Overview

Distribution

Range

E Paraguay to se Brazil and ne Argentina.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Euphonia cyanocephala

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATTTTCGGTGCATGAGCCGGAATAGTGGGTACCGCCCTAAGTCTCCTCATCCGAGCAGAACTAGGCCAACCTGGGGCACTCCTAGGAGACGACCAAGTATATAACGTAGTCGTCACGGCCCATGCTTTCGTGATAATCTTCTTTATAGTTATGCCAATTATAATCGGAGGGTTCGGTAACTGGCTAGTTCCACTAATAATTGGTGCACCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTACCACCATCCTTCCTCCTTCTGCTGGCATCTTCCACAGTTGAAGCAGGAGTTGGAACAGGCTGAACAGTATATCCCCCGCTAGCCGGCAATCTAGCCCACGCCGGAGCTTCAGTCGACCTGGCAATCTTCTCACTCCACCTAGCAGGTATCTCCTCAATCTTAGGAGCAATTAATTTTATTACAACAGCAGTTAACATAAAACCACCAGCCATCTCACAATACCAAACACCCCTATTCGTTTGATCCGTACTGATCACTGCAGTACTCCTGCTCCTGTCCCTGCCAGTCCTAGCTGCAGGAATTACTATACTTCTCACGGACCGAAATCTAAACACTACCTTCTTTGATCCAGCAGGCGGAGGAGACCCAGTCCTGTACCAACATCTCTTCTGATTCTTCGGTCATCCAGAAGTGTATATCCTGATTCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Euphonia cyanocephala

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common but patchily distributed' (Stotz et al. 1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Golden-rumped euphonia

The golden-rumped euphonia (Euphonia cyanocephala) is a species of bird in the family Fringillidae, formerly placed in the Thraupidae. It is found in Argentina, Bolivia, Brazil, Colombia, Ecuador, French Guiana, Guyana, Paraguay, Peru, Suriname, Trinidad and Tobago, and Venezuela.

Its natural habitats are subtropical or tropical moist lowland forests, subtropical or tropical moist montane forests, and heavily degraded former forest.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!