Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) BREEDING: central California, northern Arizona, southwestern New Mexico, southeastern Colorado, northwestern and central Oklahoma, south discontinuously to southern Baja California and Mexico. NON-BREEDING: throughout breeding range except northeastern portion, where usually winters from northeastern New Mexico, northern Texas and south-central Oklahoma southward.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Aimophila ruficeps occurs in south-west U.S.A. and much of Mexico (del Hoyo et al. 2011). The subspecies sanctorum of Mexico's Todos Santos Islands has not been observed on recent visits and is likely to be extinct (Wilbur 1987).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Rufous-crowned sparrows are found from mid to southern California through northern Baja California in the coastal areas to southern Mexico, as well as many other parts of the American Southwest, excluding northeastern Arizona and northwestern New Mexico. These birds range as far east as mid-eastern Texas and as far north as southern Utah and Colorado.

Biogeographic Regions: nearctic (Native )

  • Peterson, R., V. Peterson. 1990. A Field Guide to Western Birds. Boston: Houghton Mifflin Company.
  • Robbins, C., B. Bruun, H. Zim. 1983. A Guide to Field Identification: Birds of North America. New York: Western Publishing Company.
  • Collins, P. 1999. Rufous-crowned Sparrow. Pp. No.472, 1-28 in A Poole, P Stettenheim, K Kaufman, L Bevier, eds. The Birds of North America, Vol. 12, 1 Edition. Philadelphia, PA: The American Ornithologists' Union and The Academy of Natural Sciences of Philadelphia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Rufous-crowned sparrows are medium-sized birds with red-capped heads and beige-gray breasts. They have black stripes on either side of their solid, gray-white throat. Males tend to have slightly larger wingspans and tail length than females.

Similiar species include Aimophila rufescens, Aimophila notosticta, Spizella passerina, and Zonotrichia leucophrys. Rufous-crowned sparrows differ from these species in their red-brown cap and solid-colored breast. American tree sparrows (Spizella arborea) also have the red cap, but do not have a rounded tail. Sparrows in the genus Aimophila can also be distinguished from other sparrows in the range of rufous-crowned sparrows by their beaks and tails, which are longer in proportion to their body size than in other sparrows. Males and females ares similar in color, but males tend to be larger than females.

Range mass: 15 to 23 g.

Range length: 13 to 15 cm.

Average wingspan: 196.85 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Sibley, D. 2003. The Sibley Field Guide to Birds of Eastern North America. New York: Alfred A. Knopf.
  • Sibley, D. 2001. The Sibley Guide to Bird Life and Behavior. New York: Alfred A. Knopf, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 15 cm

Weight: 19 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Rocky hillsides, steep slopes of grass and brush. In Mexico, found in arid scrub and pine-oak habitat. Nests on ground at base of rock, tuft of grass, or sapling; or 0.3-1 m above ground in branches of shrub or tree.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species inhabits arid, rocky, open areas with varying elevation and heterogeneous vegetation, including low grasses and shrubbery. They are also found in open pine and oak forests. If a winter is particularly cold, these birds may move south or lower in elevation, but they do not move far from their breeding grounds.

Range elevation: 0 to 2195 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May withdraw from northern part of range for winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on insects (beetles, crickets, grasshoppers, flies, caterpillars, etc.) and seeds of grasses and forbs. Forages on the ground or low in bushes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Food habits depend on region and time of year. Grass, seeds and insects are primary foods. Rufous-crowned sparrows eat more plants such as knotweed (Polyugonum), chickweed (Stellaria media), filaree (Erodium), dock (Rumex), and wild oats (Avena) during the summer and spring. Grasshoppers (Acrididae), ground beetles (Carabidae), and ants (Formicidae) become a larger percentage of their diet during other parts of the year.

Animal Foods: insects

Plant Foods: leaves; seeds, grains, and nuts

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Rufous-crowned sparrows are primary consumers, as they eat vegetation. They are also secondary consumers, as they eat insects as well. These sparrows are preyed on by domestic cats (Felis silvestris) and probably predatory birds and snakes. Rufous-crowned sparrows can be hosts for the nest parasite, brown-headed cowbirds (Molothrus ater), though this is uncommon. They are also parasitized by two species of ticks (Amblyomma americanum and Ixodes pacificus).

