Articles on this page are available in 2 other languages: Spanish (15), Chinese (Simplified) (10) (learn more)

Overview

Brief Summary

Biology

House sparrows feed mainly on seeds, but in the breeding season the adults will take some animal matter (mainly insects), and feed their young on insects for the first part of the nestling period (9). It is a regular visitor to garden bird tables and feeders (5). This sociable species nests in colonies, the untidy feather-lined nests are built in crevices and holes in buildings, tree holes and nest boxes (4). House sparrows are also known to occasionally evict other species of birds from their nests, subsequently occupying them (6). During the breeding season, house sparrows mate very frequently, so much so that their eggs were once highly prized as aphrodisiacs (6). After May, 3-5 whitish, blotched eggs are laid (4). The female incubates the eggs for up to 14 days, after which time both parents share the task of feeding the young for around 15 days (4). Three or more broods may be produced every breeding season (4). The gregarious nature of this sparrow is often most obvious during winter, when most activities including feeding, roosting and bathing, are carried out in groups or large flocks (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 2 people

Average rating: 3.75 of 5

The House Sparrow (Passer domesticus) is native to Eurasia and the northern edge of the African continent, but is now found in most regions of the world where humans live. This species is mainly associated with humans, living around buildings in settings ranging from isolated rural farms to major urban centers, although population density and breeding success are generally higher in suburban environments than in cities or rural areas.

House Sparrows have a mainly vegetarian diet, feeding especially on weed and grass seeds or waste grain, but also on buds, berries, and a range of scraps from humans. During the summer, animal material can account for as much as 10% of the diet and, as opportunists, House Sparrows may take small frogs. mollusks, and crustaceans where available. Nestlings are fed mainly insects for the first few days after hatching .

House Sparrows generally occur in flocks, often quite large ones outside the breeding season. Breeding is mainly in loose colonies of 10 to 20 pairs. Nest building is initiated by an unmated male, but assisted by his mate after pair formation. Nests are typically built in artificial or natural cavities or crevices. These birds are remarkably catholic in their choice of a nest site, with nests reported from moving machinery and even from 640 m below ground in a coal mine in England. Clutch size is typically 3 to 6 eggs. Incubation (for 10 to 14 days) is by both parents. Both parents also feed the nestlings, which leave the nest around two weeks after hatching. Two or three clutches are typically produced each year.



House Sparrows are non-migratory over most of their native and introduced range. This species is among the more abundant birds in the world: the total European population in the 1980s and 1990s probably exceeded 50,000,000 breeding pairs, with an estimated world total of around 500,000,000 pairs. However, significant population declines have been reported in recent years over parts of the native and introduced range (although range expansion elsewhere has continued).

(Kaufman 1996; Summers-Smith 2009 and references therein)

  • Kaufman, K. 1996. Lives of North American Birds, Houghton Mifflin, Boston.
  • Summers-Smith, J.D. 2009. Family Passeridae (Old World Sparrows). Pp. 760-813 in: del Hoyo, J., Elliott, A., and D.A. Christie, eds. 2009. Handbook of the Birds of the World, Vol. 14. Bush Shrikes to Old World Sparrows. Lynx Edicions, Barcelona.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Leo Shapiro

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Description

The sparrow is one of Britain's most well-known and best-loved birds. Both sexes have a brown back streaked with black. Males and females are easily distinguished; males have a black bib, a grey crown with chestnut sides, and white cheeks. Females and juveniles have a duskier appearance, and lack the black bib seen in males (2). It is a very vocal species, producing a great range of familiar chattering and chirping, and a 'cher'r'r' when squabbling (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Passer domesticus

A medium-sized (6 inches) Old World sparrow, the male House Sparrow is most easily identified by its mottled brown back, gray belly and crown, black “bib,” white cheeks, and chestnut head patches. Females are mottled gray-brown overall with a faint pale eye stripe. This species may be confused with a several other brownish species of Old World sparrows, but is almost unmistakable in areas where it occurs alone. House Sparrows are unrelated to similarly-patterned New World “sparrows,” which are in the same family as the Old-World buntings. The House Sparrow is native to Europe, North Africa, and parts of West and South Asia. Today, this species inhabits almost every temperate and subtropical locality on earth as a result of introductions by humans. Notable releases include that of around one hundred birds in Brooklyn, NY in the early 1850s, after which began the House Sparrow’s colonization of the United States and southern Canada. Other non-native populations exist in southern South America, South Africa, Australasia, and on oceanic islands around the world. Some House Sparrows in Central Asia migrate short distances south during the winter, while native and non-native populations elsewhere are non-migratory. House Sparrows inhabit an extraordinary variety of habitats around the world, including subtropical forests, dry deserts, temperate forests, and grasslands. This species is particularly successful at utilizing human-altered environments, and is found in high concentrations in agricultural and urban areas where food and man-made nesting sites are plentiful. House Sparrows primarily eat seeds and grains, including important cereal crops, although this species will also eat insects during the summer. In temperate and subtropical parts of the world, the House Sparrow is often one of the most visible bird species, particularly in urban areas. House Sparrows may be observed foraging for food in fields, hedgerows, parks, and even on bare sidewalk. This species is a cavity nester, and, as its name suggests, is particularly attracted to nesting in the eaves of buildings. House Sparrows are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

The House Sparrow is distributed worldwide (excluding the Poles). It is native to Eurasia and North Africa. It was introduced into S. Africa, South America, Australia, New Zealand, and America. Its introduction into North America occured in 1851, when a group of 100 birds from England was released in Brooklyn, New York.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); ethiopian (Native ); neotropical (Introduced ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Native to Old World (northern Scandinavia and northern Siberia south to northern Africa, Arabia, India, and southeast Asia). Introduced and established as a resident from the north coast of British Columbia and southern Yukon to Newfoundland, south to South America, West Indies (including Puerto Rico, where the species is uncommon and local on the south coast and a flock of 60 was found on Isla Mona in 1987), Hawaii (all main islands), south and east Africa, Australia, New Zealand, and many other areas of world (AOU 1998). Expansion continues in South America unaided by humans (Ridgely and Tudor 1989). Accidental (3 records) in Alaska; two vagrants in southeastern Alaska probably came from the North American exotic population, but one from St. Lawrence Island undoubtedly came from an introduced population on the Chukotsk Peninsula (Kessel and D. Gibson, University of Alaska Museum, unpublished records).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Geographic Range

House Sparrows are distributed almost worldwide, excluding the polar regions. They are native to the Palearctic and Ethiopian regions and have been introduced to the Nearctic, Neotropical, and Australian regions. Their introduction into North America occured in 1851, when a group of 100 birds from England was released in Brooklyn, New York.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); ethiopian (Native ); neotropical (Introduced ); australian (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Widespread throughout Britain, but has undergone a drastic decline during the last 25 years. There are regional differences in the decline, but it has been most severe in the east of England, with a shocking reduction of 90% since 1970 (8). Elsewhere, this cosmopolitan species is found throughout Europe, North Africa, the Middle East, India and Burma, and across central Asia. It has been introduced to New Zealand, Australia, and North and South America (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

House Sparrows are a stout, stocky sparrow, with shorter legs and a thicker bill than native American sparrows. Members of both sexes are brown backed with black streaks throughout this area. Their undersides are pale buff. Males have white cheeks and a black bib, while females do not. The tail is usually three-quarters of the length of the wing. Males are slightly larger than females. Wing length is 76 mm and average mass is 28.5 grams.

Average mass: 28.5 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male more colorful

Average mass: 25.3 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The House Sparrow is a stout, stocky sparrow, with shorter legs and a thicker bill than indigenous American sparrows. Members of both sexes are brown backed with black streaks throughout this area. Its underside is pale buff. Males have white cheeks and a black bib, while females do not. The tail is usually three-quarters the length of the wing. Wing length is 76 mm and average mass is 28.5 grams.

Average mass: 28.5 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male more colorful

Average mass: 25.3 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 16 cm

Weight: 28 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

In North America House Sparrows prefer areas that have been modified by humans, including farms, residential areas, and urban areas. They are absent from uninhabited woodlands, deserts, forests, and grasslands.

Habitat Regions: temperate ; terrestrial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

House Sparrows like areas that have been modified by humans, including farms, residential, and urban areas. They are absent from uninhabited woodlands, deserts, forests, and grasslands.

Habitat Regions: temperate ; terrestrial

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: North America: cities, villages, farms, parks. Nests in cavities and in crevices of structures.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Closely associated with permanent human habitations, including farmyards, villages, parks, suburban areas and city centres (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

House Sparrows eat various kinds of seed supplemented by some insects. Rural birds tend to eat more waste seed from animal dung and seed from fields, while urban birds tend to eat more commercial birdseed and weed seed. Studies of the contents of House Sparrow stomachs in Alabama, Conn., Illinois, Iowa, Mass., Michigan, Miss., Penn., and Vermont have shown approximate amounts of seed to be 60% livestock feed (corn, wheat, oats, etc.), 18% cereals (grains from storage or from fields), 17 % weed seed, and 4% insects.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats seeds, grain, and (in summer) insects and other invertebrates and small fruits (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

House sparrows eat various kinds of seeds supplemented by some insects. Rural birds tend to eat more waste seed from animal dung and seed from fields, while urban birds tend to eat more commercial birdseed, weed seed, and human trash. Studies of the contents of house sparrows' stomachs in Alabama, Connecticut, Illinois, Iowa, Massachusetts, Michigan, Missouri, Pennsylvania, and Vermont have shown approximate amounts of seed to be 60% livestock feed (corn, wheat, oats, etc.), 18% cereals (grains from storage or from fields), 17 % weed seed, and 4% Insecta.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite / blood sucker
adult of Oeciacus hirundinis sucks the blood of nestling of Passer domesticus
Other: minor host/prey

Animal / predator
Passer domesticus is predator of adult of Bruchus pisorum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

House sparrows are abundant near human habitations. In these areas they serve as an important prey base for birds of prey and they may have an impact on plant communities because they consume large quantities of seeds. House sparrows seriously impact populations of native birds, such as Sialia, Parus, Petrochelidon pyrrhonota, and some Picoides. House sparrows take over the nesting cavities of native birds, including expelling adults and nestlings by force.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Many Accipitridae and Strigiformes hunt and feed on house sparrows. These include Accipitridae, Falco columbarius, Nyctea scandiaca, Otus asio, and many others. Known predators of nesting young or eggs include Felis silvestris, Canis lupus familiaris, Procyon lotor, and many Squamata. House sparrows avoid predation by foraging in small flocks so that there are many eyes watching out for potential predators.

