346-1356. [41684]
  • 130. Wakkinen, Diane; Reese, Kerry P. 1992. Snag site characteristics and their associated use by avian wildlife in ponderosa pine forests: an executive summary. Unpublished report. 21 p. On file with: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [22545]
  • 89. Richmond, Merle L.; Henny, Charles J.; Floyd, Randy L.; [and others]. 1979. Effects of Sevin-4-Oil, Dimilin, and Orthene on forest birds in northeastern Oregon. Res. Pap. PSW-148. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station. 19 p. [19181]
  • 106. Silovsky, Gene D.; Pinto, Carlos. [n.d.]. Forest wildlife inventories: identification of conflicts and management needs. In: Wildlife and forest management in the Pacific Northwest: 53-61. [35399]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

While many corvids can cause extensive crop damage, the Gray Jay, because of its habitat requirements, does not overlap with farms. It can, however, be an annoyance (some would say a great delight) to campers, as it will linger in campsites and attempt to pilfer food.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Perisoreus_canadensis is valuable as an indicator of the health of boreal and sub-alpine systems. Although these areas are less altered than most biomes, acid precipitation and global climate change could have a noticeable effect on this species. Because they are specially adapted to harsh winter environments, Gray Jays may be negatively impacted by warming trends. Thus, the species could serve as an early-warning system for cascading effects of anthropogenic climate change.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

While many corvids can cause extensive crop damage, the Gray Jay, because of its habitat requirements, does not overlap with farms. It can, however, be an annoyance (some would say a great delight) to campers, as it will linger in campsites and attempt to pilfer food.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Perisoreus canadensis is valuable as an indicator of the health of boreal and sub-alpine systems. Although these areas are less altered than most biomes, acid precipitation and global climate change could have a noticeable effect on this species. Because they are specially adapted to harsh winter environments, Gray Jays may be negatively impacted by warming trends. Thus, the species could serve as an early-warning system for cascading effects of anthropogenic climate change.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Gray jay

This article is about the bird. For the article about the Cree mythological figure, see Wisakedjak.

The gray jay (Perisoreus canadensis), also grey jay, Canada jay or whiskey jack,[2] is a member of the crow and jay family (Corvidae) found in the boreal forests across North America north to the tree-line and in subalpine forests of the Rocky Mountains south to New Mexico and Arizona. It is one of three members of the genus Perisoreus, the others being the Siberian jay, P. infaustus, found from Norway to eastern Russia and the Sichuan jay, P. internigrans, restricted to the mountains of eastern Tibet and northwestern Sichuan. All three species store food and live year-round on permanent territories in coniferous forests.

Distribution[edit]

Subspecies P. c. capitalis (left), and P. c. obscurus (right); illustration by Keulemans, 1877

The gray jay is a native resident from northern Alaska east to Newfoundland and Labrador and south to northern California, Idaho, Utah, east-central Arizona, north-central New Mexico, central Colorado, and southwestern South Dakota. It is also a native resident in northern Minnesota, northern Wisconsin, northern Michigan, northern New York, and northern New England. The gray jay may wander north of the breeding range. In winter it travels irregularly to northwestern Nebraska, central Minnesota, southeastern Wisconsin, central Michigan, southern Pennsylvania, central New York, Connecticut, and Massachusetts.[3][4]