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Domestic cats (Felis silvestris) prey on rufous-crowned sparrows. Behaviors towards Mexican jays (Aphelocoma ultramarina) suggest a possible predator/prey relationship. Other possible predators include American kestrels (Falco sparverius), white-tailed kites (Elanus leucurus), sharp-shinned hawks (Accipiter striatus), and Cooper's hawks (Accipiter cooperii). Snakes are probably important predators of eggs and nestlings, as they are in other Aimophila species.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Estimated average territory size in southern California hard chaparral was about 1.5 hectares (Cody 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Rufous-crowned sparrows have voices that have been described as "hoarse" and their call is a descending succession of staccato notes. This call, described by Collins (1999) as the Primary Song, is probably used by males to announce their territory and to attract a female mate. Rufous-crowned sparrows sing at a lower pitch during the nonbreeding season. Visual signs such as posture and vocal calls are used by the birds at specified times for several purposes. For example, males use a certain call when chasing intruders from their territory. Both males and females use vocal calls to give predator warnings. Warning calls are often nasal noises described as sounding like "dear." Aggressive sounds and postures are used during competition over territory between two males. Mates also sing songs to one another in order to recognize each other or to strengthen the pair's relationship.

Communication Channels: visual ; acoustic

Other Communication Modes: duets ; choruses

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The longest recorded lifespan for a rufous-crowned sparrow is 3 years and 2 months.

Range lifespan

Status: wild:
3.2 (high) years.

Average lifespan

Status: wild:
38 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 3.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Clutch size is 2-5 (usually 3-4). Incubation is by female. Altricial nestlings are tended by both parents.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These birds find a mate in the spring and stay with the same mate through the winter and often through following mating seasons. Males attract a mate by singing from a visible perch or while flying. The mates sing duets together and to each other when they reunite in their territory. These songs are used for recognition and to strengthen the bond between them. Males are territorial during mating season, are not exceptionally aggressive in protecting their territory.

Mating System: monogamous

Reproduction varies by region and year-to-year with weather changes. For example, rainy weather seems to act as a cue for nesting, so nesting begins in early summer in Mexico, but much earlier in California, where rains begin earlier. The dates when eggs are laid also vary by region. Birds in California lay eggs earlier (Mar 11- Jul 10) than those in Texas (Apr 4- Sept 26). In some parts of their range, rufous-crowned sparrows nest twice per year based on rain patterns. It seems that these sparrows breed only when food is available (dependent on rainfall), which could result in increased survivorship of young.

Only female sparrows build nests. Nests are constructed of grass, bark, twigs, and hair, and are usually built in a shallow concavity in the ground. Once the eggs are laid, the female incubates until hatching. The young are altricial when hatched, and both parents help to find food and feed the hatchlings.

When the young birds leave the nest, they are as yet unable to fly and they continue to depend on their parents for food. The amount of time the fledglings are dependent on their parents is unknown, but they may not become independent until winter. The age of sexual reproductive maturity is also unknown, but it is assumed that the birds are over one year old before they reproduce.

Rufous-crowned sparrows tend to return to the same breeding ground year after year once a territory is chosen as an adult.

Breeding interval: Rufous-crowned sparrows may breed once or twice yearly depending on rain cycles.

Breeding season: Breeding can occur from early spring to early fall.

Range eggs per season: 2 to 5.

Range time to hatching: 11 to 13 days.

Range fledging age: 8 to 9 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 3.

Females incubate eggs for 11 to 13 days. They stay with the eggs except when foraging, at which time the male sparrow sometimes joins her. Females will abandon the nest easily if it is disturbed, and will not attack intruders. However, females do attempt to ward off those who come too close to the nest by flapping her wings and making loud noises.