Known Predators:

  • hawks (Accipitridae)
  • falcons (Falconidae)
  • owls (Strigiformes)
  • northern shrikes (Lanius_excubitor)
  • domestic cats (Felis_silvestris)
  • domestic dogs (Canis_lupus_familiaris)
  • raccoons (Procyon_lotor)
  • black rat snakes (Elaphe_obsoleta)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

House sparrows are abundant near human habitations. In these areas they serve as an important prey base for birds of prey and they may have an impact on plant communities because they consume large quantities of seeds. House sparrows seriously impact populations of native birds, such as bluebirds, chickadees, cliff swallows, and some woodpeckers. House sparrows take over the nesting cavities of native birds, including expelling adults and nestlings by force.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Many hawks and owls hunt and feed on house sparrows. These include Cooper's hawks, merlins, snowy owls, eastern screech owls, and many others. Known predators of nesting young or eggs include cats, domestic dogs, raccoons, and many snakes. House sparrows avoid predation by foraging in small flocks so that there are many eyes watching out for potential predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

See Bennett (1990) for information on the ecological relationship between the house sparrow and house finch in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

House Sparrows use a set of postures and behaviors to communicate with others of their species. House Sparrows also have a set of vocalizations that are used to attract mates, deter intruders, and warn others.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

House Sparrows use a set of postures and behaviors to communicate with others of their species. House Sparrows also have a set of vocalizations that are used to attract mates, deter intruders, and warn others.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Life Expectancy

Lifespan/Longevity

A wild House Sparrow lived to be 13 years and 4 months old, though most will live for only several years.

Range lifespan

Status: wild:
13.0 (high) years.

Average lifespan

Status: wild:
189 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

A wild House Sparrow lived to be 13 years and 4 months old, though most will live for only several years.

Range lifespan

Status: wild:
13.0 (high) years.

Average lifespan

Status: wild:
189 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 23 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mating System: monogamous

House Sparrows form monogamous pairs for each breeding season. Nests are built between February and May. House Sparrows nest in crevices inside and on buildings, and in coniferous and deciduous trees. Nests are built from dried vegetation, feathers, strings, and paper. Eggs are layed at any time in the nesting period. One to eight eggs can be present in a clutch, though there are usually 5, with the possiblity of four clutches per nesting season. Both males and females incubate the eggs for short periods of a few minutes each. Incubation lasts for 10 to 14 days. After the eggs are hatched, both males and females feed the young through regurgitation.

Breeding season: February through August in North America

Range eggs per season: 1.0 to 8.0.

Average eggs per season: 5.0.

Range time to hatching: 11.0 (high) days.

Average fledging age: 14.0 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); oviparous

Average eggs per season: 5.

Both males and females incubate eggs and brood young until they have fledged. Both parents also provide their young with food.

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating System: monogamous

House Sparrows form monogamous pairs for each breeding season. Nests are built between February and May. House Sparrows nest in crevices inside and on buildings, and in coniferous and deciduous trees. Nests are built from dried vegetation, feathers, strings, and paper. Eggs are layed at any time in the nesting period. One to eight eggs can be present in a clutch, with the possiblity of four clutches per nesting season. Incubation begins after all the eggs have been layed. Both males and females incubate the eggs for short periods of a few minutes each. Incubation lasts for 10 to 14 days. After the eggs are hatched, both males and females feed the young through regurgitation.

Breeding season: February through August in North America

Range eggs per season: 1.0 to 8.0.

Average eggs per season: 5.0.

Range time to hatching: 11.0 (high) days.

Average fledging age: 14.0 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); oviparous

Average eggs per season: 5.

Both males and females incubate eggs and brood young until they have fledged. Both parents also provide their young with food.

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In North America, breeding begins earlier in the south than in the north. Clutch size generally averages near 4 in the southern U.S., near 5 in the northern U.S. and southern Canada. In the northern U.S., most females produce 2-3 broods per year; generally clutch initiation occurs about 4-7 days after fledging of a brood, though quicker renesting sometimes occurs. Incubation averages 12 days, mostly by female. Young are tended by both parents, leave nest at an average age of 14-17 days. In various areas of North America, hatching success was 50-83%, fledging success was 53-78%, and nesting success was 31-71% (see Anderson 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Nests are parasite-free: house sparrow
 

The nests of house sparrows are kept free of parasitic insects by a lining of leaves from the neem tree, containing insect-repelling compounds.

   
  "During an outbreak of malaria in Calcutta during 1998, Dr. Dushim Sengupta and fellow scientists at Calcutta's Center for Nature Conservation and Human Survival were surprised to witness house sparrows lining their nests with (and also eating) leaves from the paradise flower tree (Caesalpina pulcherrima), a species whose leaves are rich in the anti-malarial drug quinine. Confirming that their choice of leaves was deliberate, the sparrows swiftly gathered fresh leaves of this same species when the scientists removed those already lining their nests. Moreover, before the malaria outbreak, these birds has been using leaves from the neem tree (Azadirachta indica) for nest lining. These contain high concentrations of insect-repellent compounds, which are of great benefit to birds rearing nestlings, who are vulnerable to diseases spread by insects and to nest-dwelling parasitic insects." (Shuker 2001:216-218)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Self-medicating to prevent malaria: house sparrows
 

House sparrows protect themselves from malaria by lining their nests with and eating quinine-containing leaves from the paradise flower tree.

   
  "During an outbreak of malaria in Calcutta during 1998, Dr. Dushim Sengupta and fellow scientists at Calcutta's Center for Nature Conservation and Human Survival were surprised to witness house sparrows lining their nests with (and also eating) leaves from the paradise flower tree (Caesalpina pulcherrima), a species whose leaves are rich in the anti-malarial drug quinine. Confirming that their choice of leaves was deliberate, the sparrows swiftly gathered fresh leaves of this same species when the scientists removed those already lining their nests." (Shuker 2001:216-217)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Passer domesticus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 32 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTCTCCAACCCACAAAGACATTGGCACCCTGTACCTAATTTTTGGCGCATGAGCCGGGATAGTAGGTACCGCCCTAAGCTTACTTATCCGAGCAGAACTTGGACAACCAGGGGCTCTCCTAGGAGATGACCAAGTTTACAACGTAGTTGTCACAGCCCATGCTTTCGTGATAATCTTCTTCATAGTTATGCCAATTATAATTGGGGGATTCGGAAACTGACTAGTCCCACTGATAATTGGAGCACCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTGCTACCCCCATCCTTCCTCCTGCTACTAGCATCCTCCACCGTAGAAGCGGGGGCCGGCACCGGATGAACAGTATACCCCCCTCTAGCCGGCAACCTGGCCCACGCCGGAGCCTCAGTAGACCTAGCAATCTTCTCCCTGCACTTAGCAGGTATTTCTTCAATCTTAGGGGCAATCAACTTTATTACAACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACACCCCTATTCGTCTGATCAGTACTAATCACCGCAGTGCTACTGCTCCTATCGCTACCAGTTCTTGCTGCAGGAATTACAATGCTACTCACCGACCGCAACCTCAACACCACATTCTTCGACCCCGCAGGAGGAGGAGATCCAGTCCTATACCAACATCTTTTCTGATTCTTCGGCCATCCAGAAGTCTACATCCTAAATCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Passer domesticus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 33
Specimens with Barcodes: 59
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

When first introduced into the United States in 1851, house sparrows were protected from predators and fed. However, populations expanded enormously in North America and they were soon considered a nuisance species. Since the 1960's, with the changes in farming to larger, single crop farms, populations have declined. They are not, however, seen as threatened and are not included in most Canadian and U.S. regulations.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

When first introduced into the United States in 1851, house sparrows were protected from predators and fed. However, populations expanded enormously in North America and they were soon considered a nuisance species. Since the 1960's, with the changes in farming to larger, single crop farms, populations have declined. They are not, however, seen as threatened and are not included in most Canadian and U.S. regulations.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident breeder.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Included in the Birds of Conservation Concern Red List (high conservation concern) (9). The house sparrow has undergone a drastic decline in the last 25 years; this is cause for conservation concern (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Suggested reasons for the decline of house sparrows include predation by domestic cats, changes in agricultural practices including the loss of seeds in winter and autumn, stricter rules concerning seed storage, (resulting in sealing of buildings) diseases spread at garden feeding stations, pollution (7), and loss of invertebrates to feed chicks in urban areas (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: Monofilament lines can be used to repel house sparrows from feeding sites (Aguero et al. 1991). Monofilament lines may delay initial acceptance of nest boxes, or inhibit their use somewhat, but do not affect breeding success of birds using boxes with monofilament lines (Pochop et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The decline in numbers of the house sparrow is of such great concern, that this bird has been 'upgraded' to the Birds of Conservation Concern Red List. The British Trust for Ornithology (BTO) is currently running a house sparrow appeal, in order to raise funds to carry out research and monitoring of the species in order to understand the pattern of decline (8). House sparrow numbers have more than halved over the past 25 years. To help find out why, the RSPB asked for volunteers across the country to take part in a survey of house sparrows. The survey, which ran from the 3-11 May 2003, saw a quarter of a million participants and just over 1 million house sparrows seen. A UK city league table for house sparrows was produced from the results collected. Lincoln came top with an average of 9.41 sparrows seen per home. London came last with an average of only 4.53 sparrows per home (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Because of their preference for human-modified habitats, house sparrows are considered a nuisance species, an aggressive competitor with native birds, and an agricultural pest. Large aggregations around buildings produce annoying noise and large quantities of feces.

Negative Impacts: crop pest; household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

House sparrows are well-suited for studies of general biological problems, such as the way animals evolve and pest control.

Positive Impacts: research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Because of their preference for human-modified habitats, house sparrows are considered a nuisance species, an aggressive competitor with native birds, and an agricultural pest. Large aggregations around buildings produce annoying noise and large quantities of feces.

Negative Impacts: crop pest; household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

House sparrows are well-suited for studies of general biological problems, such as the way animals evolve and pest control.

