Overview

Comprehensive Description

The Seaside Sparrow (Ammodramus maritimus) breeds from southern New Hampshire and Massachusetts (U.S.A.) south along the Atlantic coast to Florida and along the Gulf coast from Florida to Texas. It is closely tied to salt marshes--more so than any other North American songbird. With the exception of a few Florida populations, it is nearly always found in association with tidal marshes right along the coast. (Kaufman 1996; AOU 1998)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

The Seaside Sparrow breeds from southern New Hampshire and Massachusetts south along the Atlantic coast to northeastern Florida (south to the St. Johns River, formerly to New Smyrna Beach) and along the Gulf coast from western Florida (south to Tampa Bay) west to southeastern Texas (south to Corpus Christi area). The winter range extends south along the Atlantic coast from Massachusetts through the remainder of the breeding range (casually to southern Florida) and along the Gulf Coast throughout the breeding range and south to the mouth of the Rio Grande. The recently extinct form known as the Dusky Seaside Sparrow was resident along the coast of east-central Florida (eastern Orange and northern Brevard counties). The form known as Cape Sable Seaside Sparrow is resident in extreme southern Florida (southwestern Collier, Monroe, and southern Dade counties). (AOU 1998)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

endemic to a single state or province

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (250-20,000 square km (about 100-8000 square miles)) RESIDENT: Gulf Coast of Florida, from Wakulla County south to Pasco County (Post and Greenlaw 1994, Rodgers et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) BREEDING: from New Hampshire (Greenlaw 1992) and Massachusetts south along Atlantic coast to northeastern Florida, along Gulf Coast from western Florida to southeastern Texas (Post and Greenlaw 1994). Resident along coast in southern Florida and formerly in east-central Florida. In the northeastern U.S., the largest populations occur along the east shore of the lower Chesapeake Bay in Virginia and Maryland, and along the Atlantic shores of Virginia, Maryland, southern Delaware, and southern New Jersey (including lower Delaware Bay) north to Ocean County; fairly large populations also occur in southwestern Long Island (Greenlaw 1992). Patchy distribution. NON-BREEDING: south along Atlantic coast to southern Florida, and west to the Rio Grande; mainly from South Carolina to east-central Florida and from northwestern Florida to southern Texas (Greenlaw 1992). Christmas Bird Count data show that Atlantic coastal birds are primarily concentrated from the central South Carolina coast (Charleston County) south to northeastern Florida (Nassau and Duval counties) (Robbins 1983, Root 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 15 cm

Weight: 24 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

The long bill, yellow patch before the eye, streaked plumage, and short pointed tail are diagnostic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: BREEDING: A habitat specialist that occupies coastal tidal marshes throughout its range (Kale 1983, Robbins 1983). One (A. Mirabilis) population in Florida commonly occurs in freshwater Muhlenbergia (M. FILIPES, a tussock grass) prairie (Werner and Woolfenden 1983), and another near Charleston, South Carolina, evidently avoids the outer coastal marshes for breeding and uses brackish, more sheltered marshes away from the coast (Sprunt and Chamberlain 1970). Northeastern birds occupy both high marsh (dominated by salt meadow vegetation including salt-meadow grass (Spartina patens), black-grass (JUNCUS GERARDI), glasswort (Salicornia spp.), and marsh elder (Iva frutescens)), and low marsh (mainly various ecological forms of smooth cordgrass (Spartina alterniflora)) habitats (Woolfenden 1956, Post 1970, 1970, 1974, Reinert et al. 1981, Greenlaw 1983, Marshall and Reinert 1990). Descriptions of habitat elsewhere in the range can be found in Nicholson (1928, 1946), Tomkins (1941), Sprunt and Chamberlain (1970), Werner (1975), Sykes (1980), Post (1981), Kale (1983), Post et al. (1983), and Werner and Woolfenden (1983).

