Overview

Distribution

Range Description

Aimophila ruficeps occurs in south-west U.S.A. and much of Mexico (del Hoyo et al. 2011). The subspecies sanctorum of Mexico's Todos Santos Islands has not been observed on recent visits and is likely to be extinct (Wilbur 1987).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rufous-crowned sparrows are found from mid to southern California through northern Baja California in the coastal areas to southern Mexico, as well as many other parts of the American Southwest, excluding northeastern Arizona and northwestern New Mexico. These birds range as far east as mid-eastern Texas and as far north as southern Utah and Colorado.

Biogeographic Regions: nearctic (Native )

  • Collins, P. 1999. Rufous-crowned Sparrow. Pp. No.472, 1-28 in A Poole, P Stettenheim, K Kaufman, L Bevier, eds. The Birds of North America, Vol. 12, 1 Edition. Philadelphia, PA: The American Ornithologists' Union and The Academy of Natural Sciences of Philadelphia.
  • Peterson, R., V. Peterson. 1990. A Field Guide to Western Birds. Boston: Houghton Mifflin Company.
  • Robbins, C., B. Bruun, H. Zim. 1983. A Guide to Field Identification: Birds of North America. New York: Western Publishing Company.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) BREEDING: central California, northern Arizona, southwestern New Mexico, southeastern Colorado, northwestern and central Oklahoma, south discontinuously to southern Baja California and Mexico. NON-BREEDING: throughout breeding range except northeastern portion, where usually winters from northeastern New Mexico, northern Texas and south-central Oklahoma southward.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Rufous-crowned sparrows are medium-sized birds with red-capped heads and beige-gray breasts. They have black stripes on either side of their solid, gray-white throat. Males tend to have slightly larger wingspans and tail length than females.

Similiar species include Aimophila rufescens, Aimophila notosticta, Spizella passerina, and Zonotrichia leucophrys. Rufous-crowned sparrows differ from these species in their red-brown cap and solid-colored breast. American tree sparrows (Spizella arborea) also have the red cap, but do not have a rounded tail. Sparrows in the genus Aimophila can also be distinguished from other sparrows in the range of rufous-crowned sparrows by their beaks and tails, which are longer in proportion to their body size than in other sparrows. Males and females ares similar in color, but males tend to be larger than females.

Range mass: 15 to 23 g.

Range length: 13 to 15 cm.

Average wingspan: 196.85 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Sibley, D. 2001. The Sibley Guide to Bird Life and Behavior. New York: Alfred A. Knopf, Inc..
  • Sibley, D. 2003. The Sibley Field Guide to Birds of Eastern North America. New York: Alfred A. Knopf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 15 cm

Weight: 19 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species inhabits arid, rocky, open areas with varying elevation and heterogeneous vegetation, including low grasses and shrubbery. They are also found in open pine and oak forests. If a winter is particularly cold, these birds may move south or lower in elevation, but they do not move far from their breeding grounds.

Range elevation: 0 to 2195 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Rocky hillsides, steep slopes of grass and brush. In Mexico, found in arid scrub and pine-oak habitat. Nests on ground at base of rock, tuft of grass, or sapling; or 0.3-1 m above ground in branches of shrub or tree.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May withdraw from northern part of range for winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food habits depend on region and time of year. Grass, seeds and insects are primary foods. Rufous-crowned sparrows eat more plants such as knotweed (Polyugonum), chickweed (Stellaria media), filaree (Erodium), dock (Rumex), and wild oats (Avena) during the summer and spring. Grasshoppers (Acrididae), ground beetles (Carabidae), and ants (Formicidae) become a larger percentage of their diet during other parts of the year.

Animal Foods: insects

Plant Foods: leaves; seeds, grains, and nuts

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds on insects (beetles, crickets, grasshoppers, flies, caterpillars, etc.) and seeds of grasses and forbs. Forages on the ground or low in bushes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Rufous-crowned sparrows are primary consumers, as they eat vegetation. They are also secondary consumers, as they eat insects as well. These sparrows are preyed on by domestic cats (Felis silvestris) and probably predatory birds and snakes. Rufous-crowned sparrows can be hosts for the nest parasite, brown-headed cowbirds (Molothrus ater), though this is uncommon. They are also parasitized by two species of ticks (Amblyomma americanum and Ixodes pacificus).

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • brown-headed cowbirds (Molothrus ater)
  • ticks (Amblyomma americanum)
  • ticks (Ixodes pacificus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Domestic cats (Felis silvestris) prey on rufous-crowned sparrows. Behaviors towards Mexican jays (Aphelocoma ultramarina) suggest a possible predator/prey relationship. Other possible predators include American kestrels (Falco sparverius), white-tailed kites (Elanus leucurus), sharp-shinned hawks (Accipiter striatus), and Cooper's hawks (Accipiter cooperii). Snakes are probably important predators of eggs and nestlings, as they are in other Aimophila species.