Positive Impacts: research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

House Sparrow

House Sparrow

Animalia

The House Sparrow (Passer domesticus) is a species of passerine bird of the sparrow family Passeridae. It occurs naturally in most of Europe, the Mediterranean region, and much of Asia. It has also been intentionally or accidentally introduced to many parts of the world, making it the most widely distributed wild bird. It is strongly associated with human habitations, but it is not the only sparrow species found near houses. It is a small bird, with feathers mostly different shades of brown and grey.

Contents

Description

The House Sparrow is a chunky bird,[2] typically about 16 centimetres (6.3 in) long, ranging from 14–18 centimetres (5.5–7.1 in).[3] It has a large rounded head, a short tail, and a stout bill.[2] In weight, the House Sparrow generally ranges from 24–39.5 grams (0.85–1.39 oz).[4] Weight varies by sex, with females usually smaller than males.[4] Younger birds are smaller, males are larger during the winter, and females larger during the breeding season.[5] Between and within subspecies, there is further variation based on latitude, altitude, climate, and other environmental factors, under biological rules such as Bergmann's rule.[5][6][7][8]

The plumage of the House Sparrow is mostly different shades of grey and brown. The sexes differ, with females and juveniles mostly buff, and the male marked with bold colours.[7] The male is duller in fresh non-breeding plumage, with buff tips on many feathers. Wear and preening expose bright markings of brown and black, including a throat and chest patch, called a "bib" or a "badge".[9] This patch is variable in width and general size, and some scientists have suggested that patches signal social status or fitness, a hypothesis which has led to a "veritable 'cottage industry'" of studies, which have only conclusively shown that patches increase in size with age.[10] In breeding plumage, the male's crown is grey, and it is marked with black on its throat and beneath its crown. The cheeks and underparts are pale grey. The mantle and upper back are a warm brown, broadly streaked with black, while the lower back, rump and uppertail coverts are a greyish-brown.[11] The female has no black on head or throat, nor a grey crown and its upperparts are streaked with brown.[12] The juvenile is deeper brown, and the white is replaced by buff; the beak is pink to dull yellow.[12]

There is some variation in the twelve subspecies of House Sparrow. The subspecies are divided into two groups, the Oriental indicus group, and the Palaearctic domesticus group. Birds of the domesticus group have grey cheeks, while indicus group birds have white cheeks, as well as bright colouration on the crown, a smaller bill, and a longer black bib.[13] The subspecies Passer domesticus tingitanus differs little from the nominate subspecies, except in the worn breeding plumage of the male, in which the head is speckled with black and underparts are paler.[14] P. d. balearoibericus is slightly paler than the nominate but darker than P. d. bibilicus.[15] P. d. bibilicus is paler than most subspecies, but has the grey cheeks of domesticus group birds. The similar P. d. persicus is paler and smaller, and P. d. niloticus is nearly identical but smaller.[14] Of the less wide ranging indicus group subspecies, P. d. hyrcanus is larger than P. d. indicus, P. d. bactrianus is larger and paler, P. d. parkini is larger and darker with more black on the breast than any other subspecies, and P. d. hufufae is paler.[14][16][17]

The House Sparrow can be confused with a number of other seed-eating birds, especially its relatives in the genus Passer. Many of these relatives are smaller, with an appearance that is neater or "cuter", as with the Dead Sea Sparrow.[18] The dull-coloured female often can not be distinguished from other birds, and it is nearly identical to the females of the Spanish Sparrow and Italian Sparrow.[11] The Eurasian Tree Sparrow is smaller and more slender with a chestnut crown and a black patch on each cheek.[19] The male Spanish Sparrow and Italian Sparrow are distinguished by their chestnut crowns. The Sind Sparrow is smaller, with the male less black on the throat and the female usually having a distinct pale supercilium.[11]

Voice

One sparrow then another.ogg
Male calling in San Francisco

All of the House Sparrow's vocalisations are variations on its short and incessant chirping call. Transcribed as chirrup, tschilp, or philip, this note is made as a contact call by flocking or resting birds, or by males to proclaim nest ownership and invite pairing.[20] In the breeding season this call becomes what is called an "ecstatic call", which is similar to a song, as it is uttered by the male at great speed.[20] Young birds, especially in captivity, also give a true song, a warbling similar to that of the European Greenfinch.[21] Aggressive male House Sparrows give a trilled version of their call, transcribed as "chur-chur-r-r-it-it-it-it". This call is also used by females in the breeding season, to establish dominance over males while displacing them to feed young or incubate eggs.[22] The House Sparrow gives a nasal alarm call, the basic sound of which is transcribed as quer, and it gives a shrill "chree" call in great distress.[23] Another House Sparrow vocalisation is what has been described as an "appeasement call", a soft quee given to inhibit aggression, usually by a mated pair.[22] These vocalisations are not unique to the House Sparrow, but are shared with small variations by all sparrows.[24]

Taxonomy

The House Sparrow is part of the sparrow genus Passer, which contains about 20 species, depending on the authority.[25] Most species in the genus are between 11 and 16 cm (4–6 in) long, dull-coloured birds with short square tails and stubby conical beaks.[7][26] Mitochondrial DNA suggest that speciation in Passer occurred during the Pleistocene and earlier, while other evidence suggests speciation occurred 25,000 to 15,000 years ago.[27] Within Passer, the House Sparrow is part of the "Palearctic black-bibbed sparrows" group and a close relative of the Mediterranean "willow sparrows".[28][29]

The taxonomy of the House Sparrow and its Mediterranean relatives is highly complicated. The common type of "willow sparrow" is the Spanish Sparrow, which resembles the House Sparrow in many respects.[30] It frequently prefers wetter habitats than the House Sparrow, and it is often colonial and nomadic.[31] In most of the Mediterranean, one or both species occur, with some degree of hybridisation.[32] In North Africa, the two species hybridise extensively, forming highly variable mixed populations with a full range of characters from pure House Sparrows to pure Spanish Sparrows and everything between.[33][34][35]

In much of Italy there is a type of sparrow apparently intermediate between the House and Spanish sparrows, known as the Italian Sparrow. It resembles a hybrid between the two species, and is in other respects intermediate. Its specific status and origin are the subject of much debate.[34][36] In the Alps, the Italian Sparrow intergrades over a roughly 20 km (12 mi) strip with the House Sparrow,[37] but to the south it intergrades over the southern half of Italy and some Mediterranean islands with the Spanish Sparrow.[34] On the Mediterranean islands of Malta, Gozo, Crete, Rhodes, and Karpathos, there are other apparently intermediate birds of unknown status.[34][38][39]

The bird's usual English and scientific names have the same meaning. The Latin word passer, like the English word "sparrow", is a term for small active birds, coming from a root word referring to speed.[40][41] The Latin word domesticus means "belonging to the house", like the common name a reference to its association with humans.[42] The House Sparrow was scientifically described by Carl Linnaeus in the 1758 edition of his Systema Naturae, as Fringilla domestica.[43] Later the name Fringilla came to be used only for the Chaffinch and its relatives, and House Sparrow as placed in the genus Passer created by French zoologist Mathurin Jacques Brisson in 1760.[44][45] The House Sparrow is called by a number of other names, including English Sparrow, chiefly in North America;[46][47] and Indian Sparrow or Indian House Sparrow, for the birds of the Indian subcontinent and Central Asia.[48] Dialectal names include sparr, sparrer, spadger, spadgick, and philip, mainly in southern England; spug and spuggy, mainly in northern England; spur and sprig, mainly in Scotland;[49][50] and spatzie or spotsie in North America.[51]

Subspecies

A male of the subspecies indicus

A large number of subspecies have been named, of which twelve were recognised in the Handbook of the Birds of the World.[25] These subspecies are divided into two groups, the Palearctic domesticus group, and the Oriental indicus group.[25] Several Middle Eastern subspecies, including Passer domesticus biblicus, are sometimes considered a third group. The subspecies P. d. indicus was described as a species, and considered one by many ornithologists during the nineteenth century.[13] Migratory birds of the subspecies P. d. bactrianus in the indicus group were recorded overlapping with the P. d. domesticus without hybridising in the 1970s, so the Soviet scientists Edward I. Gavrilov and M. N. Korelov proposed indicus to be a separate species.[44][52] This split is rarely recognised, since indicus group and domesticus group birds intergrade in a large part of Iran.[25]

  • domesticus group
    • P. d. domesticus, the nominate subspecies described by Linnaeus from Sweden, is the found in most of Europe, across northern Asia to Sakhalin and Kamchatka. It is the subspecies most widely introduced worldwide.[53]
    • P. d. balearoibericus, von Jordans, 1923, described from a specimen collected at Majorca, is found in the Balearic Islands, southern France, the Balkans, and Anatolia.[25]
    • P. d. tingitanus, (Loche, 1867), described from a specimen from Algeria, is found in the Maghreb from Ajdabiya in Libya to Béni Abbès in Algeria, and to Morocco's Atlantic coast. It hybridises extensively with the Spanish Sparrow, especially in the eastern part of its range.[54]
    • P. d. niloticus, Nicoll and Bonhote, 1909, described from Faiyum, Egypt, is found along the Nile north of Wadi Halfa. It intergrades with bibilicus in the Sinai, and with rufidorsalis in a narrow zone, around Wadi Halfa. It has been recorded in Somaliland.[54][55]
    • P. d. persicus, Zarudny and Kudashev, 1916, described from the Karun River in Khūzestān, Iran, is found in the western half of Iran to the south of the Elburz mountains, gradually integrading with indicus across central Iran.[54]
    • P. d. biblicus, Hartert, 1910, described from Palestine, is found in the Middle East from the Bosphorus to the Sinai in the west and from Azerbaijan to Kuwait in the east.[54]
  • indicus group
    • P. d. hyrcanus, Zarudny and Kudashev, 1916, described from Gorgan, Iran, is found along the southern coast of the Caspian Sea from the Iranian-Azerbaijani border to Gurgan. It integrades with persicus in the Elburz mountains, and with bibilicus to the west. It is the subspecies with the smallest range.[54]
    • P. d. bactrianus, Zarudny and Kudashev, 1916, described from Tashkent, is found in Turkestan and northern Afghanistan. It intergrades with persicus in Baluchistan and with indicus across central Afghanistan. Unlike most other House Sparrow subspecies, it is almost entirely migratory, wintering in the plains of the northern Indian subcontinent. It is found in open country rather than in settlements, which in its range are occupied by the Tree Sparrow.[54] There is an exceptional record from Sudan.[55]
    • P. d. parkini, Whistler, 1920, described from Srinagar, Kashmir, is found in the western Himalayas from the Pamir Mountains to southeastern Nepal. It is migratory, like bactrianus.[13][54]
    • P. d. indicus, Jardine and Selby, 1831, described from Bangalore, is found in the Indian subcontinent south of the Himalayas, in Sri Lanka, eastern Iran, southwestern Arabia and western Southeast Asia.[13][54]
    • P. d. hufufae, Ticehurst and Cheeseman, 1924, described from the town of Al-Hofuf in Saudi Arabia, is found in northeastern Arabia.[54][56]
    • P. d. rufidorsalis, Brehm, 1855, described from Khartoum in Sudan, is found in the Nile valley from Wadi Halfa south to Renk in Sudan.[54][55] It has also been introduced to Mohéli in the Comoros.[57]