Once the eggs hatch, the female is the exclusive brooder. Both male and female sparrows find food for the young. They will feed the offspring for an unknown period of time, even after the young leave the nest.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female); post-independence association with parents; extended period of juvenile learning

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook. New York: Simon & Schuster, Inc..
  • Collins, P. 1999. Rufous-crowned Sparrow. Pp. No.472, 1-28 in A Poole, P Stettenheim, K Kaufman, L Bevier, eds. The Birds of North America, Vol. 12, 1 Edition. Philadelphia, PA: The American Ornithologists' Union and The Academy of Natural Sciences of Philadelphia.
  • Morrison, S., D. Bolger, T. Sillett. 2004. Annual Survivorship of the Sedentary Rufous-Crowned Sparrow (Aimophila ruficeps): No Detectable Effects of Edge or Rainfall in Southern California. The Auk, Vol.121: 904-916. Accessed November 11, 2006 at http://0-www.bioone.org.ariadne.kzoo.edu/perlserv/?request=get-document&doi=10.1642%2F0004-8038%282004%29121%5B0904%3AASOTSR%5D2.0.CO%3B2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aimophila ruficeps

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTGATCTTCGGCGCATGAGCCGGAATAGTAGGTACTGCACTAAGCCTCCTCATCCGAGCTGAACTAGGCCAACCTGGAGCCCTCCTAGGAGACGACCAAGTTTACAACGTAATCGTCACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATCATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCCTTCCCACGGATAAACAACATAAGCTTCTGACTACTCCCCCCCTCCTTTCTCCTCCTCCTAGCATCCTCCACCGTTGAAGCAGGTGTCGGCACAGGCTGAACAGTGTACCCCCCACTAGCCGGCAACCTAGCCCACGCCGGAGCCTCAGTCGACCTCGCAATCTTCTCACTACACCTAGCCGGTATCTCCTCAATCCTAGGAGCAATCAACTTCATCACAACAGCAATCAATATGAAACCCCCTGCCCTCTCACAATACCAAACCCCCTTATTTGTATGATCAGTCCTAATCACCGCAGTCCTACTCCTCCTATCTCTTCCAGTCCTAGCCGCAGGAATCACAATACTCCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCCGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTTTACATCTTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aimophila ruficeps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although rufous-crowned sparrows are not considered endangered or threatened, loss of habitat through human expansion has limited their range and may affect populations.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Aimophila ruficeps on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

These birds help to control insect populations through their feeding habits.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Rufous-crowned sparrow

The rufous-crowned sparrow (Aimophila ruficeps) is a smallish American sparrow. This passerine is primarily found across the Southwestern United States and much of the interior of Mexico, south to the transverse mountain range, and to the Pacific coast to the southwest of the transverse range. Its distribution is patchy, with populations often being isolated from each other. Twelve subspecies are generally recognized, though up to eighteen have been suggested. This bird has a brown back with darker streaks and gray underparts. The crown is rufous, and the face and supercilium are gray with a brown or rufous streak extending from each eye and a thick black malar streak.

These sparrows feed primarily on seeds in the winter and insects in the spring and summer. The birds are often territorial, with males guarding their territory through song and displays. Flight is awkward for this species, which prefers to hop along the ground for locomotion. They are monogamous and breed during spring. Two to five eggs are laid in the bird's nest, which is cup-shaped and well hidden. Adult sparrows are preyed upon by house cats and small raptors, while young may be taken by a range of mammals and reptiles. They have been known to live for up to three years, two months. Although the species has been classified as least concern, or unthreatened with extinction, some subspecies are threatened by habitat destruction and one may be extinct.

Taxonomy[edit]

Drawing joined to the original description by John Cassin.