A patchy or discontinuous distribution on local marshes is exhibited throughout the range. The composition and physiognomic characteristics of occupied marsh vegetation are varied and reflect a behavioral opportunism in using available substrate (Greenlaw 1983, Post et al. 1983). Two biologically significant habitat characteristics evidently shared by most or all breeding populations are: (1) suitable elevated nest sites that offer protection from periodic tidal and storm-related flooding, and (2) nearby openings in the vegetation, or pool and ditch edges that permit access to the bases of rooted plants and open mud during foraging (Greenlaw 1992). Different microhabitats fulfill these divergent requirements for nesting and feeding. In low marshes in New York and New England, nests are commonly in areas of medium-height cordgrass (40-100 cm) growing densely enough to form a turf of partly clumped, semi-erect, persistent stems in the spring. Stands of dwarf cordgrass at or near mean high water level, and tall, open stands in the lower intertidal zone are avoided as nesting substrates. In high marshes, sparrows nest on IVA-dominated spoil deposits, or in IVA/salt meadow ecotones on the inner marsh, but they shun extensive areas of pure salt meadow grasses. Optimum habitat contains nesting and feeding microhabitats in close proximity, otherwise sparrows commute between a nest-centered territory and more distant undefended (but see DeRagon 1988) feeding areas (Tomkins 1941, Woolfenden 1956, Post 1974, Greenlaw 1983, 1992, Post et al. 1983, Marshall 1986, DeRagon 1988, Marshall and Reinert 1990).

NEST SITES: Typically elevated high enough in suitable vegetation to minimize the problem of normal flooding and low enough to be sheltered from predators and weather (Woolfenden 1956, Greenlaw 1983, Post et al. 1983, DeRagon 1988, Marshall and Reinert 1990). In New York, mid-summer nests suspended in new-growth cordgrass averaged 19.0 cm above the mud (Post 1974). Early nests are typically placed in clumps of residual cordgrass, but later nests are in the vegetation column between erect, live culms of cordgrass (Post 1974, Marshall and Reinert 1990). In the latter case, the tops of the grasses are often pulled over the nest to form a canopy (Greenlaw, pers. obs.). Occasionally, nests are placed one to four m above the ground in a shrub (usually IVA spp. in the Northeast) or small tree (Arnow 1906, Woolfenden 1956, Marshall 1986, Greenlaw 1992). In Florida, the activity of predatory rats influences nest site use by sparrows (Post 1981).

NON-BREEDING: Populations along the southeastern Atlantic and Gulf coasts are nonmigratory and continue to occupy their breeding marshes during the nonbreeding season. In some of these populations, there may be local or regional dispersal as birds respond to seasonal changes in food. Near Charleston, South Carolina, young leave the brackish, subcoastal, breeding marshes shortly after they are able to fly and move into the outer coastal marshes (Sprunt and Chamberlain 1970). In New York, post-breeding birds frequent the tall stands of cordgrass along the bay edges where they harvest the rich supply of seed (Greenlaw 1992). Beyond the fact that the birds remain in tidal marshes during the winter, little is known about the characteristics of the wintering habitat of northeastern sparrows.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Seaside Sparrow inhabits coastal tidal marshes. In Florida, the now extinct form known as the Dusky Seaside Sparrow nested in fresh or brackish marshes in some areas; in parts of extreme southern Florida, the Cape Sable Seaside Sparrow still does so. (Kaufman 1996)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Populations in southeastern U.S. are nonmigratory or make local migrations. Northern populations are migratory and winter probably along the Atlantic coast of the southeastern U.S. Winter departures occur in populations at least south to North Carolina (Tomkins 1941).

In some years, sparrows in New York return to breeding marshes as early as mid-April, but the usual arrival time for vanguard birds in this region is the last week of April (Bull 1964, J. Greenlaw, unpubl. data). First arrival in southern New Jersey is also late April (Stone 1937, Woolfenden 1956). Early birds in Massachusetts appear during the first week of May (Marshall 1986, Marshall and Reinert 1990, Greenlaw 1992). Males arrive ahead of females, and older males before one-year-old males (J. Greenlaw, unpubl. data). The median dates of spring arrival for all sparrows in a Long Island low marsh was May 5 (early season) and May 18 (typical season) (J. Greenlaw, unpubl. data). Based on 30 years of records in Connecticut, Saunders (in Robbins 1983) found the median date of spring arrival to be 18 May.