In North America and Hawaii, House Sparrow populations are more differentiated than those in Europe.[6] This variation follows predictable patterns, with birds at higher latitudes being larger and those in arid areas being paler.[7][58][59] However, it is not clear how much this is caused by evolution or by environment.[60][61][62][63] Similar observations have been made in New Zealand,[64] and in South Africa.[65] Introduced House Sparrow populations may be distinct enough to merit subspecies status,[25] and American ornithologist Harry Church Oberholser even gave the subspecies name plecticus to the paler birds of western North America in his 1974 Bird Life of Texas.[58]

Distribution and habitat

Passer domesticus - gathering at fluorescent tube.ogg
House Sparrows flocking and chirping together in Germany

The House Sparrow originated in the Middle East and spread, along with agriculture, to most of Eurasia, and parts of North Africa.[66] Since the mid-nineteenth century, it has spread throughout much of the world, mostly due to deliberate introductions but also through natural dispersal and shipborne travel.[67] The House Sparrow has also greatly extended its range in northern Eurasia since the 1850s,[68] and continues to do so, as is shown by the colonisations, both around 1990, of Iceland and Rishiri Island.[69]

Its introduced range encompasses most of North America, Central America, southern South America, southern Africa, part of West Africa, Australia, New Zealand, and islands throughout the world, making it the most widely distributed wild bird on the planet.[70] The House Sparrow has become highly successful in most parts of the world where it has been introduced. This is mostly due to its early adaptation to living with humans, and its adaptability to a wide range of conditions.[71][72] Other factors may include its robust immune response.[73] When introduced, the House Sparrow spreads quickly, sometimes at the rate of over 140 miles per year.[74] In many parts of the world it has become a pest, and a threat to many native bird species.[75][76] A few introductions have died out or been of limited success, such as those to Greenland and Cape Verde.[77]

The first of many successful introductions to North America occurred when fifty pairs from England were released in Brooklyn, New York, in 1852.[78][79] It now occurs from Northwest Territories to Darién Province,[2] and it is one of the most abundant birds in North America.[75] The House Sparrow was first introduced to Australia in 1863 at Melbourne and is a common pest throughout eastern Australia,[77] but has been prevented from establishing itself in Western Australia, where every House Sparrow found in the state is killed.[80] House Sparrows were introduced in New Zealand in 1859, and from there reached many of the Pacific islands, including Hawaii.[81] In southern Africa birds of both the European subspecies domesticus and the Indian subspecies indicus were introduced around 1900. Birds of domesticus ancestry are confined to a few towns, while indicus birds have spread rapidly, reaching Tanzania in the 1980s. Despite this success, native relatives such as the Cape Sparrow also occur in towns, competing successfully with it.[77][82] In South America, it was first introduced near Buenos Aires around 1870, and quickly became common in most of the southern part of the continent. It now occurs almost continuously from Tierra del Fuego to the fringes of Amazonia, with isolated populations as far north as coastal Venezuela.[77][83][84]

The House Sparrow is closely associated with human habitations and cultivation.[85] It is not the obligate commensal of humans some have suggested it is, as Central Asian birds usually breed away from humans in open country,[86] and birds elsewhere are found away from humans.[85][87][88] The only habitats in which the House Sparrow is not found are dense forest and tundra. It is, however, well adapted to living around humans. It frequently lives and even breeds indoors, especially in factories, warehouses, and zoos.[85] It has been recorded breeding in a coal mine 640 m (2,100 ft) below ground,[89] and feeding on the Empire State Building's observation deck at night.[90] It reaches its greatest densities in urban centers, but its reproductive success is greater in suburbs, where insects are more abundant.[85][91] On a larger scale, it is most abundant in wheat-growing areas such as the Midwestern United States.[92] In most of eastern Asia the House Sparrow is entirely absent, replaced by the Eurasian Tree Sparrow.[93] Where these two species overlap, the House Sparrow is usually more common than the Eurasian Tree Sparrow, but one species may replace the other in a manner that Maud Doria Haviland described as "random, or even capricious".[94] It tolerates a variety of climates, but prefers drier conditions, especially in moist tropical climates.[77][85] It has a number of adaptations to dry areas, including a high salt tolerance[95] and an ability to survive without water by ingesting berries.[96] In most of its range the House Sparrow is extremely common, despite some declines,[1] but in marginal habitats such as rainforest or mountain ranges, its distribution can be spotty.[85]

Behaviour

House Sparrow dust bath.ogv
The House Sparrow often bathes in water (at left) or in dust (at right)

The House Sparrow is a very social bird. It is gregarious at all seasons when feeding, often forming flocks with other types of bird.[97] It also roosts communally, its nests are usually grouped together in clumps, and it engages in a number of social activities, such as dust and water bathing, and "social singing", in which birds call together in bushes.[98][99] The House Sparrow feeds mostly on the ground, but it flocks in trees and bushes.[98] For the larger part it is sedentary, rarely moving more than a few kilometres.[100] There is limited migration in sedentary populations, with mountain birds moving to lower altitudes and some young birds dispersing long distances, especially on coasts.[98][101] In addition, two subspecies, bactrianus and parkini, are predominately migratory and unlike the birds in sedentary populations that migrate, prepare for migration by putting on weight.[98] Non-breeding House Sparrows roost in large groups in trees, gathering some time before and calling together.[98] At feeding stations and at the nest, the female House Sparrows are dominant, despite their smaller size.[102][103]

Feeding

Passer domesticus female - foraging plants.ogg
Female foraging in Germany

As an adult, the House Sparrow mostly feeds on the seeds of cereals and weeds, but it is opportunistic and adaptable, and eats whatever foods are available.[104] It can perform complex and unusual tasks to obtain food, such as opening automatic doors to enter supermarkets,[105] clinging to hotel walls to watch vacationers on their balconies,[106] and nectar robbing kowhai flowers.[107] In common with many other birds, the House Sparrow requires grit to digest the hard seeds in its diet. Grit can be either stone, often grains of masonry, or the shells of eggs or snails; oblong and rough grains are preferred.[108][109]

Several studies of the House Sparrow in temperate agricultural areas have found the proportion of seeds in its diet to be about 90 percent.[104][110][111] It will eat almost any seeds, but where it has a choice, it prefers oats and wheat.[112] In urban areas, the House Sparrow feeds largely on food provided directly or indirectly by humans, such as bread, though it prefers raw seeds.[111][113] The House Sparrow also eats berries and fruits, and it can survive without water in arid areas by ingesting moisture from berries.[96] In temperate areas, the House Sparrow has an unusual habit of tearing flowers, especially yellow ones, in the spring.[114]

Animals form another important part of the House Sparrow's diet, chiefly insects, of which beetles, caterpillars, dipteran flies, and aphids are especially important. Various non-insect arthropods are eaten, as are molluscs and crustaceans where available, earthworms, and even vertebrates such as lizards and frogs.[104] Nestling House Sparrows are fed mostly on insects until about fifteen days after hatching.[115] They are also given small quantities of seeds, spiders, and grit. In most places, grasshoppers and crickets are most the abundant foods of nestlings.[116] True bugs, ants, sawflies, and beetles are also important, but House Sparrows will take advantage of whatever food is most abundant to feed their nestlings.[116][117][118]

Breeding

A pair of the subspecies indicus mating in Kolkata

The House Sparrow can breed in the breeding season immediately following its hatching, and sometimes attempts to do so. Some birds breeding for the first time in tropical areas are only a few months old, and retain juvenile plumage.[119] Birds breeding for the first time are rarely successful in raising young, and reproductive success increases with age, as older birds breed earlier in the breeding season, and fledge more young.[120] The timing of the House Sparrow's breeding season is varied, depending mostly on the availability of insects.[121]

The House Sparrow is monogamous, and typically mates for life. Birds from pairs often engage in extra-pair copulations, with about 15 percent of House Sparrow fledgelings being unrelated to their mother's mate.[122] Bigamy occurs, and is mostly limited by aggression between females.[123] Male House Sparrows guard their mates carefully before breeding to avoid being cuckolded.[124] Many birds do not find a nest and a mate, and instead may serve as helpers for mated pairs, a role which increases the chances of being chosen to replace a lost mate. Lost mates of both sexes can be quickly replaced during the breeding season.[125][126] The formation of a pair and the bond between the two birds is related to the holding of a nest site, though birds of a pair can recognise each other away from the nest.[121] Before the breeding season, unmated males take up a nesting site and call incessantly to attract females. When a female approaches a displaying male, the male displays by drooping and shivering his wings, pushing up his head, raising and spreading his tail, and displaying his black bib.[121] The male then tries to mate with the female, who adopts a threatening posture and attacks him before flying away. The male then flies after the female and displays in front of her, attracting other males, who also display to her.[121] These other males usually do not mate with the female, though this has been recorded once.[127] When the female is ready to copulate, she solicits to the male by giving a soft dee-dee-dee call. Pairs copulate frequently and the male mounts the female repeatedly.[121]