  • P. c. albescens is a resident from northeastern British Columbia and northwestern Alberta southeastward, east of the Rocky Mountains to South Dakota (Black Hills). It is casual in northwestern Nebraska.[3]
  • P. c. arcus is a resident in the Rainbow Mountains area, and headwaters of the Dean and Bella Coola Rivers of the central Coast Ranges, British Columbia.[3]
  • P. c. barbouri is a resident on Anticosti Island, Quebec.[3]
  • P. c. bicolor is a resident in southeastern British Columbia, southwestern Alberta, eastern Washington, northeastern Oregon, northern and central Idaho, and western Montana.[3]
  • P. c. canadensis breeds from northern British Columbia east to Prince Edward Island, and south to northern Minnesota, northern Wisconsin, northern Michigan, northeastern New York, northern Vermont, northern New Hampshire, and Maine. It winters at lower altitudes within the breeding range and south to southern Ontario and Massachusetts, casually to central Minnesota, southeastern Wisconsin, northwestern Pennsylvania, and central New York. Perisoreus c. canadensis is accidental in northeastern Pennsylvania (Philadelphia).[3]
  • P. c. capitalis is a resident in the southern Rocky Mountains from eastern Idaho, south-central Montana, and western and southern Wyoming south through eastern Utah, and western and central Colorado, to east-central Arizona and north-central New Mexico.[3]
  • P. c. griseus is a resident from southwestern British Columbia and Vancouver Island south through central Washington and central Oregon to the mountains of north-central and northeastern California.[3]
  • P. c. nigracapillus is a resident in northern Quebec (Fort Chimo, Whale River, and George River), throughout Labrador, and in southeastern Quebec (Mingan and Blanc Sablon).[3]
  • P. c. obscurus is a resident in the coastal belt from Washington (Crescent Lake, Seattle, and Columbia River) through western Oregon to northwestern California (Humboldt County).[3]
  • P. c. pacificus is a resident in north-central Alaska (Kobuk River, Endicott Mountains, and Fort Yukon), northern Yukon (Arctic Circle at the International Boundary), and northwestern Mackenzie (Mackenzie Delta and lower Horton River) south in Alaska to latitude 60° N.[3]
  • P. c. sanfordi is a resident in Newfoundland and Nova Scotia.[3]

Habitat and distribution[edit]

The vast majority of gray jays live where there is a strong presence of one or more of black spruce (Picea mariana), white spruce (P. glauca), Englemann spruce (P. engelmanni), jack pine (Pinus banksiana), or lodgepole pine (P. contorta). Gray jays do not inhabit the snowy, coniferous, and therefore seemingly appropriate Sierra Nevada of California where no spruce and neither of the two named pines occur. Nor do gray jays live in lower elevations of coastal Alaska or British Columbia dominated by Sitka spruce (Picea sitchensis). The key habitat requirements may be sufficiently cold temperatures to ensure successful storage of perishable food and tree bark with sufficiently pliable scales arranged in a shingle-like configuration that allows Gray Jays to wedge food items easily up into dry, concealed storage locations. Storage may also be assisted by the antibacterial properties of the bark and foliage of boreal tree species. An exception to this general picture may be the well-marked subspecies P. c. obscurus, once given separate specific status as the 'Oregon jay'. It lives right down to the coast from Washington to northern California in the absence of cold temperatures or the putatively necessary tree species.

Behavior[edit]

Mating[edit]

Gray jays typically breed at two years of age. Pairs are monogamous and remain together for their lifetime, but a male or female will find another mate following the disappearance or death of their partner.[4] Gray jay pairs breed during March and April, depending on latitude,[4][5][6] in permanent, all-purpose territories.[4][5][6][7] Second broods are not attempted, perhaps allowing greater time for food storage.[4][5]

Gray jays cooperatively breed.[6][8][9] Strickland[6] studied cooperative breeding of gray jays in Algonquin Provincial Park, Ontario, and La Verendrye Provincial Park, Quebec. In early June, when broods were 55 to 65 days old, the young fought amongst themselves until dominant juveniles forced their siblings to leave the natal area. Dominant juveniles, known as "stayers", remained with their parents, and "leavers" left the natal territory to join an unrelated pair who failed to breed. Two-thirds of "stayers" were male.[6]

During the nest-building phase of the subsequent breeding season, approximately 65% of gray jay trios included "stayers" from the previous spring and their parents, and approximately 30% of trios included an unrelated "leaver". Occasionally, two nonbreeders accompany a pair of adults. "Stayers" may eventually inherit the natal territory and breed, and "leavers" may eventually fill a vacancy nearby or form a new breeding pair on previously unoccupied ground.[6] The role of "stayers" is to retrieve caches and bring food to younger siblings;[8][9] however, this is only allowed by the parents during the postfledgling period.[6][8][9] Until then, parents are hostile toward the "stayer". This may reduce the frequency of predator-attracting visits to the nest when young are most vulnerable. The benefits of allofeeding may include "lightening the load" for the breeding pair, which may possibly increase longevity, reducing the probability of starvation of nestlings, and detecting and mobbing predators near the nest.[8]