This bird belongs to the family Emberizidae, which consists of the American sparrows and Eurasian buntings. The American sparrows are seed-eating New World birds with conical bills, brown or gray plumage, and distinctive head patterns. Birds in the genus Aimophila tend to be medium-sized at 5 to 8 inches (13 to 20 cm) in length, live in arid scrubland, have long bills and tails in proportion to their body size as well as short, rounded wings, and build cup-shaped nests.[4][5]

The rufous-crowned sparrow was described in 1852 by American ornithologist John Cassin as Ammodramus ruficeps.[2] It has also been described as belonging to the genus Peucaea, which contains several sparrows in the genus Aimophila that share characteristics, such as a larger bill and a patch of yellow under the bend of the wing, that other members of the genus do not.[3][6] However, splitting the Peucaea sparrows into a separate genus is not generally recognized.[2][7] A 2008 phylogenetic analysis of the genus Aimophila divided it into four genera, with the rufous-crowned sparrow and its two closest relatives, the Oaxaca sparrow and rusty sparrow, being maintained as the genus Aimophila.[8] In addition, this study suggested that the rufous-crowned sparrow may be more closely related to the brown towhees of the genus Pipilo than the other members of the historical genus Aimophila.[8]

The derivation of the current genus name, Aimophila, is from the Greek aimos/ἀιμος, meaning "thicket", and -philos/-φιλος, meaning "loving".[9] The specific epithet is a literal derivation of the common name, derived from the Latin rufus, meaning "reddish" or "tawny", and -ceps, from caput, meaning "head".[10] The bird is also occasionally referred to colloquially as the rock sparrow because of its preference for rocky slopes.[11]

Subspecies[edit]

Twelve subspecies are generally recognized,[2] although sometimes up to eighteen are named.[7]

  • A. r. ruficeps, the nominate subspecies, was described by Cassin in 1852.[12] It is found in the coastal ranges of California and on the western slopes of the Sierra Nevada.[13] This subspecies is darker and noticeably smaller than A. r. eremoeca and has distinct rufous-brown streaking on its upperparts.[2]
  • A. r. canescens was described by American ornithologist W.E. Clyde Todd in 1922,[12] and it is found in southwestern California and northeast Baja California as far east as the base of the San Pedro Martir.[13] While the species itself is listed as of least concern, this subspecies is listed as a "species of special concern" by the California Department of Fish and Game, signifying that this population is threatened with extinction.[11] It appears to be extremely similar to A. r. ruficeps but is darker.[2]
  • A. r. obscura, described by Donald R. Dickey and Adriaan van Rossem in 1923,[12] is found in the Channel Islands of California on Santa Cruz, Anacapa, and formerly on Santa Catalina.[13][11] While the Santa Catalina population has not been observed since 1863, the subspecies seems to have colonized Anacapa Island.[11] No records exist of them before 1940.[14] This subspecies is similar to A. r. canescens but is darker.[2]
  • A. r. sanctorum was described by van Rossem in 1947.[12] It was found on the Todos Santos Islands off the coast of northwest Baja California.[13][15] This subspecies is believed to be extinct.[16][11] This is the darkest of the coastal subspecies, especially on its underbelly.[2]
  • A. r. sororia was described by Robert Ridgway in 1898,[12] and it is found in the mountains of southern Baja California, specifically the Sierra de la Laguna.[13] It is the palest of the coastal subspecies.[2]
  • A. r. scottii, described by George Sennett in 1888,[12] is found from northern Arizona to New Mexico south to northeastern Sonora and northwestern Coahuila.[13] It appears to be a darker gray than A. r. eremoeca and has narrower and darker rufous streaks on its breast.[2]
  • A. r. rupicola was described by van Rossem in 1946.[12] It is found in the mountains of southwestern Arizona.[13] It is similar in appearance to A. r. scottii but is darker and grayer on its back.[2]
  • A. r. simulans was described by van Rossem in 1934,[12] and it is found in northwestern Mexico from southeastern Sonora and southwestern Chihuahua to Nayarit and northern Jalisco.[13] It has more rufous coloration on its back and is paler on its underbelly than A. r. scottii.[2]
Rufous-crowned sparrow general characteristics
  • A. r. eremoeca was described by N. C. Brown in 1882.[12] It is found from southeastern Colorado to New Mexico, Texas, northern Chihuahua, and central Coahuila.[13] It has grayish upperparts and a dark breast.[2]
  • A. r. fusca, described by Edward William Nelson in 1897,[12] is found in western Mexico from southern Nayarit to southwestern Jalisco, northern Colima, and Michoacan.[13] It is darker and more rufous on its upperparts than A. r. australis. It also possesses a darker rufous crown which does not show a gray stripe down the middle.[2]
  • A. r. boucardi was described by Philip Sclater in 1867,[12] and it is found in eastern Mexico from southern Coahuila to San Luis Potosí, northern Puebla, and southern Oaxaca.[13] This subspecies is darker than A. r. eremoeca and has dull brown, not rufous, streaking on the chest.[2]
  • A. r. australis, described by Edward William Nelson in 1897,[12] occurs in southern Mexico from Guerrero to southern Puebla and Oaxaca.[13] A. r. scottii is similar in appearance, but this subspecies is smaller and has a shorter bill.[2]