Female bringing food for young in a nest made in a tree hole in California

The House Sparrow's nesting sites are varied, but it prefers the shelter of a hole. Nests are most frequently built in the eaves and other crevices of houses. Holes in cliffs and banks, or in tree cavities are also used.[128][129] It sometimes excavates its own nests in sandy banks or rotten branches, but it more frequently uses the nests of other birds: those of swallows in banks and cliffs, and old woodpecker cavity nests.[128] It usually uses unused nests, though it sometimes usurps actively used nests.[128][130] The House Sparrow nests more commonly in tree holes in North America than in Europe,[128] and as such it competes with bluebirds and other North American cavity nesters, contributing to their declines in population.[75] Especially in warmer areas, the House Sparrow also builds its nests in the open, on the branches of trees, especially evergreens and hawthorns; or in the nests of large birds such as storks or magpies.[121][128][131] In open nesting sites, breeding success tends to be lower, since breeding begins late and the nest can easily be destroyed or damaged by storms.[128][132] Less common nesting sites used by the House Sparrow include streetlights and neon signs, favoured due to their warmth; and the old open-topped nests of other songbirds, which are domed over.[128][129]

The nest is usually domed, though it sometimes is not roofed over in enclosed sites.[128] It has an outer layer of stems and roots, a middle layer of dead grass and leaves, and a lining of feathers, as well as paper and other soft materials.[129] Nest typically have external dimensions of 20 × 30 cm,[121] but their size varies greatly.[129] The building of the nest is initiated by the unmated male, who begins construction while displaying to females. The female assists in building, but is less active than the male. Some nest building occurs throughout the year, especially after moult in autumn.[128] In colder areas House Sparrows build specially created roost nests, or roost in streetlights, to avoid losing heat during the winter.[128][133] The House Sparrow does not keep territories, but it defends its nest aggressively against intruders of the same sex.[128]

The House Sparrow's nests support a wide range of scavenging insects, including nest flies such as Neottiophilum praestum, and the species of Protocalliphora,[134] and over 1,400 species of beetle.[135]

Eggs in a nest

Clutches usually contain four or five eggs, though clutches with only one egg or with as many as ten eggs have been recorded.[136] Clutch size is larger at poleward latitudes and smaller near the sea and on islands. Central Asian House Sparrows, which migrate and have only one clutch a year, have an average of 6.53 eggs in a year. Variation in clutch size is caused by environmental and seasonal conditions, female age, breeding density, but is probably not hereditary.[137] Some intraspecific brood parasitism occurs, and instances of unusually large numbers of eggs in a nest may be the result of females laying eggs in the nests of their neighbours. Such foreign eggs are sometimes recognised and ejected by females.[136][138] The House Sparrow is a victim of interspecific brood parasites, but only rarely, since it usually uses nests in holes too small for parasites to enter, and it feeds its young foods unsuitable for young parasites.[139][140] The House Sparrow has been recorded as a brood parasite of the Cliff Swallow once.[138][141]

A female feeding a chick

The eggs are white, bluish-white or greenish-white, spotted with brown or grey.[2] Subelliptical in shape,[7] they range from 20–22 millimetres (0.79–0.87 in) in length and 14–16 millimetres (0.55–0.63 in) in width,[2] and have an average mass of 2.9 grams (0.10 oz),[142] and an average surface area of 9.18 square centimetres (1.423 sq in).[143] Eggs from the tropical subspecies are distinctly smaller.[144][145] Eggs begin to develop with the deposition of yolk in the ovary a few days before ovulation. In the day between ovulation and laying, egg white forms, followed by eggshell.[146] Eggs laid later in a clutch are larger, as are those laid by larger females, and egg size is hereditary. Eggs decrease slightly in size from laying to hatching.[147] The yolk comprises 25 percent of the egg, the egg white 68 percent, and the shell 7 percent. Eggs are watery, being 79 percent liquid, and otherwise mostly protein.[148]

The female develops a brood patch of bare skin and plays the main part in incubating the eggs. The male helps, but he can only cover the eggs rather than truly incubating them. The female spends the night incubating during this period, while the male roosts near the nest.[136] Eggs hatch at the same time, after a short incubation period lasting 11–14 days, and exceptionally for as many as 17 or as few as 9.[7][121][149]

Survival

A male being eaten by a cat, one of the primary predators of the House Sparrow

The House Sparrow's main predators are cats and birds of prey, but many other predators feed on the House Sparrow, including corvids, smaller squirrels,[150] and even humans, as the House Sparrow has been consumed by humans in many parts of the world, and still is in parts of the Mediterranean.[151] Most species of bird of prey have been recorded preying on the House Sparrow in places where there are extensive records. Accipiters and the Merlin in particular are major predators, though cats likely make a greater impact on House Sparrow populations.[150] The House Sparrow is also a common victim of roadkill; on European roads, it is the species most frequently found dead.[152]

The House Sparrow is host to a huge number of parasites and diseases, and the effect of most is unknown. Ted R. Anderson listed thousands, noting that his list was incomplete.[153] Many of the diseases hosted by the House Sparrow are also present in humans and their domestic animals, for which the House Sparrow acts as a reservoir host.[154] Arboviruses such as the West Nile virus, which most commonly infect insects and mammals, survive winters in temperate areas by going dormant in birds such as the House Sparrow.[153][155] The commonly recorded bacterial pathogens of the House Sparrow are often those common in humans, and they include Salmonella and Escherichia coli.[156] Salmonella is common in the House Sparrow, and a comprehensive study of House Sparrow disease found it in 12.9 percent of sparrows tested. Salmonella epidemics in the spring and winter can kill large numbers of sparrows.[153] The House Sparrow hosts avian pox and avian malaria, which it has spread to the native forest birds of Hawaii.[157] There are a few records of disease extirpating House Sparrow populations, especially from Scottish islands, but this seems to be rare.[158]

The House Sparrow is infested by a number of external parasites, which usually cause little harm to adult sparrows. In Europe, the most common mite found on sparrows is Proctophyllodes, the most common ticks are Argas reflexus and Ixodes arboricola, and the most common flea on the House Sparrow is Ceratophyllus gallinae. A number of chewing lice occupy different niches on the House Sparrow's body. Menacanthus lice occur across the House Sparrow's body, where they feed on blood and feathers, while Brueelia lice feed on feathers and Philopterus fringillae occurs on the head.[134]

In the adult House Sparrow, annual survival is between 45 and 65 percent.[159] After fledgeing and leaving the care of its parents, the young House Sparrow has a high mortality rate, which lessens as it grows older and more experienced. Only about 20 to 25 percent of birds hatched survive to their first breeding season.[160] The oldest known wild House Sparrow lived for nearly two decades; it was found dead 19 years and 9 months after it was ringed in Denmark.[161] The oldest recorded captive sparrow lived for twenty-three years.[162] The typical ratio of males to females is uncertain due to problems in collecting data, but a very slight preponderance of males at all ages seems to be the usual situation.[163]

Relationships with humans

A female in Australia

The House Sparrow is closely associated with humans. Usually, it is regarded as a pest, since it consumes agricultural products and spreads disease to humans and their domestic animals.[164] Even birdwatchers often hold it in little regard because of its molestation of other birds.[75] In most of the world the House Sparrow is not protected by law. Attempts to control House Sparrows include the trapping, poisoning, or shooting of adults; the destruction of their nests and eggs; or less directly, blocking nest holes and scaring off sparrows with noise, glue, or porcupine wire.[165]

The House Sparrow has an extremely large range and population, and is not seriously threatened by human activities, so it is assessed as Least Concern on the IUCN Red List.[1] However, populations are declining in many parts of the world.[166][167][168] These declines were first noticed in the United States, where they were initially attributed to the spread of the House Finch, but have been most severe in Western Europe.[169][170] Declines have not been universal, as no serious declines have been reported from Eastern Europe, but they have occurred in Australia, where the House Sparrow is a recently introduced species.[171] In the Netherlands, the House Sparrow is even considered an endangered species,[172] and the population has dropped by half since the 1980s.[91] In Britain, populations peaked in the early 1970s,[173] but have since declined by 68 percent overall,[174] and over 90 percent in urban areas.[175] In London, the House Sparrow almost disappeared from the central city.[175] These declines are not unprecedented, as similar reductions in population occurred when the internal combustion engine replaced the horse in the 1920s and a major source of food in the form of spillage was lost.[176][177]

Various causes for the dramatic decreases in population have been proposed, including predation,[178] electromagnetic radiation from mobile phones,[179] and diseases.[180] A shortage of nesting sites is probably a factor, and conservation organisations have encouraged the use of special nest boxes for sparrows.[180][181][182][183] The main cause of the decline seems to be nestling starvation due to an insufficient supply of insect food.[180][184] The decline in the insect population is caused by an increase of monoculture crops, the heavy use of pesticides,[185][186][187] the replacement of native plants in cities with introduced plants and parking areas,[188][189] and possibly the introduction of unleaded petroleum, which produces toxic compounds such as methyl nitrite.[190] Protecting insect habitats on farms,[191] and planting native plants in cities benefit the House Sparrow, as does establishing urban green spaces.[192][193]

To many people across the world, the House Sparrow is the most familiar wild animal and, because of this familiarity, it is frequently used to represent the common and vulgar, or the lewd.[194] One of the reasons for the introduction of House Sparrows throughout the world was their association with the European homeland of many immigrants.[79] Sparrows are referred to in religious texts, and in ancient literature, most notably in the New Testament and in Catullus's poems about Lesbia. These references may not specifically refer to the House Sparrow, or even to small, seed-eating birds, but later writers who were inspired by these texts often had the House Sparrow in mind.[194][195]

The House Sparrow is only represented in ancient Egyptian art very rarely, but an Egyptian hieroglyph is based on it, the sparrow hieroglyph:
G37
The symbol had no phonetic value and was used as a determinative in words to indicate small, narrow or bad.[196]