Nesting[edit]

Gray jay in late spring

Nesting typically occurs in March and April.[4][5] Male gray jays choose a nest site in a mature coniferous tree[7] and take the lead in construction.[4] Gray jay nests were found in black spruce (Picea mariana), white spruce (Picea glauca), and balsam fir (Abies balsamea) trees in Ontario and Quebec, with black spruce predominating.[4][5] Cup-shaped nests[7] were constructed with brittle dead twigs pulled off of trees, as well as bark strips and lichens. Cocoons of the forest tent caterpillar (Malacosoma disstria) filled the interstitial spaces of the nest.[4] Nests are usually built on the southwestern side of a tree for solar warming and are usually <1 nest diameter from the trunk.[5] Nest height is typically 8 to 30 ft (2.4–9.1 m) above the ground.[5] The average height of 264 nests surveyed in Algonquin Provincial Park was 16 ± 9.2 ft (4.9 ± 2.8 m) above ground.[5]

Clutch size is 2 to 5 eggs. The mean clutch sizes of gray jays in Algonquin Provincial Park and La Verendrye Provincial Park were 3.03 and 3.18 eggs, respectively. Incubation is performed only by the female[5] and lasts an average of 18.5 days.[4]

Fledging[edit]

Gray jay young are altricial. Nestling growth is most rapid from the fourth through the tenth day following hatching. Young are fed food carried in the throats of both parents.[4][5] They are fed by the accompanying nonbreeding third bird ("stayer") only during the postfledgling period.[8][9] Food is a dark brown, viscous paste containing primarily arthropods.[4][5] Young gray jays leave the nest between 22 and 24 days after hatching.[4] Juveniles reach full adult measurements within 5 months.[10] Natal dispersal distance for the gray jay is a median of 0.0 mile for males, 1.7 miles (2.8 km) for females, and a maximum distance of 7.0 miles (11.3 km) for males and females.[6]

Survival[edit]

In studies conducted in Ontario and Quebec, the mortality rate for nonbreeding dominant juveniles ("stayers") was 52%, and mortality was 85% for nonbreeding "leavers" between fledging in June to approximately mid-October. From fall to the following breeding season in March, further nonbreeder mortality was 50%. Territory-holding adult gray jays experienced low mortality rates (15.1% and 18.2% for males and females, respectively).[6] The oldest known female gray jay was 16 years old, and one male was at least 14 years old.[4] Food-storing birds such as the gray jay may live longer than other species due to the increased probability of food availability.[11]

Gray jays are omnivorous.[4][5] Foods eaten include arthropods,[4] small mammals,[12] nestling birds,[13][14][15] carrion,[4][5] fungi,[4] fruits such as chokecherry (Prunus virginiana),[5] and seeds.[5] Two gray jays were seen eating slime mold (Fuligo septica) near Kennedy Hot Springs in the Glacier Peak Wilderness, Washington. This was the first report of any bird consuming slime mold in the field.[16]

Occasionally, gray jays eat live prey. Lescher and Lescher[12] witnessed a gray jay kill an unidentified, live small rodent in Wisconsin. Barnard was the first to witness an in-flight gray jay capture of a magnolia warbler (Dendroica magnolia) for consumption.[17]

Gray jays have been seen landing on moose (Alces alces) to remove and eat engorged winter ticks (Dermacentor albipictus) during April and May in Algonquin Provincial Park. Researchers also found a gray jay nest containing a brooding female, three hatchlings, and three warm, engorged winter deer ticks. Because the winter deer ticks were too large for the hatchlings to eat, it was hypothesized that the ticks may have served as "hot water bottles", keeping hatchlings warm when parents were away from the nest.[18]

Gray jays are suspected but not proven to prey on nests of the threatened marbled murrelet (Brachyramphus marmoratus) in coastal areas of the Pacific Northwest.[19]

Foraging behavior[edit]

Gray jays do not hammer food with their bill as do other jays, but wrench, twist, and tug food apart. Gray jays commonly carry large food items to nearby trees to eat or process for storage, possibly as defense against large scavengers.[4] They are "scatterhoarders", caching food items among scattered sites for later consumption.[20][21]