The other six subspecies that are occasionally recognized are A. r. extima and A. r. pallidissima, which were described by A. R. Phillips in 1966, A. r. phillipsi, which was described by J.P. Hubbard and Crossin in 1974, and A. r. duponti, A. r. laybournae, and A. r. suttoni, which were described by J.P. Hubbard in 1975.[7]

Description[edit]

A. r. boucardi

The rufous-crowned sparrow is a smallish sparrow at 5.25 inches (13.3 cm) in length, with males tending to be larger than females.[2][5][12] It ranges from 15 to 23 grams (0.53 to 0.81 oz) in weight and averages about 19 grams (0.67 oz).[5] It has a brown back with darker streaks and gray underparts. Its wings are short, rounded, and brown and lack wingbars, or a line of feathers of a contrasting color in the middle of the bird's wing. The sparrow's tail is long, brown, and rounded. The face and supercilium (the area above the eye) are gray with a brown or rufous streak extending from each eye and a thick black streak on each cheek.[12] The crown ranges from rufous to chestnut, a feature which gives it its common name, and some subspecies have a gray streak running through the center of the crown.[4][2] The bill is yellow and cone-shaped.[12] The sparrow's throat is white with a dark stripe. Its legs and feet are pink-gray.[2] Both sexes are similar in appearance, but the juvenile rufous-crowned sparrow has a brown crown and numerous streaks on its breast and flanks during the spring and autumn.[12]

The song is a short, fast, bubbling series of chip notes that can accelerate near the end, and the calls include a nasal chur and a thin tsi.[2] When threatened or separated from its mate, the sparrow makes a dear-dear-dear call.[17]

Distribution and habitat[edit]

Chaparral nesting habitat in California

This bird is found in the southwestern United States and Mexico from sea level up to 9,800 feet (3,000 m), though it tends to be found between 3,000 and 6,000 feet (910 and 1,830 m).[2][11] It lives in California, southern Arizona, southern New Mexico, Texas, and central Oklahoma south along Baja California and in western Mexico to southern Puebla and Oaxaca. In the midwestern United States, the sparrow is found as far east as a small part of western Arkansas, and also in a small region of northeastern Kansas, its most northeastern habitat. The range of this species is discontinuous and is made up of many small, isolated populations.[11] The rufous-crowned sparrow is a non-migratory species, though the mountain subspecies are known to descend to lower elevations during severe winters.[11] Male sparrows maintain and defend their territories throughout the year.[11]

This sparrow is found in open oak woodlands and dry uplands with grassy vegetation and bushes. It is often found near rocky outcroppings. The species is also known from coastal scrublands and chaparral areas.[2] The rufous-crowned sparrow thrives in open areas cleared by burning.[11]

Ecology and behavior[edit]

The average territory size of rufous-crowned sparrows in the chaparral of California ranges from 2 acres (0.81 ha) to 4 acres (1.6 ha).[11] The density of territories varies by habitat, including 2.5 to 5.8 territories per 99 acres (40 ha) of three- to five-year-old burned chaparral to 3.9 to 6.9 territories for the same amount of coastal scrubland.[11] One pair tends to be supported by a territory, although birds without a mate have been seen sharing a territory with a mated pair.[11]