References

  1. ^ a b c BirdLife International (2008). "Passer domesticus". IUCN Red List of Threatened Species. Version 2008. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/149100. Retrieved 15 December 2008. 
  2. ^ a b c d e "House Sparrow". All About Birds. Cornell Lab of Ornithology. Archived from the original on 8 December 2010. http://www.webcitation.org/5upHx7vY8. 
  3. ^ Summers-Smith 1988, pp. 116–117
  4. ^ a b Clement, Harris & Davis 1993, p. 446
  5. ^ a b Summers-Smith 1988, pp. 118–121
  6. ^ a b Johnston, Richard F.; Selander, Robert K (May–June 1973). "Evolution in the House Sparrow. III. Variation in Size and Sexual Dimorphism in Europe and North and South America". The American Naturalist 107 (955): 373–390. doi:10.1086/282841. http://www.jstor.org/stable/2459538. 
  7. ^ a b c d e f Groschupf, Kathleen (2001). "Old World Sparrows". In Elphick, Chris; Dunning, Jr., John B.; Sibley, David. The Sibley Guide to Bird Life and Behaviour. London: Christopher Helm. pp. 562–564. ISBN 0-7136-6250-6. 
  8. ^ Felemban, Hassan M. (1997). "Morphological differences among populations of House Sparrows from different altitudes in Saudi Arabia" (PDF). The Wilson Bulletin 109 (3): 539–544. http://elibrary.unm.edu/sora/Wilson/v109n03/p0539-p0544.pdf. 
  9. ^ Anderson 2006, pp. 202–203
  10. ^ Anderson 2006, pp. 224–225, 244–245
  11. ^ a b c Clement, Harris & Davis 1993, p. 444
  12. ^ a b Clement, Harris & Davis 1993, p. 443
  13. ^ a b c d Vaurie, Charles; Koelz, Walter. "Notes on some Ploceidae from western Asia". American Museum Novitates (1406). http://digitallibrary.amnh.org/dspace/handle/2246/2345. 
  14. ^ a b c Summers-Smith 1988, p. 117
  15. ^ Snow & Perrins 1998, pp. 1061–1064
  16. ^ Clement, Harris & Davis 1993, p. 445
  17. ^ Roberts 1992, pp. 472–477
  18. ^ Mullarney et al. 1999, pp. 342–343
  19. ^ Clement, Harris & Davis 1993, p. 463–465
  20. ^ a b Summers-Smith 1963, pp. 26–30
  21. ^ Summers-Smith 1963, p. 101
  22. ^ a b Summers-Smith 1963, pp. 30–31
  23. ^ Summers-Smith 1963, pp. 31–32
  24. ^ Summers-Smith 1988, p. 254
  25. ^ a b c d e f Summers-Smith, J. Denis (2009). "Family Passeridae (Old World Sparrows)". In del Hoyo, Josep; Elliott, Andrew; Christie, David. Handbook of the Birds of the World. Volume 14: Bush-shrikes to Old World Sparrows. Barcelona: Lynx Edicions. ISBN 978-84-96553-50-7. 
  26. ^ Summers-Smith 1988, pp. 253–254
  27. ^ Allende, Luis M.; Rubio, Isabel; Ruíz-del-Valle, Valentin; Guillén, Jesus; Martínez-Laso, Jorge; Lowy, Ernesto; Varela, Pilar; Zamora, Jorge; Arnaiz-Villena, Antonio (2001). "The Old World sparrows (genus Passer) phylogeography and their relative abundance of nuclear mtDNA pseudogenes" (PDF). Journal of Molecular Evolution 53 (2): 144–154. doi:10.1007/s002390010202. PMID 11479685. http://chopo.pntic.mec.es/~biolmol/publicaciones/Passer.pdf. 
  28. ^ González, Javier; Siow, Melanie; Garcia-del-Rey, Eduardo; Delgado, Guillermo; and Wink, Michael (2008). "Phylogenetic relationships of the Cape Verde Sparrow based on mitochondrial and nuclear DNA" (PDF). Systematics 2008, Göttingen. http://www.avescanarias.com/pdfs/CO%20Garcia-del-Rey%20POSTER%20(PASIAG).pdf. Retrieved 7 February 2010. 
  29. ^ Summers-Smith 1988, pp. 303–305
  30. ^ Summers-Smith 1988, p. 164
  31. ^ Summers-Smith 1988, p. 172
  32. ^ Anderson 2006, p. 16
  33. ^ Summers-Smith 1988, pp. 126–127
  34. ^ a b c d Töpfer, Till (2006). "The taxonomic status of the Italian Sparrow — Passer italiae (Vieillot 1817): Speciation by stabilised hybridisation? A critical analysis". Zootaxa 1325: 117–145. ISSN 1175-5334. 
  35. ^ Metzmacher, M. (1986). "Moineaux domestiques et Moineaux espagnols, Passer domesticus et P. hispaniolensis, dans une région de l'ouest algérien : analyse comparative de leur morphologie externe" (in French, English abstract). Le Gerfaut 76: 317–334. 
  36. ^ Anderson 2006, pp. 13–18, 25–26
  37. ^ Summers-Smith 1988, pp. 121–126
  38. ^ Summers-Smith 1988, pp. 169–170
  39. ^ Summers-Smith 1992, pp. 22, 27
  40. ^  Newton, Alfred (1911). "Sparrow". In Chisholm, Hugh. Encyclopædia Britannica. 25 (Eleventh ed.). Cambridge University Press. 
  41. ^ Summers-Smith 1988, p. 13
  42. ^ Jobling 2009, p. 138
  43. ^ Linnaeus 1758, p. 183
  44. ^ a b Summers-Smith 1988, pp. 114–115
  45. ^ Brisson 1760, p. 36
  46. ^ Saikku, Mikko (2004). "House Sparrow". In Krech, Shepard; McNeill, John Robert; Merchant, Carolyn, editors. Encyclopedia of World Environmental History. 3. Routledge. ISBN 0415937345. 
  47. ^ Turcotte & Watts 1999, p. 429
  48. ^ Sibley & Monroe 1990, pp. 669–670
  49. ^ Lockwood 1984, pp. 114–146
  50. ^ Swainson 1885, pp. 60–62
  51. ^ Carver 1987, p. 199
  52. ^ Gavrilov, E. I. (1965). "On hybridisation of Indian and House Sparrows". Bulletin of the British Ornithologists' Club 85: 112–114. 
  53. ^ Summers-Smith 1988, pp. 121–122
  54. ^ a b c d e f g h i j Summers-Smith 1988, pp. 126–128
  55. ^ a b c Mackworth-Praed & Grant 1955, pp. 870–871
  56. ^ Vaurie, Charles (1956). "Systematic notes on Palearctic birds. No. 24, Ploceidae, the genera Passer, Petronia, and Montifringilla". American Museum Novitates (1814). http://digitallibrary.amnh.org/dspace/handle/2246/5394. 
  57. ^ Summers-Smith 1988, p. 134
  58. ^ a b Oberholser 1974, p. 1009
  59. ^ Johnston, Richard F.; Selander, Robert K (March 1971). "Evolution in the House Sparrow. II. Adaptive Differentiation in North American Populations". Evolution (Society for the Study of Evolution) 25 (1): 1–28. doi:10.2307/2406496. http://www.jstor.org/stable/2406496. 
  60. ^ Packard, Gary C. (March 1967). "House Sparrows: Evolution of Populations from the Great Plains and Colorado Rockies". Systematic Zoology (Society of Systematic Biologists) 16 (1): 73–89. doi:10.2307/2411519. http://jstor.org/stable/2411519. 
  61. ^ Johnston, R. F.; Selander, R. K. (1 May 1964). "House Sparrows: Rapid Evolution of Races in North America". Science 144 (3618): 548–550. doi:10.1126/science.144.3618.548. PMID 17836354. 
  62. ^ Selander, Robert K.; Johnston, Richard F (May–June 1967). "Evolution in the House Sparrow. I. Intrapopulation Variation in North America" (PDF). The Condor (Cooper Ornithological Society) 69 (3): 217–258. doi:10.2307/1366314. http://elibrary.unm.edu/sora/Condor/files/issues/v069n03/p0217-p0258.pdf. 
  63. ^ Hamilton, Suzanne; Johnston, Richard F (April 1978). "Evolution in the House Sparrow—VI. Variability and Niche Width" (PDF). The Auk 95 (2): 313–323. http://elibrary.unm.edu/sora/Auk/v095n02/p0313-p0323.pdf. 
  64. ^ Baker, Allan J. (July 1980). "Morphometric Differentiation in New Zealand Populations of the House Sparrow (Passer domesticus)". Evolution (Society for the Study of Evolution) 34 (4): 638–653. doi:10.2307/2408018. http://jstor.org/stable/2408018. 
  65. ^ Summers-Smith 1988, pp. 133–135
  66. ^ Anderson 2006, pp. 5, 9–12
  67. ^ Summers-Smith 1988, pp. 129–137, 280–283
  68. ^ Summers-Smith 1963, pp. 171–173
  69. ^ Anderson 2006, p. 22
  70. ^ Anderson 2006, p. 5
  71. ^ Summers-Smith 1988, pp. 293–296
  72. ^ Martin, Lynn B., II; and Fitzgerald, Lisa (2005). "A taste for novelty in invading house sparrows, Passer domesticus". Behavioral Ecology 16 (4): 702–707. doi:10.1093/beheco/ari044. 
  73. ^ Lee, Kelly A.; Martin, Lynn B., II; Wikelski, Martin C. (2005). "Responding to inflammatory challenges is less costly for a successful avian invader, the house sparrow (Passer domesticus), than its less-invasive congener" (PDF). Oecologia 145 (2): 244–251. http://www.princeton.edu/~wikelski/Publications/2005%20lee%20et%20al.pdf. 
  74. ^ Blakers, Davies & Reilly 1984, p. 586
  75. ^ a b c d Franklin, K. (2007). "The House Sparrow: Scourge or Scapegoat?". Naturalist News. Audubon Naturalist Society. http://www.audubonnaturalist.org/default.asp?page=674. Retrieved 17 December 2008. 
  76. ^ Clergeau, Philippe; Levesque, Anthony; Lorvelec, Olivier (2004). "The precautionary principle and biological invasion: the case of the House Sparrow on the Lesser Antilles". International Journal of Pest Management 50: 83–89. doi:10.1080/09670870310001647650. 