Any food intended for storage is manipulated in the mouth and formed into a bolus (rounded mass) that is coated with sticky saliva, adhering to anything it touches. The bolus is stored in bark crevices, under tufts of lichen, or among conifer needles.[5]

Risk and energy expenditure are factors in food selection for gray jay, which selects food on the basis of profitability to maximize caloric intake. Increased handling, searching, or recognition times for a preferred food item lowers its profitability.[20]

The gray jay takes advantage of man-made sources of food, hence the names "camp robber" and "whiskey jack". According to Maccarone and Montevecchi,[20] human observers do not inhibit gray jay's feeding behavior; however, Rutter[5] claims that "once having identified man with food it does not forget". He found that after a nesting female was accustomed to being fed by humans she could be enticed to leave the nest during incubation and brooding.[5]

Predation[edit]

Gray jays commonly prey on nestling birds.[15][19] Nests are located visually by moving from perch to perch and scanning surroundings.[4] Gray jay predation on nestling birds is temporally homogeneous throughout the passerine breeding season. Avian nest predation by gray jays is not necessarily higher in fragmented versus unfragmented forest.[13][14][15]

Boulet and others [13] examined bird nest predation in a commercially fragmented boreal black spruce forest intermixed with jack pine, balsam fir, quaking aspen, and paper birch near Lake Saint-Jean, Quebec. Gray jays directed their attacks on artificial arboreal nests more often than artificial ground nests. Depredation of nests was positively related to the presence of the lake and jack pine. Gray jays may have preferred preying on avian nests in jack pine versus black spruce habitat because jack pine forests were more open, and trees did not conceal nests as well. Gray jays may have favored foraging along lakeshores and moist patches due to the high density of insects. No relationship was found between the fragmented forest and predation.[13]

The potential for egg predation by gray jays was greater in riparian forest strips than in clearcuts in a second-growth boreal balsam fir forest in Montmorency Forest, Quebec.[22]

Stuart-Smith and Hayes[14] examined the influence of residual tree density on predation of artificial and natural songbird nests. The study took place in the White River and Lussier River Watershed, southeastern British Columbia, in a forest dominated by Douglas-fir, white spruce, and western larch. Twenty-four plots of similar age were chosen (16 logged, 8 burned by wildfire); they varied in residual tree density between 0 and 180 trees/ha. Residual trees apparently did not increase predation on nesting songbirds by the gray jay. However, a moderate increase in nest predation occurred in logged plots adjacent to or surrounded by mature conifer forest, which is the preferred habitat for gray jays.[4][5] Retaining residual trees would outweigh the possible increased risk of nest predation, except in areas where nesting birds are at very low numbers and potential risk by gray jays is high.[14]

When predation rates on bird nests by the gray jay were compared in clearcut, green-tree retention stands, and mature western hemlock stands in the west-central Oregon Cascade Ranges, predation rates were highest in green-tree retention stands. This may have been due to increased availability of perch sites for avian predators such as the gray jay.[15]

Caching[edit]

Gray jays cache thousands of food items every day during the summer for use the following winter.[6][9][23][24] Caching behavior is thought to have evolved for several reasons. It allows for permanent residence in boreal and subalpine forests,[4] ensures a food source in areas with high elevations and cyclic availability of food resources, and favors the retention of young and a kin-selected social organization.[11] In southern portions of the gray jay's range, food is not cached during summer because of the chance of spoilage and the reduced need for winter stores.[4] Cached items can be anything from carrion to bread crumbs and are formed into a bolus before being cached.[5] Cached food is sometimes used to feed nestlings and fledglings.[5]

Caching is inhibited by the presence of Steller's jays[25] and gray jays from adjacent territories,[23][24] which follow resident gray jays to steal cached food.[25] Gray jays carry large food items to distant cache sites for storage more often than small food items. To prevent theft, they also tend to carry valuable food items further from the source when caching in the company of one or more gray jays.[24] Scatterhoarding discourages pilferage by competitors. Cache thievery increases with increased cache density.[23]

When exploiting distant food sources found in clearings, gray jays temporarily concentrated their caches in an arboreal site along the edge of a black spruce forest in interior Alaska. This allowed a high rate of caching in the short term and reduced the jay's risk of predation. A subsequent recaching stage occurred, and food items were transferred to widely scattered sites to reduce theft.[21]