This sparrow is awkward in flight and primarily uses running and hopping to move.[5] The rufous-crowned sparrow will at times forage in pairs during the breeding season, and in family-sized flocks in late summer and early autumn. During the winter they can occasionally be found in loose mixed-species foraging flocks.[11]

Predators of adult sparrows include house cats and small raptors like Cooper's and sharp-shinned hawks, American kestrels, and white-tailed kites.[18] The nests may be raided by a range of species including mammals and reptiles such as snakes, though nest predation has not yet been directly observed, and nesting sparrows have been observed using three kinds of displays to distract potential predators; the rodent run, the broken wing, and the tumbling off the bush.[11] Birds adopt a rodent run display to distract predators. The head, neck and tail are lowered, wings held out, and feathers fluffed as the bird runs rapidly and voices a continuous alarm call.[19][20] In the broken wing display, the sparrow imitates having a broken wing by dropping one to the ground and hopping away from the nest, leading the predator away until the bird ceases the act and escapes the predator.[21] The adult rufous-crowned sparrow distracts a nest predator by falling from the top of a bush to attract the predator to itself in the tumbling off the bush display.[22]

The longest lifespan recorded for a rufous-crowned sparrow is three years, two months.[5] Two species of tick, Amblyomma americanum and Ixodes pacificus, are known to parasitize the sparrow.[5]

Diet[edit]

A pair in California

This sparrow feeds primarily on small grass and forb seeds, fresh grass stems, and tender plant shoots during autumn and winter.[11] During these seasons, insects such as ants, grasshoppers, ground beetles, and scale insects as well as spiders make up a small part of its diet. In the spring and summer, the bird's diet includes a greater quantity and variety of insects.[17]

The rufous-crowned sparrow forages slowly on or near the ground by walking or hopping under shrubs or dense grasses.[11] Though it occasionally forages in weedy areas, it is almost never observed foraging in the open. It has occasionally been observed feeding in branches and low shrubs.[17] During the breeding season, it gleans its food from grasses and low shrubs.[11] However, normally the species obtains its food by either pecking or less frequently scratching at leaf litter. This bird tends to forage in a small family group and in a limited area.[17]

It is unknown whether this species obtains all of the water it needs from its food or if it must also drink; however, it has been observed both drinking and bathing in pools of water after rain storms.[11]

Reproduction[edit]

The rufous-crowned sparrow breeds in sparsely vegetated scrubland. Males attract a mate by singing from regular positions at the edge of their territories throughout the breeding season. These birds are monogamous, taking only one mate at a time, and pairs often remain together for several years.[11] If singing males come within contact of each other, they may initially raise their crowns and face the ground to display this feature; if that fails to make the other bird leave, they stiffen their body, droop their wings, raise their tails, and stick their head straight out.[11] Males guard their territories year-round.[11]

While it is not known when precisely the breeding season starts, the earliest that a sparrow has been observed carrying nesting material was on March 2 in southern California.[11] The female bird builds a bulky, thick-walled open-cup nest typically on the ground, though occasionally in a low bush up to 18 in (46 cm) above it, from dried grasses and rootlets, sometimes with strips of bark, small twigs, and weed stems.[5][11] Nests are well hidden, as they are built near bushes or tall grasses or overhanging rock with concealing vegetation.[11] Once a sparrow chooses a nesting site, it tends to return to the site for many years.[11] It lays between two and five eggs at a time and typically only raises one brood a year, though some birds in California have been observed raising two or even three broods a year.[11][12] In case of a nesting failure, replacement clutches may be laid.[11] The eggs are an unmarked, pale bluish-white.[17] Broods of the rufous-crowned sparrow have very occasionally been observed to be parasitized by the brown-headed cowbird.[11][23]