  77. ^ a b c d e Summers-Smith, J. D. (1990). "Changes in distribution and habitat utilisation by members of the genus Passer". In Pinowski, J.; and Summers-Smith, J. D.. Granivorous birds in the agricultural landscape. Warszawa: Pánstwowe Wydawnictom Naukowe. pp. 11–29. ISBN 83-01-08460-X. 
  78. ^ Barrows 1889, p. 17
  79. ^ a b Healy, Michael; Mason, Travis V.; and Ricou, Laurie (2009). "'hardy/unkillable clichés': Exploring the Meanings of the Domestic Alien, Passer domesticus". Interdisciplinary Studies in Literature and Environment (Oxford University Press) 16 (2): 281–298. doi:10.1093/isle/isp025. 
  80. ^ Massam, Marion. "Sparrows" (PDF). Farmnote (Agriculture Western Australia) (117/99). ISSN 0726-934X. http://www.agric.wa.gov.au/objtwr/imported_assets/content/pw/vp/bird/f11799.pdf. Retrieved 1 February 2009. 
  81. ^ Anderson 2006, p. 25
  82. ^ Brooke, R. K. (1997). "House Sparrow". In Harrison, J. A.; Allan, D. G.; Underhill, L. G.; Herremans, M.; Tree, A. J.; Parker, V.; and Brown, C. J.. The Atlas of Southern African Birds. 1. BirdLife South Africa. http://sabap2.adu.org.za/docs/sabap1/801.pdf. 
  83. ^ Lever 2005, pp. 210–212
  84. ^ Restall, Rodner & Lentino 2007, p. 777
  85. ^ a b c d e f Summers-Smith 1988, pp. 137–138
  86. ^ Anderson 2006, pp. 424–425
  87. ^ Hobbs, J. N. (1955). "House Sparrow breeding away from Man". The Emu 55 (4): 202. http://www.publish.csiro.au/?act=view_file&file_id=MU955302.pdf. 
  88. ^ Wodzicki, Kazimierz (May 1956). "Breeding of the House Sparrow away from Man in New Zealand" (PDF). Emu 54: 146–147. http://www.publish.csiro.au/?act=view_file&file_id=MU956143.pdf. 
  89. ^ Summers-Smith 1992, pp. 128–132
  90. ^ Brooke, R. K. (January 1973). "House Sparrows Feeding at Night in New York" (PDF). The Auk 90 (1): 206. http://elibrary.unm.edu/sora/Auk/v090n01/p0206-p0206.pdf. 
  91. ^ a b van der Poel, Guus (29 January 2001). "Concerns about the population decline of the House Sparrow Passer domesticus in the Netherlands". http://www.xs4all.nl/~amvdpoel/Home.htm. Retrieved 29 December 2009. 
  92. ^ Summers-Smith 1988, p. 129
  93. ^ Melville, David S.; Carey, Geoff J. (1998). "Syntopy of Eurasian Tree Sparrow Passer montanus and House Sparrow P. domesticus in Inner Mongolia, China" (PDF). Forktail 13: 125. http://www.orientalbirdclub.org/publications/forktail/13pdfs/Melville-Sparrows.pdf. Retrieved 10 September 2010. 
  94. ^ Summers-Smith 1988, p. 228
  95. ^ Minock, Michael E. (1969). "Salinity Tolerance and Discrimination in House Sparrows (Passer domesticus)" (PDF). The Condor 71 (1): 79–80. doi:10.2307/1366060. http://elibrary.unm.edu/sora/Condor/files/issues/v071n01/p0079-p0080.pdf. 
  96. ^ a b Walsberg, Glenn E. (1975). "Digestive Adaptations of Phainopepla nitens Associated with the Eating of Mistletoe Berries" (PDF). The Condor (Cooper Ornithological Society) 77 (2): 169–174. doi:10.2307/1365787. http://elibrary.unm.edu/sora/Condor/files/issues/v077n02/p0169-p0174.pdf. 
  97. ^ Anderson 2006, pp. 247
  98. ^ a b c d e Summers-Smith 1988, pp. 139–142
  99. ^ McGillivray, W. Bruce (1980). "Communal Nesting in the House Sparrow" (PDF). Journal of Field Ornithology 51 (4): 371–372. http://elibrary.unm.edu/sora/JFO/v051n04/p0371-p0372.pdf. 
  100. ^ Waddington, Don C.; and Cockrem, John F. (1987). "Homing ability of the House Sparrow" (PDF). Notornis 34 (1). http://www.notornis.org.nz/free_issues/Notornis_34-1987/Notornis_34_1.pdf. 
  101. ^ Broun, Maurice (January 1972). "Apparent migratory behavior in the House Sparrow" (PDF). The Auk 89: 187–189. http://elibrary.unm.edu/sora/Auk/v089n01/p0187-p0189.pdf. 
  102. ^ Johnston, Richard F. (1969). "Aggressive Foraging Behavior in House Sparrows". The Auk 86 (3): 558–559. http://elibrary.unm.edu/sora/Auk/v086n03/p0558-p0559.pdf. 
  103. ^ Kalinoski, Ronald (1975). "Intra- and Interspecific Aggression in House Finches and House Sparrows" (PDF). The Condor 77 (4): 375–384. doi:10.2307/1366086. http://elibrary.unm.edu/sora/Condor/files/issues/v077n04/p0375-p0384.pdf. 
  104. ^ a b c Anderson 2006, pp. 273–275
  105. ^ Anderson 2006, p. 246
  106. ^ Kalmus, H. (1984). "Wall clinging: energy saving by the House Sparrow Passer domesticus". Ibis 126 (1): 72–74. doi:10.1111/j.1474-919X.1984.tb03667.x. 
  107. ^ Stidolph, R. D. H. (1974). "The Adaptable House Sparrow" (PDF). Notornis 21 (1): 88. http://www.notornis.org.nz/free_issues/Notornis_21-1974/Notornis_21_1.pdf. 
  108. ^ Anderson 2006, pp. 279–281
  109. ^ Gionfriddo, James P.; Best, Louis B. (1995). "Grit Use by House Sparrows: Effects of Diet and Grit Size" (PDF). The Condor 97 (1): 57–67. doi:10.2307/1368983. http://elibrary.unm.edu/sora/Condor/files/issues/v097n01/p0057-p0067.pdf. 
  110. ^ Summers-Smith 1963, pp. 34–35
  111. ^ a b Summers-Smith 1988, pp. 159–161
  112. ^ Summers-Smith 1963, p. 33
  113. ^ Gavett, Ann P.; and Wakeley, James S. (1986). "Diets of House Sparrows in Urban and Rural Habitats". The Wilson Bulletin 98. http://elibrary.unm.edu/sora/Wilson/v098n01/p0137-p0144.pdf. 
  114. ^ Summers-Smith 1963, pp. 35, 38–39
  115. ^ Vincent 2005, pp. 2–3
  116. ^ a b Anderson 2006, pp. 276–279
  117. ^ Anderson, Ted R. (1977). "Reproductive Responses of Sparrows to a Superabundant Food Supply" (PDF). The Condor (Cooper Ornithological Society) 79 (2): 205–208. doi:10.2307/1367163. http://elibrary.unm.edu/sora/Condor/files/issues/v079n02/p0205-p0208.pdf. 
  118. ^ Ivanov, Bojidar (1990). "Diet of House Sparrow [Passer domesticus (L.)] nestlings on a livestock farm near Sofia, Bulgaria". In Pinowski, J.; and Summers-Smith, J. D.. Granivorous birds in the agricultural landscape. Warszawa: Pánstwowe Wydawnictom Naukowe. pp. 179–197. ISBN 83-01-08460-X. 
  119. ^ Anderson 2006, pp. 135–136
  120. ^ Hatch, Margret I.; Westneat, David F. (2007). "Age-related patterns of reproductive success in house sparrows Passer domesticus". Journal of Avian Biology 38 (5): 603–611. doi:10.1111/j.0908-8857.2007.04044.x. 
  121. ^ a b c d e f g h Summers-Smith 1988, pp. 144–147
  122. ^ Anderson 2006, pp. 141–142
  123. ^ Anderson 2006, pp. 143–144
  124. ^ Anderson 2006, p. 145
  125. ^ Summers-Smith 1988, pp. 142–143
  126. ^ Anderson, T. R. (1990). "Excess females in a breeding population of House Sparrows [Passer domesticus (L.)]". In Pinowski, J.; and Summers-Smith, J. D.. Granivorous birds in the agricultural landscape. Warszawa: Pánstwowe Wydawnictom Naukowe. pp. 87–94. ISBN 83-01-08460-X. 
  127. ^ Brackbill, Hervey (1969). "Two Male House Sparrows Copulating on Ground with Same Female" (PDF). The Auk 86 (1). http://elibrary.unm.edu/sora/Auk/v086n01/p0146-p0146.pdf. 
  128. ^ a b c d e f g h i j k Summers-Smith 1963, pp. 52–57
  129. ^ a b c d Indykiewicz, Piotr (1990). "Nest-sites and nests of House Sparrow [Passer domesticus (L.)] in an urban environment". In Pinowski, J.; and Summers-Smith, J. D.. Granivorous birds in the agricultural landscape. Warszawa: Pánstwowe Wydawnictom Naukowe. pp. 95–121. ISBN 83-01-08460-X. 
  130. ^ Gowaty, Patricia Adair (Summer 1984). "House Sparrows Kill Eastern Bluebirds" (PDF). Journal of Field Ornithology 55 (3): 378–380. http://elibrary.unm.edu/sora/JFO/v055n03/p0378-p0380.pdf. Retrieved 1 October 2009. 
  131. ^ Haverschmidt 1949, pp. 33–34
  132. ^ Morris & Tegetmeier 1896, pp. 8–9
  133. ^ Jansen, R. R. (1983). "House Sparrows build roost nests". The Loon 55: 64–65. ISSN 0024-645X. 
  134. ^ a b Summers-Smith 1963, pp. 131–132
  135. ^ Sustek, Zbyšek; Hokntchova, Daša (1983). "The beetles (Coleoptera) in the nests of Delichon urbica in Slovakia". Acta Rerum Naturalium Musei Nationalis Slovaci, Bratislava XXIX: 119–134. 
  136. ^ a b c Summers-Smith 1988, pp. 148–149
  137. ^ Anderson 2006, pp. 157–172
  138. ^ a b Anderson 2006, pp. 145–146
  139. ^ Anderson 2006, p. 319
  140. ^ Davies 2000, p. 55
  141. ^ Stoner, Dayton (December 1939). "Parasitism of the English Sparrow on the Northern Cliff Swallow" (PDF). Wilson Bulletin 51 (4). http://elibrary.unm.edu/sora/Wilson/v051n04/p0221-p0222.pdf. 
  142. ^ "BTO Bird facts: House Sparrow". British Trust for Ornithology. http://blx1.bto.org/birdfacts/results/bob15910.htm. Retrieved 24 November 2009. 