Fall departures in the Northeast span a period from mid-September to at least mid-November, when autumn movement is essentially complete. The fall peak of migration on Long Island occurs in mid-October (Cruickshank 1942, Bull 1964, 1974). A few individuals are usually detected in early winter on Christmas Bird Counts as far north as Cape Cod (Hill 1965), but in most winters lingering birds in New York and southern New England probably leave later or succumb since marshes generally freeze over during much of January and February. The relative incidence of birds detected in Christmas Bird Counts areas along the Atlantic and Gulf coasts was evaluated by Robbins (1983) and Root (1988).

Winter resident birds begin arriving in Georgia and Florida as early as 3-4 October (Robbins 1983). There are no winter recoveries of sparrows banded on breeding areas in the Northeast, so it is unknown where most birds from different northern populations spend their winters. Overall, it seems that Atlantic birds winter mostly from the central South Carolina coast south to northeastern Florida (Robbins 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats mainly insects and other small invertebrates, also seeds of marsh plants (Terres 1980). In north, seeds of Spartina alterniflora are used heavily prior to fall migration (Greenlaw 1992). In north, forages on exposed ground, on patches of wrack, among marsh vegetation, and sometimes in shallow water; in Florida, obtains most food from vegetation (see Greenlaw 1992). In Massachusetts, the banks and exposed bottoms of mosquito ditches and tidal creeks were the principal foraging areas; also foraged in short Spartina alterniflora habitats (Marshall and Reinert 1990). Northern sparrows forage mainly in open stands of cordgrass, along bay or marsh edges, on patches of wrack, along the edges of pools and ditches, and in muddy Salicornia spp. pannes (Woolfenden 1956, Post 1974, Merriam 1979, Delaney and Mosher 1983, Greenlaw 1983, Post et al. 1983). They obtain their arthropod prey by either walking on the marsh substrate, or by climbing through the matrix of vegetation above the ground. From the ground, they glean insects from vegetation by stretching their neck, lunging, or chasing, and they probe or peck mud and water surfaces. They also wade into shallow water. Only rarely do they hover or flycatch. Above the ground, sparrows peck at vegetation and snap at flying insects (Post et al. 1983; J. Greenlaw, pers. obs.). Both the vegetation column and the marsh substrate are significant sources of food in northern marshes, but only the vegetation is important to birds in Florida (Post et al. 1983).

There is little quantitative information on the diets of adults. Judd (1901) found that about 70% of the food consumed consisted of arthropods, mainly insects and spiders, while the balance was seeds of marsh plants. Martin et al. (1951) reported that 94%, 100%, and 40% of the spring, summer, and fall diets, respectively, were comprised of invertebrates. The following invertebrate taxa have been found in the adult diet: Annelida (marine worms), Gastropoda (small snails), Decapoda (small crabs), Amphipoda (sand fleas), Araneida (spiders), Homoptera (leafhoppers), Hemiptera (true bugs), Diptera (flies, adults and larvae), Lepidoptera (moths), Orthoptera (crickets and grasshoppers), Odonata (dragonflies), and Hymenoptera (wasps) (Judd 1901, Howell 1924, Obersholser 1938, Martin et al. 1951, Sprunt 1968). In the north, the seeds of Spartina alterniflora are used heavily by post-breeding birds before migration (J. Greenlaw, pers. obs.).