Predators[edit]

Gray jays are consumed by several bird species including great gray owls (Strix nebulosa), northern hawk-owls (Surnia ulula),[26] and Mexican spotted owls (Strix occidentalis lucida).[27] Gray jay remains were found in the nest sites of fisher (Martes pennanti) and American marten (Martes americana).[28] Red squirrel (Tamiasciurus hudsonicus) eat gray jay eggs.[5]

Gray jays warn each other of predators by whistling alarm notes, screaming, chattering, or imitating, and/or mobbing predators.[4]

Relationship with humans[edit]

Cultural significance[edit]

Bold gray jay, typical of those individuals accustomed to humans

Gray jays readily capitalize on novel food sources, including food sources introduced by humans living on or passing through their territories. To the frustration of trappers using baits to catch fur-bearing animals or early travelers trying to protect their winter food supplies, and to the delight of modern campers, many individual gray jays quickly learn that humans can be an excellent source of food, even coming to the hand for bread, raisins, or cheese. Such familiarity has inspired a long list of colloquial names for the gray jay. In addition to the once official 'Canada jay', there are, lumberjack, meat-bird, camp robber, venison-hawk, moose-bird, gorby and, most notable of all, 'whiskeyjack'. This is a variant of an aboriginal name, variously written as wiskedjak, whiskachon, wisakadjak, and other forms, of a mischievous prankster prominent in Algonquian mythology.

Conservation[edit]

Gray jays are widespread in boreal and subalpine habitats only lightly occupied by humans. Significant human impacts may nevertheless occur through anthropogenic climate warming. Gray jays at the northern edges of their range may benefit from the extension of spruce stands out onto formerly treeless tundra. A published study has documented a decline at the southern edge of the gray jay’s range, however, and plausibly linked a local decline in productivity to warmer temperatures in preceding autumns. Such warm temperatures may encourage spoilage of the perishable food items stored by gray jays upon which success of late winter nesting partly depends.

Three important questions[edit]

There are three perplexing features of gray jay breeding and social behaviour that pose interesting challenges to a central concept of evolutionary biology, namely that an organism should exhibit behaviour that maximizes the production of surviving offspring.

Why do Gray Jays breed so early?[edit]

Female incubating her eggs

Breeding gray jays build nests and lay eggs in March or even February, when snow is deep in the boreal forest, temperatures may plunge far below freezing, and there is no obvious food to support reproduction. In spite of such hostile conditions, gray jays have a high rate of nest success and the young typically leave the nest in late April, well before most boreal birds have even returned from the south, let alone begun nesting themselves. Just as strange, gray jays never bring off a second brood in the same season even though there would probably be time to do so and therefore to produce more young per year than they actually do. Stored food enables nesting jays to feed their young even during a blizzard but this only explains how gray jays can get away with nesting in late winter and contributes nothing to understanding why it is advantageous to do so. Among other possible benefits, early nesting gray jays have nesting over and done with at a correspondingly early date and can invest more food storage effort into their territories before the following winter. Assuming much of the stored food lasts until the onset of cold temperatures, storing more food on the territory should mean that early nesting jays have a better prospect of making it through the long, seemingly foodless boreal winter by staying at home and therefore avoiding the dangers of migration. This might mean that fewer young would be produced each breeding season (than if nesting occurred in June) but if it means that early nesting gray jays live longer and nest more often, they may still produce more surviving young in the long run than if they re-nested, or nested just once but later in the season).

Why do young gray jays turn on each other?[edit]

When young gray jays leave the nest in late April, they huddle together for warmth at first and later gradually start moving through the forest as part of a cohesive family group. Then, when they are about 55 days old (five weeks out of the nest) they start to fight among themselves and within ten days, one of them has expelled its siblings from the natal territory. The dominant juvenile will continue to accompany its parents through the first fall and winter (and sometimes longer), benefiting from their experience and protection. The expelled siblings sometimes succeed in finding an unsuccessful pair that will tolerate them but most fail to do so and about 80% of them are dead by fall (as opposed to just 50% of the dominant juveniles that have stayed at home with their parents). Since siblings share 50% of their genes (as many as a parent shares with its offspring) an explanation is required for any behaviour in an individual that results in a high death rate in that individual’s brothers and sisters.