  143. ^ Paganelli, C. V.; Olszowka, A.; and Ali, A. (1974). "The Avian Egg: Surface Area, Volume, and Density" (PDF). The Condor (Cooper Ornithological Society) 76 (3): 319–325. doi:10.2307/1366345. http://elibrary.unm.edu/sora/Condor/files/issues/v076n03/p0319-p0325.pdf. 
  144. ^ Ogilvie-Grant 1912, pp. 201–204
  145. ^ Hume & Oates 1890, pp. 169–151
  146. ^ Anderson 2006, pp. 175–176
  147. ^ Anderson 2006, pp. 173–175
  148. ^ Anderson 2006, pp. 176–177
  149. ^ Nice, Margaret Morse (1953). "The Question of Ten-day Incubation Periods" (PDF). The Wilson Bulletin 65 (2): 81–93. http://elibrary.unm.edu/sora/Wilson/v065n02/p0081-p0093.pdf. 
  150. ^ a b Anderson 2006, pp. 304–306
  151. ^ Summers-Smith 1992, pp. 30–33
  152. ^ Erritzoe J.; Mazgajski T. D.; Rejt L. (2003). "Bird casualties on European roads — a review". Acta Ornithologica 38 (2): 77–93. http://www.birdresearch.dk/unilang/articles/traffic.pdf. 
  153. ^ a b c Anderson 2006, pp. 311–317
  154. ^ Anderson 2006, pp. 427–429
  155. ^ Young, Emma (1 November 2000). "Sparrow suspect". New Scientist. http://www.newscientist.com/article/dn122-sparrow-suspect.html. Retrieved 25 May 2010. 
  156. ^ Summers-Smith 1963, p. 128
  157. ^ van Riper, Charles III; Sandra G. van Riper and Wallace R. Hansen (2002). "Epizootiology and Effect of Avian Pox on Hawaiian Forest Birds". The Auk 119 (4): 929–942. doi:10.1642/0004-8038(2002)119[0929:EAEOAP]2.0.CO;2. 
  158. ^ Summers-Smith 1963, p. 129
  159. ^ Summers-Smith 1988, pp. 154–155
  160. ^ Summers-Smith 1988, pp. 137–141
  161. ^ "European Longevity Records". EURING: The European Union for Bird Ringing. http://www.euring.org/data_and_codes/longevity-voous.htm. Retrieved 24 November 2009. 
  162. ^ "AnAge entry for Passer domesticus". AnAge: the Animal Ageing and Longevity Database. http://genomics.senescence.info/species/entry.php?species=Passer_domesticus. Retrieved 1 February 2010. 
  163. ^ Anderson 2006, pp. 333–336
  164. ^ Anderson 2006, pp. 425–429
  165. ^ Invasive Species Specialist Group. "ISSG Database: Ecology of Passer domesticus". http://www.issg.org/database/species/ecology.asp?fr=1&si=420&lang=EN. Retrieved 16 January 2009. 
  166. ^ "Even sparrows don't want to live in cities anymore". Times of India. 13 June 2005. http://timesofindia.indiatimes.com/articleshow/1140183.cms. Retrieved 26 October 2008. 
  167. ^ Daniels, R. J. Ranjit (2008). "Can we save the sparrow?" (PDF). Current Science 95 (11): 1527–1528. http://www.ias.ac.in/currsci/dec102008/1527.pdf. 
  168. ^ De Laet, Summers-Smith, J. D. (2007). "The status of the urban house sparrow Passer domesticus in north-western Europe: a review". Journal of Ornithology 148 (Supplement 2): 275–278. doi:10.1007/s10336-007-0154-0. 
  169. ^ Anderson 2006, p. 320
  170. ^ Summers-Smith, J. Denis (2005). "Changes in the House Sparrow Population in Britain" (PDF). International Studies on Sparrows 5: 23–37. Archived from the original on 4 August 2010. http://www.webcitation.org/5naXWiZbt. 
  171. ^ Anderson 2006, pp. 229–300
  172. ^ Gould, Anne Blair (29 November 2004). "House sparrow dwindling". Radio Nederland Wereldomroep. http://static.rnw.nl/migratie/www.radionetherlands.nl/features/science/041129rf-redirected. Retrieved 29 November 2009. 
  173. ^ Summers-Smith 1988, pp. 157–158, 296
  174. ^ "Sparrow numbers 'plummet by 68%'". BBC News. 20 November 2008. http://news.bbc.co.uk/2/hi/uk_news/7738798.stm. Retrieved 6 December 2009. 
  175. ^ a b McCarthy, Michael (16 May 2000). "It was once a common or garden bird. Now it's not common or in your garden. Why?". The Independent. http://www.independent.co.uk/environment/it-was-once-a-common-or-garden-bird-now-its-not-common-or-in-your-garden-why-718073.html. Retrieved 12 December 2009. 
  176. ^ Summers-Smith 1988, p. 156
  177. ^ Bergtold, W. H. (April 1921). "The English Sparrow (Passer domesticus) and the Automobile". The Auk 38 (2): 244–250. http://elibrary.unm.edu/sora/Auk/v038n02/p0244-p0250.pdf. 
  178. ^ MacLeod, Ross; Barnett, Phil; Clark, Jacquie; and Cresswell, Will (23 March 2006). "Mass-dependent predation risk as a mechanism for house sparrow declines?". Biology Letters 2 (1): 43–46. doi:10.1098/rsbl.2005.0421. PMID 17148322. 
  179. ^ Balmori, Alfonso; Hallberg, Örjan (2007). "The Urban Decline of the House Sparrow (Passer domesticus): A Possible Link with Electromagnetic Radiation". Electromagnetic Biology and Medicine 26 (2): 141–151. doi:10.1080/15368370701410558. PMID 17613041. 
  180. ^ a b c McCarthy, Michael (20 November 2008). "Mystery of the vanishing sparrow". The Independent. http://www.independent.co.uk/environment/nature/mystery-of-the-vanishing-sparrow-1026319.html. Retrieved 17 January 2009. 
  181. ^ Vincent, Kate; and Baker Shepherd Gillespie (2006). "The provision of birds in buildings; turning buildings into bird-friendly habitats" (PowerPoint presentation). Ecobuild exhibition. http://www.housesparrow.org/the_provision_of_birds_in_buildings.ppt. Retrieved 10 January 2010. 
  182. ^ De Laet, Jenny; Summers-Smith, Denis; and Mallord, John (2009). "Meeting on the Decline of the Urban House Sparrow Passer domesticus: Newcastle 2009 (24–25 Feb)" (PDF). International Studies on Sparrows 33: 17–32. http://www.wnb.uz.zgora.pl/assets/files/iss/iss_vol33.pdf. [dead link]
  183. ^ Butler, Daniel (2 February 2009). "Helping birds to nest on Valentine's Day". The Telegraph. http://www.telegraph.co.uk/earth/wildlife/4593534/Helping-birds-to-nest-on-Valentines-Day.html. Retrieved 3 May 2010. 
  184. ^ Peach, W. J.; Vincent, K. E.; Fowler, J. A.; and Grice, P. V. (2008). "Reproductive success of house sparrows along an urban gradient". Animal Conservation 11 (6): 1–11. doi:10.1111/j.1469-1795.2008.00209.x. http://www.housesparrow.org/reproductive_success_of_house_sparrows_along_an_urban_gradient.pdf. 
  185. ^ Vincent 2005, pp. 265–270
  186. ^ Vincent, Kate E.; Will Peach; and Jim Fowler (2009). "An investigation in to the breeding biology and nestling diet of the house sparrow in urban Britain" (PowerPoint presentation). International Ornithological Congress. http://www.housesparrow.org/an_investigation_in_to_the_breeding_biology_and_nestling_diet_of_the_house_sparrow_in_urban_britain.ppt. Retrieved 17 January 2009. 
  187. ^ Vincent, Kate E. (2009). "Reproductive success of house sparrows along an urban gradient" (PowerPoint presentation). LIPU – Passeri in crisis?. Pisa, Italy. http://www.housesparrow.org/lipu_reproductive_success_of_house_sparrows_along_an_urban_gradient.ppt. Retrieved 17 January 2010. 
  188. ^ Clover, Charles (20 November 2008). "On the trail of our missing house sparrows". The Telegraph. http://www.telegraph.co.uk/earth/earthcomment/charlesclover/3491497/On-the-trail-of-our-missing-house-sparrows.html. Retrieved 25 May 2010. 
  189. ^ Smith, Lewis (20 November 2008). "Drivers and gardeners the secret behind flight of house sparrows". The Times. http://www.timesonline.co.uk/tol/news/environment/article5192153.ece. Retrieved 17 January 2009. 
  190. ^ Summers-Smith, J. Denis (September 2007). "Is unleaded petrol a factor in urban House Sparrow decline?". British Birds 100: 558. ISSN 0007-0335. 
  191. ^ Hole, D. G.; Whittingham, M. J., Bradbury, R. B., Anderson, G. Q. A., Lee, P. L. M., Wilson, J. D., and Krebs, J. R. (2002). "Ecology and conservation of rural house sparrows". Ecology of Threatened Species. Royal Society for the Protection of Birds. http://www.rspb.org.uk/ourwork/science/report/2002/ecology/ruralhousesparrows.asp. Retrieved 17 January 2010. 
  192. ^ Adam, David (20 November 2009). "Leylandii may be to blame for house sparrow decline, say scientists". The Guardian. http://www.guardian.co.uk/environment/2008/nov/20/wildlife-endangeredspecies. Retrieved 17 January 2009. 
  193. ^ Mukherjee, Sarah (20 November 2008). "Making a garden sparrow-friendly". BBC News. http://news.bbc.co.uk/2/hi/science/nature/7739645.stm. Retrieved 17 January 2009. 
  194. ^ a b Summers-Smith 1963, pp. 49, 215
  195. ^ Shipley, A. E. (1899). "Sparrow". In Cheyne, Thomas Kelley; and Black, J. Sutherland, editors. Encyclopaedia Biblica. 4. http://www.archive.org/stream/encyclopaediabib04cheyuoft#page/n413/mode/2up/. 
  196. ^ Houlihan & Goodman 1986, pp. 136–137
Works cited
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!