The diets of nestlings in the Northeast are much better known (Merriam 1979, 1983, Post et al. 1983). In a low marsh in New York, invertebrates from at least 38 taxa were fed to nestlings, while in a neighboring high marsh, invertebrates from 25 groups were provided by the adults. The major taxa represented were Insecta (at least 37 families), Araneida (5 families), Acari, Pseudoscorpionida, Amphipoda, Isopoda, and Mollusca (Merriam 1979). Diptera were the most important food for nestlings in low and high marshes. In the ditched high marsh, the tabanid flies, TABANUS NIGROVITTATA and Chrysops spp., constituted 71% of the overall diet, while in the unaltered low marsh, tabanids, stratiomyid flies (especially Odontomyia MICROSTOMATA), and noctuid and pyralid moths made up 70% of the diet. Mirids (Hemiptera) also were consumed in large numbers but comprised relatively little bulk (Merriam 1979).

Nestling dietary composition changes seasonally to reflect available stocks of invertebrates (Merriam 1983, Post et al. 1983). Mud-inhabiting prey groups (e.g., stratiomyid and dipteran larvae) were taken in proportion to availability in the mud, while some prey groups in the vegetation (Diptera, Lepidoptera, Araneida) were exploited disproportionately to their availability (Merriam 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

The Seaside Sparrow eats mainly insects and other invertebrates and (especially in fall and winter) seeds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Estimate of 5,000-10,000 pairs in 1979-1980 and 1987 (Rodgers et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

BREEDING DENSITY: The territory is nest-centered and usually is enclosed within a larger, undefended home range (activity space) that includes additional feeding sites (Post 1974). Population sizes can vary from one or two territorial males isolated on a marsh to many dozens of males on contiguous or overlapping activity spaces (Post 1974, Greenlaw 1983, Post et al. 1983). Only a few studies supply information on breeding densities in the Northeast. With one exception on Long Island, densities ranged from 64-214 singing males per square km on marshes from Maryland to New York (Post 1970, Robbins 1983). Post (1970) reported an exceptionally high density of 2,000 males per square km on an unaltered low marsh on Long Island. On the same marsh several years later, Greenlaw (1983) found 982 males per square km. The two latter values are ecological densities (unsuitable habitat and a tidal pool were excluded from calculations), while most or all of the values reported elsewhere (see Robbins 1983 for summary) are crude densities. Post's (1970) value may be exceptionally high because his survey focused on a relatively small area of the marsh (2.75 ha) that contained a dense cluster of territories (see Post 1974). Densities in New England varied from two to 114 males per square km (Reinert et al. 1981, Marshall 1986, DeRagon 1988, Marshall and Reinert 1990). The mean density in the region for all types was 30.1 males per square km. These are all crude densities. Ditched and unaltered marshes usually support different densities, with highest densities in the latter habitat (Post 1970, 1974, Reinert et al. 1981, Greenlaw 1983, DeRagon 1988). In Rhode Island, mean density was 14 males per square km and 55 males per square km in ditched and unditched marshes, respectively (DeRagon 1988). On a Gulf Coast marsh in Florida, breeding densities in the race PENINSULAE varied from 158-260 males per square km between 1980-89 (Post 1981, McDonald 1982, 1983, 1984, 1989, 1990). In Massachusetts, breeding territory size was 1290-10,423 square meters (mean = 3953) (Marshall and Reinert 1990). In New York, territory size was 0.01-0.9 ha, overall home range size was 0.02-1.76 ha (Post 1974); average size of activity spaces ranged from 0.12 ha in New York to 3.6 ha in Florida (Werner 1975, Post et al. 1983, Greenlaw 1992). Space use varies between populations within and between regions (Post 1974, Werner 1975), but there is no evidence that any population is nonterritorial (Stimson 1968, Werner and Woolfenden 1983).

DISPERSION ON MARSHES: The patchy, uneven dispersion of breeding sparrows on marshes, and their absence from apparently suitable microhabitat in some areas, have led authors to describe the bird as "colonial" or "semicolonial" (e.g., Nicholson 1928, 1946, Stimson 1968, Werner 1975, Austin 1983). This is misleading since evidence suggests that clusters of territories simply reflect a common response to widespread patterns of temporal and spatial heterogeneity in saltmarsh vegetation (Post 1974, Greenlaw 1983, Post et al. 1983). The absence of breeding birds from seemingly suitable areas can be a simple consequence of low population size and poor recruitment.