Incubation of the eggs lasts 11 to 13 days and is performed solely by the female. The hatchlings are naked and quills do not begin to show until the third day. Only females brood the nestlings, though both parents may bring whole insects to their young. When a young rufous-crowned sparrow leaves the nest after eight or nine days, it is still incapable of flight, though it can run through the underbrush; during this time it is still fed by the parents. Juveniles tend to leave their parent's territory and move into adjacent habitat in autumn or early winter. Reproductive success varies strongly with annual rainfall and is highest in wet El Niño years, since cool rainy weather reduces the activity of snakes, the main predator of the sparrow's nests.[24]

Conservation[edit]

The rufous-crowned sparrow is treated as a species of least concern, or not threatened with extinction, by BirdLife International due to its large geographical range of about 463,323 square miles (1,200,000 km2), estimated population of 2.4 million individuals, and lack of a 30% population decline over the last ten years.[25] In years without sufficient rains, many birds fail to breed and those that do produce fewer offspring.[26][27] Some of the local populations of this bird are threatened and declining in number.[11] The island subspecies and populations have declined in some cases: A. r. sanctorum of the Todos Santos Islands is believed to be extinct,[16] and the populations on Santa Catalina Island and Baja California's Islas de San Martin have not been observed since the early 1900s.[11] Populations of the species in southern California are also becoming more restricted in range because of urbanization and agricultural development in the region. Additionally, the sparrow is known to have been poisoned by the rodenticide warfarin, though more research is needed to determine the effects of pesticides on the rufous-crowned sparrow.[11]

References[edit]