Gray, sooty plumage of a juvenile

For the gray jay, one possible explanation concerns the problem of storing enough food for a young bird’s first winter. Although young gray jays start storing food when they are just a few weeks old, they almost certainly aren’t very good at it and may plausibly require a parental subsidy to avoid starving to death in the cold season. If so, and if the parental subsidy is sufficient for the sure survival of only one extra bird, there will be grounds for conflict in deciding which sibling will be the one to benefit. The question then becomes ‘why not wait until fall before ejecting the weaker siblings?’ That way, the dominant juvenile could reap the benefits, not only of his food storage efforts (and it usually is a male since they are larger and tend to win the dispersal fights), but also of the food stored all summer by the about-to-be ejected losers.

The relevant consideration here may be how the parental subsidy is acquired. If gray jays find stored food by random searching, evicting siblings at either the beginning or the end of the summer-and-fall food storage season would probably be ineffective. To be sure, a dominant juvenile could probably keep its weaker siblings from accompanying the family group but it could do little to prevent them from sneaking around the huge thickly forested territory and finding stored food on their own. If gray jays recover stored food by memory, however, it would pay a dominant juvenile to get rid of the competition at the beginning of the food storage season. That way, the weaker siblings would never know where the extra food was hidden and there would be no point in trying to stay on in their parents’ territory. On the contrary, it would be in their best interest, once they had lost the fight with their dominant sibling, to leave in search of another territory without an extra juvenile and where they might be tolerated by the local pair. In so doing, they would have at least a fighting chance to acquire access to a winter food subsidy of their own. The fact that dominant juveniles do expel their siblings in June, at the beginning of the food storage season, and the fact that expelled juveniles do leave right away and try to win acceptance from unrelated pairs suggests that gray jays do, in fact, recover stored food by memory.

Why don’t nonbreeders help feed nestlings?[edit]

When gray jays start building their nests in February or March, 20 percent or more of all pairs are still accompanied by a third, nonbreeding individual, usually the dominant juvenile from the pair’s own previous nesting. Many other bird species, particularly in the tropics, and notably including jays, also have retained young that have been unable to find territories of their own. Typically, such birds help feed their parents’ new nestlings and participate in defending them from nest predators. In many cases, such help has been shown to improve the production of surviving young. Since the extra young are younger siblings of the nonbreeding helpers, the nonbreeders have, in effect, increased their own genes in the next generation, just as they would have if they had had young of their own.

Pair of jays feeding their nestlings

In gray jays, however, nonbreeders do not help their parents to raise younger siblings. Instead, they usually stay well away from the nest and if they do approach it, the adults energetically drive them away. But, if helping by nonbreeders is so beneficial in other birds with similar demographic circumstances, why not in gray jays? If anything, it should be even more important in a bird that nests in the cold, apparently foodless conditions of late winter. Even more puzzling, although a pair will prevent the nonbreeder from feeding the nestlings, it will allow such feeding as soon as the young have left the nest. This strange reversal of behaviour may be explained as follows. First, extra trips to the nest with food will be dangerous if they give the location away to a predator that then cannot be driven away by the combined efforts of the pair and the nonbreeder. This is supported by the fact that adult gray jays also help to keep the nest inconspicuous in much the same way—by bringing maximum possible food loads in what are therefore very infrequent trips to the nest. Second, if the nest predator driving this behaviour is a mammal, it will be much less dangerous once the young can fly and have left the nest. This may explain why, after the young fledge, breeding gray jays start allowing feeding visits to the young by the nonbreeder and also why they themselves start making more frequent visits (with smaller food loads).

References[edit]

 This article incorporates public domain material from the United States Department of Agriculture document "Perisoreus canadensis".

