Overview

Brief Summary

Pooecetes gramineus

A medium-sized (6 inches) bunting, the Vesper Sparrow is most easily identified by its streaked body, reddish-brown shoulders, and dark tail with white edges. Similar in shape to the Song Sparrow (Melospiza melodia), this species may be distinguished from the Song Sparrow by that species’ browner body, dark breast patch, and rounder tail. Male and female Vesper Sparrows are similar to one another in all seasons. The Vesper Sparrow breeds across much of the northern United States and southern Canada. In winter, most populations migrate south to the southern half of the U.S.and northern Mexico. Vesper Sparrows are present all year in a few areas, most notably in California’s Central Valley. Vesper Sparrows inhabit open or sparsely-vegetated habitats, including grasslands, prairies, and scrubland. The clearing of land in the eastern U.S.and Canada for agriculture allowed this species to expand eastward onto farmland during the nineteenth century, although this species is now experiencing declines in these areas as abandoned fields are reclaimed by forest. Vesper Sparrows primarily eat seeds and grains, adding insects and other invertebrates to their diets during the summer when these sources of food are available. In appropriate habitat, Vesper Sparrows may be observed foraging for food on bare ground or on the lower stalks of grasses. Males may also be observed singing this species’ song, a series of whistling notes recalling that of the Song Sparrow but higher-pitched and less buzzing. Vesper Sparrows are primarily active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range extends primarily from east-central and southern British Columbia eastward across southern Canada to Nova Scotia, and south to eastern and southern California, central Nevada, Arizona, New Mexico, Kansas, Illinois, Tennessee, and North Carolina (Jones and Cornely 2002). Winter range extends across the southern United States from central California to South Carolina, and south to southern Baja California, southern Oaxaca, southern Tamaulipas, U.S. Gulf Coast, and Florida, with much smaller numbers wintering in areas farther north and south (Jones and Cornely 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 16 cm

Weight: 27 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Habitats include plains, prairies, dry shrublands, savannas, weedy pastures, fields, sagebrush, arid scrub, and woodland clearings (AOU 1983). In Iowa, breeding territories were along fencerows between agricultural fields (Rodenhouse and Best 1994).

Nests are on the ground, often in a small depression near a clump of grass (Harrison 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

This species migrates in flocks (25-30 or fewer), arrives in nesting areas in the northern U.S. and southern Canada in March-April (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on seeds, waste grain, and insects. Forages on the ground; sometimes takes food items from low foliage. Forages along fencerows, in weedy areas, etc. In North Dakota, grasshoppers were the principal food brought to week-old nestlings (Adams et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Pooecetes gramineus (meadow lark, chipping sparrow, clay-colored sparrow, vesper sparrow, horned lark, upland plover) preys on:
Insecta
Hemiptera
Diptera
Elateridae
Noctuidae

Based on studies in:
Canada: Manitoba (Grassland)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 383 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Population size is unknown but presumably exceeds 1,000,000. Rich et al. (2004) estimated population size at 30,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In Iowa, average territory size was 2.34 ha (Rodenhouse and Best 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 7.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