Known Predators:

  • Domestic cats (Felis silvestris)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Estimated average territory size in southern California hard chaparral was about 1.5 hectares (Cody 1974).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Rufous-crowned sparrows have voices that have been described as "hoarse" and their call is a descending succession of staccato notes. This call, described by Collins (1999) as the Primary Song, is probably used by males to announce their territory and to attract a female mate. Rufous-crowned sparrows sing at a lower pitch during the nonbreeding season. Visual signs such as posture and vocal calls are used by the birds at specified times for several purposes. For example, males use a certain call when chasing intruders from their territory. Both males and females use vocal calls to give predator warnings. Warning calls are often nasal noises described as sounding like "dear." Aggressive sounds and postures are used during competition over territory between two males. Mates also sing songs to one another in order to recognize each other or to strengthen the pair's relationship.

Communication Channels: visual ; acoustic

Other Communication Modes: duets ; choruses

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The longest recorded lifespan for a rufous-crowned sparrow is 3 years and 2 months.

Range lifespan

Status: wild:
3.2 (high) years.

Average lifespan

Status: wild:
38 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 3.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

These birds find a mate in the spring and stay with the same mate through the winter and often through following mating seasons. Males attract a mate by singing from a visible perch or while flying. The mates sing duets together and to each other when they reunite in their territory. These songs are used for recognition and to strengthen the bond between them. Males are territorial during mating season, are not exceptionally aggressive in protecting their territory.

Mating System: monogamous

Reproduction varies by region and year-to-year with weather changes. For example, rainy weather seems to act as a cue for nesting, so nesting begins in early summer in Mexico, but much earlier in California, where rains begin earlier. The dates when eggs are laid also vary by region. Birds in California lay eggs earlier (Mar 11- Jul 10) than those in Texas (Apr 4- Sept 26). In some parts of their range, rufous-crowned sparrows nest twice per year based on rain patterns. It seems that these sparrows breed only when food is available (dependent on rainfall), which could result in increased survivorship of young.

Only female sparrows build nests. Nests are constructed of grass, bark, twigs, and hair, and are usually built in a shallow concavity in the ground. Once the eggs are laid, the female incubates until hatching. The young are altricial when hatched, and both parents help to find food and feed the hatchlings.

When the young birds leave the nest, they are as yet unable to fly and they continue to depend on their parents for food. The amount of time the fledglings are dependent on their parents is unknown, but they may not become independent until winter. The age of sexual reproductive maturity is also unknown, but it is assumed that the birds are over one year old before they reproduce.

Rufous-crowned sparrows tend to return to the same breeding ground year after year once a territory is chosen as an adult.

Breeding interval: Rufous-crowned sparrows may breed once or twice yearly depending on rain cycles.

Breeding season: Breeding can occur from early spring to early fall.

Range eggs per season: 2 to 5.

Range time to hatching: 11 to 13 days.

Range fledging age: 8 to 9 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 3.

Females incubate eggs for 11 to 13 days. They stay with the eggs except when foraging, at which time the male sparrow sometimes joins her. Females will abandon the nest easily if it is disturbed, and will not attack intruders. However, females do attempt to ward off those who come too close to the nest by flapping her wings and making loud noises.

Once the eggs hatch, the female is the exclusive brooder. Both male and female sparrows find food for the young. They will feed the offspring for an unknown period of time, even after the young leave the nest.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female); post-independence association with parents; extended period of juvenile learning

  • Collins, P. 1999. Rufous-crowned Sparrow. Pp. No.472, 1-28 in A Poole, P Stettenheim, K Kaufman, L Bevier, eds. The Birds of North America, Vol. 12, 1 Edition. Philadelphia, PA: The American Ornithologists' Union and The Academy of Natural Sciences of Philadelphia.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook. New York: Simon & Schuster, Inc..
  • Morrison, S., D. Bolger, T. Sillett. 2004. Annual Survivorship of the Sedentary Rufous-Crowned Sparrow (Aimophila ruficeps): No Detectable Effects of Edge or Rainfall in Southern California. The Auk, Vol.121: 904-916. Accessed November 11, 2006 at http://0-www.bioone.org.ariadne.kzoo.edu/perlserv/?request=get-document&doi=10.1642%2F0004-8038%282004%29121%5B0904%3AASOTSR%5D2.0.CO%3B2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size is 2-5 (usually 3-4). Incubation is by female. Altricial nestlings are tended by both parents.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aimophila ruficeps

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTGATCTTCGGCGCATGAGCCGGAATAGTAGGTACTGCACTAAGCCTCCTCATCCGAGCTGAACTAGGCCAACCTGGAGCCCTCCTAGGAGACGACCAAGTTTACAACGTAATCGTCACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATCATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCCTTCCCACGGATAAACAACATAAGCTTCTGACTACTCCCCCCCTCCTTTCTCCTCCTCCTAGCATCCTCCACCGTTGAAGCAGGTGTCGGCACAGGCTGAACAGTGTACCCCCCACTAGCCGGCAACCTAGCCCACGCCGGAGCCTCAGTCGACCTCGCAATCTTCTCACTACACCTAGCCGGTATCTCCTCAATCCTAGGAGCAATCAACTTCATCACAACAGCAATCAATATGAAACCCCCTGCCCTCTCACAATACCAAACCCCCTTATTTGTATGATCAGTCCTAATCACCGCAGTCCTACTCCTCCTATCTCTTCCAGTCCTAGCCGCAGGAATCACAATACTCCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCCGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTTTACATCTTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aimophila ruficeps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5