  1. ^ BirdLife International (2012). "Perisoreus canadensis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Peterson RT (1947). A Field Guide to Eastern Birds. Second Revised Edition. Boston:Houghton Mifflin Co.
  3. ^ a b c d e f g h i j k l American Ornithologists' Union. 1957. Checklist of North American birds. 5th ed. Baltimore, MD: The Lord Baltimore Press, Inc
  4. ^ a b c d e f g h i j k l m n o p q r s t u v w x Strickland, Dan; Ouellet, Henri. 1993. Gray Jay. In: Poole, A.; Stettenheim, P.; Gill, F., eds. Birds of North America, No. 40. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
  5. ^ a b c d e f g h i j k l m n o p q r s t u v Rutter, Russell J. (1969). "A contribution to the biology of the Grey Jay (Perisoreus canadensis)". Canadian Field-Naturalist 83 (4): 300–316. 
  6. ^ a b c d e f g h i j Strickland, Dan (1991). "Juvenile dispersal in Grey Jays: dominant brood member expels siblings from natal territory". Canadian Journal of Zoology 69 (12): 2935–2945. doi:10.1139/z91-414. 
  7. ^ a b c Hobson, Keith A.; Schieck, Jim (1999). "Changes in bird communities in boreal mixedwood forest: harvest and wildfire effects over 30 years". Ecological Applications 9 (3): 849–863. doi:10.1890/1051-0761(1999)009[0849:CIBCIB]2.0.CO;2. JSTOR 2641334. 
  8. ^ a b c d e Strickland, Dan; Waite, Thomas A. (2001). "Does initial suppression of allofeeding in small jays help to conceal their nests?". Canadian Journal of Zoology 79 (12): 2128–2146. doi:10.1139/cjz-79-12-2128. 
  9. ^ a b c d e Waite, Thomas A.; Strickland, Dan (1997). "Cooperative breeding in Gray Jays: philopatric offspring provision juvenile siblings". The Condor 99 (2): 523–525. doi:10.2307/1369960. JSTOR 1369960. 
  10. ^ Ha, James C.; Lehner, Philip N. (1990). "Notes on Gray Jay demographics in Colorado". The Wilson Bulletin 102 (4): 698–702. JSTOR 4162942. 
  11. ^ a b Roberts, Robert Chadwick. 1976. Ecological relationships in the acorn woodpecker (Melanerpes formicivorus), with reference to habitat characteristics, foraging strategies, and the evolution of food-storing behavior. Davis, CA: University of California. Dissertation
  12. ^ a b Lesher, Fred; Lesher, Jolene (1984). "Gray Jay takes live mammal". The Loon 56 (1): 72–73. 
  13. ^ a b c d Boulet, Marylene; Darveau, Marcel; Belanger, Louis (2000). "A landscape perspective of bird nest predation in a managed boreal black spruce forest". Ecoscience 7 (3): 281–289. 
  14. ^ a b c d Stuart-Smith, A; Hayes, John P. (2003). "Influence of residual tree density on predation of artificial and natural songbird nests". Forest Ecology and Management 183: 159. doi:10.1016/S0378-1127(03)00104-X. 
  15. ^ a b c d Vega, Robyn M. S. 1993. Bird communities in managed conifer stands in the Oregon Cascades: habitat associations and nest predation. Corvallis, OR: Oregon State University. Thesis
  16. ^ Sutherland, John B.; Crawford, Ronald L (1979). "Gray Jay feeding on slime mold". The Murrelet 60 (1): 28. 
  17. ^ Barnard, William H. (1996). "Juvenile Grey Jay preys upon magnolia warbler". Journal of Field Ornithology 67 (2): 252–253. 
  18. ^ Addison, E. M.; Strickland, R. D.; Fraser, D. J. H. (1989). "Gray Jays, Perisoreus canadensis, and common ravens, Corvus corax, as predators of winter ticks, Dermacentor albipictus". The Canadian Field-Naturalist 103 (3): 406–408. 
  19. ^ a b Raphael, Martin G.; Mack, Diane Evans; Marzluff, John M.; Luginbuhl, John M. 2002. Effects of forest fragmentation on populations of the marbled murrelet. Studies in Avian Biology. 25: 221–235
  20. ^ a b c Maccarone, Alan D.; Montevecchi, W. A. (1986). "Factors affecting food choice by Gray Jays". Bird Behavior 6 (2): 90–92. doi:10.3727/015613886792195216. 
  21. ^ a b Waite, Thomas A.; Reeve, John D. (1997). "Multistage scatter-hoarding decisions in the Gray Jay (Perisoreus canadensis)". Bird Behavior 12 (1/2): 7–14. doi:10.3727/015613897797141335. 
  22. ^ Darveau, Marcel; Belanger, Louis; Huot, Jean; Melancon, Eric; DeBellefeuille, Sonia (1997). "Forestry practices and the risk of bird nest predation in a boreal coniferous forest". Ecological Monographs 7 (2): 572–580. doi:10.1890/1051-0761(1997)007[0572:FPATRO]2.0.CO;2. JSTOR 2269522. 
  23. ^ a b c Waite, Thomas A. (1988). "A field test of density-dependent survival of simulated Gray Jay caches". The Condor 90 (1): 247–249. doi:10.2307/1368458. JSTOR 1368458. 
  24. ^ a b c Waite, Thomas A. (1992). "Social hoarding and a load size-distance relationship in Gray Jays". The Condor 94 (4): 995–998. doi:10.2307/1369297. JSTOR 1369297. 
  25. ^ a b Burnell, Kristi L.; Tomback, Diane F. (1985). "Steller's jays steal Grey Jay caches: field and laboratory observation". Auk 102 (2): 417–419. doi:10.2307/4086793. JSTOR 4086793. 
  26. ^ Rohner, Christoph; Smith, James N. M.; Stroman, Johan; Joyce, Miranda; Doyle, Frank I.; Boonstra, Rudy (1995). "Northern Hawk-Owls in the Nearctic boreal forest: prey selection and population consequences of multiple prey cycles". The Condor 97 (1): 208–220. doi:10.2307/1368997. JSTOR 1368997. 
  27. ^ U.S. Department of the Interior, Fish and Wildlife Service. 1995. Recovery plan for the Mexican spotted owl: Vols. 1–2. Albuquerque, NM: U. S. Department of the Interior, Fish and Wildlife Service
  28. ^ Henry, Stephen E.; Raphael, Martin G.; Ruggiero, Leonard F. (1990). "Food caching and handling by marten". The Great Basin Naturalist 50 (4): 381–383.  PDF copy