In Iowa, began establishing territories in second week of April. Clutch size usually is 3-5, sometimes 6. Both sexes (usually female) may incubate eggs for 11-13 days. Young leave nest 7-12 days after hatching. Individual females generally produce 2-3 broods per year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pooecetes gramineus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNCTATACCTAATCTTCGGTGCATGAGCCGGGATGGTAGGTACCGCCCTAAGCCTCCTTATTCGAGCTGAACTAGGCCAACCTGGAGCCCTTCTAGGAGACGACCAAGTATACAACGTAGTCGTCACAGCCCACGCTTTCGTAATAATTTTCTTCATAGTTATACCAATCATAATCGGAGGATTCGGAAACTGACTAGTTCCTCTAATAATCGGAGCCCCGGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTCCTCCTAGCATCCTCCACCGTTGAAGCAGGCGTTGGCACAGGCTGAACAGTATACCCCCCACTAGCTGGCAACCTAGCTCACGCCGGAGCCTCAGTCGACCTTGCAATTTTCTCCCTACATCTAGCCGGAATTTCCTCAATCTTAGGGGCAATCAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTCTCACAATACCAAACCCCCCTATTCGTATGATCAGTCCTAATTACCGCAGTTCTCCTACTCCTATCTCTCCCAGTCCTAGCCGCAGGAATCACAATACTACTCACAGACCGCAACCTTAACACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCTGTCCTATACCAACACCTATTCTGATTCTTCGGACACCCAGAAGTTTACATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pooecetes gramineus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in North America; large population size; major regional decline in eastern North America, due to reforestation, urbanization, and changing agricultural practices.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: BBS data indicate that the species is undergoing a slow decline that may be less than 10% over 10 years or three generations. Declines are widespread but pervasive in eastern North America.

Global Long Term Trend: Unknown

Comments: Long-term trend over the past 200 years is unknown. During the nineteenth century, the range expanded in eastern North America as forests were cleared for farming, and the species became relatively numerous in many areas where it was rare before European settlement (Jones and Cornely 2002). Since the 1940s, many farms have been abandoned and land has reverted to forest or developed for housing, resulting in vesper sparrow population declines in much of the east (Jones and Cornely 2002).

Breeding Bird Survey (BBS) data indicate a significant survey-wide decline averaging 1.0% per year during 1966-2007 and a significant survey-wide decline averaging 0.8% per year during 1980-2007. The decline for 1966-2007 amounts to 28% for this time period.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Declines in eastern North America appear to be a result of (1) reforestation and urbanization of grasslands and (2) agriculture practices, such as removal of hedgerows and more frequent mowing and haying (Jones and Cornely 2002). This species readily nests in agricultural areas (given compatible practices) and does not require pristine conditions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: Suggested restoration guidelines are to plant native warm-season grasses in old fields and to provide undisturbed sparse vegetation and song perches along borders of crops (Jones and Vickery 1997).

Preserve Selection and Design Considerations: Minimum grassland size is 30 acres (Jones and Vickery 1997).

Management Requirements: Breeding success probably would be greater in agricultural areas if the number of tillage operations was reduced and if crop residue was retained on fields (Rodenhouse and Best 1983).

In Saskatchewan, after an October prescribed fire, showed a preference for the burned area in the first year after the fire (Pylypec 1991). Jones and Vickery (1997) suggest burning in early spring or late fall; burn 20-30% of area annually in grasslands > 60 acres; do not burn more than 50-60% of area in any year for grasslands < 60 acres.

In North Dakota, reduction in grasshopper densities on vesper sparrow territories did not reduce survival or growth of nestlings compared to control areas; sparrows apparently compensated for reduced food by foraging farther from the nest (Adams et al. 1994). Nesting areas should be unmowed during breeding season; however, frequently mowed areas are favored for foraging. Tolerates moderate grazing which maintains 20-40% of vegetation at 10 inches (Jones and Vickery 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Vesper Sparrow

The Vesper Sparrow (Pooecetes gramineus) is a medium-sized American sparrow. It is the only member of the genus Pooecetes.

Adults have light brown upperparts and light underparts, both with darker streaking. They have a white eye ring and a long dark brown tail which shows white outer feathers in flight.

Their breeding habitat is open grassy areas across most of North America. The nest is an open cup on the ground under a clump of grass.

These birds migrate to the southern and central United States and Mexico.

These birds forage on the ground, mainly eating insects and seeds. Outside the nesting season they often feed in small flocks.

The male sings from a higher perch, such as a shrub or fencepost, which indicates his ownership of the nesting territory. The musical song begins with two pairs of repeated whistled notes and ends in a series of trills, somewhat similar to that of the Song Sparrow.

This bird's numbers are declining in the eastern parts of its range due to habitat loss.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!