Articles on this page are available in 1 other language: Chinese (Simplified) (9) (learn more)

Overview

Brief Summary

Description

The striking plumage of the Java sparrow has resulted in this bird being one of the few globally threatened species which have actually expanded in range (4), as it has been introduced all over the world as a consequence of the cage-bird trade. The Java sparrow has largely pearly-grey plumage, turning pinkish on the belly and white towards the tail. The head is black, which contrasts with the sharply defined white cheeks and large, vivid pink bill. The rump and tail are also black. The song of the Java sparrow begins with single notes, somewhat like a bell, developing into a continuous trilling and clucking, interspersed with high-pitched and deeper notes (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

The gregarious Java sparrow has been observed in flocks consisting of hundreds of individuals. They roost communally in tall trees, cultivated palms in towns, or shrubs, reeds or sugarcane in the country. In its natural range of Java and Bali, the vast extent of rice-farming has resulted in rice being the dominant food in the Java sparrow's diet; so much so that the scientific species name oryzivora means 'rice-eater' (4). However, like other members of the finch family (the Estrildidae), the Java sparrow also feeds on the small seeds of grasses and flowering plants, and occasionally insects (4) (6). Within the natural range of the Java sparrow, breeding extends from February to August, with a peak in April and May. The nest is a loosely built structure of dried grass, constructed under the roofs and eaves of buildings in towns and villages, or in bushes and treetops in more rural areas. Generally, clutches of three or four eggs are laid into these nests, although larger clutches have also been found (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: Native to Java and Bali in East Indies. Introduced and established in Hawaii (abundant and spreading from Honolulu area on Oahu; less numerous but increasing on Kauai and in Keauhou-Kona area of Hawaii); Puerto Rico (San Juan metro area); Miami, Florida; and elsewhere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Range Description

Padda oryzivora is a native endemic of the islands of Java, Bali, and probably Madura, Indonesia, although it has been widely introduced, with feral populations now established in many parts of the world. It was formerly widespread and abundant in its native range, but numbers have crashed disastrously. It can now be difficult to find, particularly on Java (N. Brickle in litt. 2012); a recent survey looked at 64 former locations and located only 109 individuals at 17 sites (Muchtar and Nurwatha 2001). The majority of documented recent records derive from east Java and Bali. Feral populations (in Indonesia at least) have also apparently declined precipitously. Information from elsewhere is insufficient to estimate its status as a feral species, and all conservation efforts should focus on its original native range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Java, Bali, Lombok, Sumbawa, Kangean Is.; introd. Christmas I..
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Originally native to Java and Bali in Indonesia, and possibly also Madura, (an island off the north-eastern coast of Java), the Java sparrow has been widely introduced and populations are now established in many parts of the world, from Asia to Australia, Africa and North America (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 15 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is usually a lowland species, chiefly found below 500m but occurring locally up to 1,500m. It has been recorded in many habitats, including towns and villages (where it was formerly one of the most common species), cultivated land (particularly rice-growing areas), grassland, open woodland, tree savanna, beach forest and even mangroves. It is gregarious, especially outside the breeding season. Post-breeding flocks appear to make substantial short-distance movements in response to local food supplies.


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Scrub, mangroves, cultivated lands, around human habitation (AOU 1983). Puerto Rico: areas of short grass such as athletic fields and large lawns where grass is going to seed (Raffaele 1983), and suburbs. Hawaii: lawns and parks, mostly in cities. In Puerto Rico and Hawaii, nests in crevice or ledge of building (Raffaele 1983, Berger 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Within its natural range the Java sparrow inhabits open woodlands, often bordering cultivated areas, and is also found in mangroves, grassland, towns and villages. It is found in both coastal and inland areas, up to 1,500 metres above sea level (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

May form flocks of up to 100 in Puerto Rico (Raffaele 1983); flocks of 100+ reported in Hawaii (Berger 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: Surprisingly little is known about the lifespan of these animals. Their life expectancy in captivity is 2 to 3 years, but Java sparrows living up to 7 years have been reported (http://bna.birds.cornell.edu/). Anecdotal reports suggest these animals may live over 9 years in captivity.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In Puerto Rico breeds from July to as late as February (Raffaele 1983). In Hawaii, begins to nest in fall, continues throughout winter (Berger 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Padda oryzivora

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTACCTAATTTTCGGTGCCTGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGACAACCCGGAGCCCTACTAGGAGACGACCAAGTATACAACGTTGTCGTCACAGCCCATGCTTTCGTAATGATTTTCTTCATAGTTATACCAATCATAATTGGAGGATTCGGAAACTGACTAGTACCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTCCTCCCCCCCTCATTCCTCCTACTACTAGCATCCTCAACAGTCGAAGCAGGAGTGGGAACGGGCTGAACAGTATATCCCCCACTAGCCGGAAACCTAGCCCACGCCGGAGCCTCAGTAGACCTAGCCATTTTCTCACTACACTTAGCAGGTATCTCCTCTATTCTAGGGGCAATCAACTTCATCACAACAGCAATCAATATAAAACCACCAGCCCTATCACAGTACCAGACCCCCCTATTCGTGTGATCCGTACTAATCACCGCAGTCCTGCTTCTCCTATCCCTACCCGTCCTCGCTGCAGGAATCACAATACTCCTCACAGACCGCAACCTAAACACAACATTCTTCGACCCAGCAGGGGGAGGAGACCCAGTATTATACCAACACCTATTCTGATTCTTCGGACACCCAGAAGTTTACATCCTAATCCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Padda oryzivora

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bde+3bde+4bde

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Brickle, N.

Justification
The popularity of this finch as a cage-bird has resulted in intense trapping activity, which is inferred to be causing rapid declines in the population. Unless stringent regulations are enforced, these declines are likely to continue, and as such it is listed as Vulnerable.


History
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5