Further reading[edit]

  • Madge, S. and H. Burn. 1994. Crows and Jays: A Guide to the Crows, Jays and Magpies of the World. Boston, Houghton Mifflin.
  • Strickland, D. and H. Ouellet. 1993. Gray Jay – Perisoreus canadensis. The Birds of North America No. 40.
  • Waite, T.A. and D. Strickland. 2006. Climate change and the demise of a hoarding bird living on the edge. Proc. Roy. Soc. B. 273: 2809–2813.

Additional photos[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Composed of two groups which may represent separate species: CANADENSIS (Canada Jay) and OBSCURUS (Oregon Jay) (AOU 1998). May constitute a superspecies with P. INFAUSTUS and P. INTERNIGRANS, both of the Old World (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Perisoreus canadensis (Linnaeus) is the scientific name for the gray jay,
a member of the Corvidae family. Listed below are 11 recognized subspecies [4,60,104]:

Perisoreus canadensis albescens Peters

Perisoreus canadensis arcus Miller

Perisoreus canadensis barbouri Brooks

Perisoreus canadensis bicolor Miller

Perisoreus canadensis canadensis Linnaeus

Perisoreus canadensis capitalis Ridgway

Perisoreus canadensis griseus Ridgway

Perisoreus canadensis nigricapillus Ridgway

Perisoreus canadensis obscurus Ridgway

Perisoreus canadensis pacificus Gmelin

Perisoreus canadensis sanfordi Oberholser
  • 104. Sibley, Charles G.; Monroe, Burt L., Jr. 1990. Distribution and taxonomy of the birds of the world. New Haven, CT: Yale University Press. 1111 p. [22814]
  • 4. American Ornithologists' Union. 2007. The A.O.U. check-list of North American birds, 7th edition, [Online]. American Ornithologists' Union (Producer). Available: http://www.aou.org/checklist/index.php3. [50863]
  • 60. ITIS Database. 2007. Integrated taxonomic information system, [Online]. Available: http://www.itis.gov/index.html. [51763]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

gray jay

grey jay

Canada jay

whiskey Jack

camp robber

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!