  1. ^ BirdLife International (2012). "Aimophila ruficeps". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g h i j k l m n o p q r s t u v Byers, Clive; Curson, Jon; Olsson, Urban (1995). Sparrows and Buntings: A Guide to the Sparrows and Buntings of North America and the World. Pica Press. pp. 296–7. ISBN 1-873403-19-4. 
  3. ^ a b Storer, Robert W. (1955). "A preliminary survey of the sparrows of the genus Aimophila" (PDF). The Condor 57 (4): 193–201. doi:10.2307/1365082. JSTOR 1365082. Retrieved 2009-02-13. 
  4. ^ a b Howell, Steve N.G.; Webb, Sophie (1995). A Guide to the Birds of Mexico and Northern Central America. New York: Oxford University Press. ISBN 0-19-854012-4. 
  5. ^ a b c d e f g Omari, Amel; Fraser, Ann (2007). "Aimophila ruficeps". Animal Diversity Web. Retrieved 2009-04-12. 
  6. ^ Wolf, LL (1977). Species relationships in the avian genus Aimophila. Ornithological Monographs No. 23. American Ornithologists' Union. 
  7. ^ a b c "ITIS Standard Report Page: Aimophila ruficeps". Integrated Taxonomic Information System. Retrieved 2009-04-12. 
  8. ^ a b DaCosta, Jeffrey M.; Spellman, Garth M.; Escalante, Patricia; Klicka, John (2009). "A molecular systematic review of two historically problematic songbird clades: Aimophila and Pipilo". Journal of Avian Biology (Copenhagen: Munksgaard International) 40 (2): 206–216. doi:10.1111/j.1600-048X.2009.04514.x. 
  9. ^ Holloway, J. E. (2003). Dictionary of Birds of the United States: Scientific and Common Names. Portland, Oregon: Timber Press. p. 17. ISBN 0-88192-600-0. 
  10. ^ Simpson, D.P. (1979). Cassell's Latin Dictionary (5 ed.). London: Cassell. p. 883. ISBN 0-304-52257-0. 
  11. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac ad ae af Thorngate, Nellie; Parsons, Monika (2005). "California partners in flight coastal scrub and chaparral bird conservation plan Rufous-crowned Sparrow (Aimophila ruficeps)". California Partners in Flight. Retrieved 2008-01-19. 
  12. ^ a b c d e f g h i j k l m n o p q Gough, Gregory (2000-12-28). "Rufous-crowned sparrow Aimophila ruficeps". Patuxent Bird Identification InfoCenter. USGS Patuxent Wildlife Research Center. Retrieved 2007-01-18. 
  13. ^ a b c d e f g h i j k l Clements, James F. (2007). The Clements Checklist of Birds of the World (6th ed.). Ithaca, NY: Comstock Publishing Associates. pp. 681–682. ISBN 978-0-8014-4501-9. 
  14. ^ Johnson, Ned K. (1972). "Origin and differentiation of the avifauna of the Channel Islands, California." (PDF). Condor 74 (3): 295–315. doi:10.2307/1366591. JSTOR 1366591. Retrieved 2009-02-13. 
  15. ^ Howell, Alfred Brazier (June 1917). "Birds of the islands off the coast of southern California". Pacific Coast Avifauna 12: 80. Retrieved 2009-02-13. 
  16. ^ a b Donlan, C. J.; Tershy, B. R.; Keitt, B. S.; Wood, B.; Sanchez, J. A.; Weinstein, A.; Croll, D. A.; and Alguilar, J. L. (2000). Island conservation action in northwest Mexico. In Browne, D. H.; Chaney, H. and Mitchell, K. (eds.). Proceedings of the Fifth California Islands Symposium (PDF). Santa Barbara Museum of Natural History, Santa Barbara, California, USA. pp. 330–338. Retrieved 2009-02-13. 
  17. ^ a b c d e Kaufman, Kenn (1996). Lives of North American Birds. Boston: Houghton Mifflin. p. 583. ISBN 0-618-15988-6. 
  18. ^ Morrison, Scott A.; Bolger, Douglas T.; Scott, Sillett T. (2004). "Annual survivorship of the sedentary rufous-crowned sparrow (Aimophila ruficeps): no detectable effects of edge or rainfall in southern California". The Auk 121 (3): 904–916. doi:10.1642/0004-8038(2004)121[0904:ASOTSR]2.0.CO;2. ISSN 0004-8038. 
  19. ^ Rowley, Ian (1962). "'Rodent-run' distraction display by a passerine, the Superb Blue Wren Malurus cyaneus (L.)". Behaviour 19: 170–76. doi:10.1163/156853961X00240. 
  20. ^ Barrows, Edward M. (2001). Animal behavior desk reference (2 ed.). CRC press. p. 177. ISBN 0-8493-2005-4. 
  21. ^ Hauser, Marc D. (1997). The evolution of communication. Cambridge, MA: MIT Press. p. 588. ISBN 0-262-58155-8. 
  22. ^ Collins, Paul W. (1999). "Rufous-crowned Sparrow (Aimophila ruficeps)". In Poole, A.; Gill, F. The Birds of North America Online. Ithaca, NY: Cornell Lab of Ornithology. doi:10.2173/bna.472. Retrieved 2009-04-11. 
  23. ^ Miles, D. B. (1986). "A record of Brown-headed Cowbird Molothrus ater nest parasitism of Rufous-crowned Sparrows Aimophila ruficeps". Southwestern Naturalist 31 (2): 253–254. doi:10.2307/3670570. JSTOR 3670570. 
  24. ^ Morrison, Scott A.; Bolger, Douglas T. (November 2002). "Variation in a sparrow's reproductive success with rainfall: food and predator-mediated processes". Oecologia 133 (3): 315–324. doi:10.1007/s00442-002-1040-3. 
  25. ^ "Species factsheet: Aimophila ruficeps". BirdLife International. 2007. Retrieved 2008-01-19. 
  26. ^ Bolger, Douglas T.; Patten, Michael A.; and Bostock, David C. (2005). "Avian reproductive failure in response to an extreme climatic event" (PDF). Oecologia 142 (3): 398–406. doi:10.1007/s00442-004-1734-9. PMID 15549403. Archived from the original on December 30, 2006. Retrieved 2009-02-13. 
  27. ^ Morrison, Scott A.; Bolger, Douglas T.; Sillett, T. Scott (2004). "Annual survivorship of the sedentary rufous-crowned sparrow (Aimophila ruficeps): No detectable effects of edge or rainfall in southern California" (PDF). The Auk 121 (3): 904–916. doi:10.1642/0004-8038(2004)121[0904:ASOTSR]2.0.CO;2. ISSN 0004-8038. Retrieved 2009-02-13. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!