SURVIVAL AND REPLACEMENT RATE: Based on cumulative return rates, adult survival was estimated to be 57-60% for a population on an unaltered low marsh in New York (Post et al. 1983). Two Florida populations had minimum return rates for adults of 85.7% (PENINSULAE) (Post et al. 1983) and 88% (Mirabilis) (Werner 1975). Post-fledging survival to independence of birds banded as nestlings in New York was 36% (Post and Greenlaw 1982). The estimated lifetime reproductive output of an average female (replacement rate) of 2.72 (2-year average) in a New York population suggests that the population was increasing (Post et al. 1983). This population exhibited an exceptionally high breeding density (Post 1970). In Florida, the replacement rate for A. M. PENINSULAE averaged 1.11, indicating that the population was just maintaining itself. These populations were in low marsh habitats; no similar data are available for high marshes.

FIDELITY: Adults are highly philopatric, and some first-year birds in New York return to breed in their natal marshes (Greenlaw 1992).

NON-BREEDING: Remarkably little is known about the behavior and ecology of northern sparrows on their wintering grounds. Burleigh (1958) commented that northern sparrows in Georgia confined their activity to dense saltmarsh grasses where they were quiet and inconspicuous. In the Southeast, they mingle with the resident birds.

PARASITES: Do not seem to represent a serious problem. Apparently healthy sparrows often carry body loads of endoparasites (Trematoda, Cestoda, Nematoda, and Acanthocephala). Acanthocephalans are especially prevalent in the blood of birds in the Carolinas (Hunter and Quay 1953). For most endoparasite groups, immature birds have larger body loads than adults (Hunter and Quay 1953). The blood fluke Pseudospelotrema ammospizae (Trematoda) was originally described from the seaside sparrow (Hunter and Vernberg 1953). Ectoparasites (Mallophaga, Diptera: Hippoboscidae, Acarina) are also present (Post and Enders 1970, Greenlaw 1992), but infestations tend to be small and occasional in New York birds (Greenlaw 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

The Seaside Sparrow forages on the ground and in low vegetation at the water's edge (Kaufman 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

PHENOLOGY AND CHRONOLOGY: Median date of first egg-laying varies between years at given localities, depending on earliness of the season. In New York, first eggs usually appeared in nests from 13 to 16 May (Greenlaw 1992), in Rhode Island about 23 May (DeRagon 1984), and in Massachusetts from 25 to 26 May (Marshall and Reinert 1990). The average date of initiation of first clutches in New York was 19 May, whereas it was 20 July for last clutches (Post et al. 1983). Egg dates ranged seasonally from 17 May to 25 July in New York (Greenlaw 1992), from 27 May to 21 August in Rhode Island (DeRagon 1984), and from 25 May to 30 July in Massachusetts (Marshall and Reinert 1990).

Incubation begins with the laying of the last or next to the last egg (Greenlaw 1992). Incubation period varies from 11-14 days (mean = 12.2 days in New York, 12.4 days in Massachusetts) (Worth 1972, Marshall and Reinert 1990, Greenlaw 1992). Young are tended by both parents and leave nest at 9-11 days, unable to fly. Adults continue to feed young out of the nest for an additional 20 days (DeRagon 1988, Greenlaw 1992). In New York, nestlings started appearing as early as the end of May and the first few days of June, while nests containing young occurred as late as 14 August (Greenlaw 1992). The length of the nesting cycle from start of nest construction to fledging averaged 28.7 days (range = 27-30 days) (Marshall and Reinert 1990).

Two broods are reared successfully by some pairs in New York (Greenlaw 1992), but Marshall (1986) felt that only one brood was attempted in Massachusetts. In New York, the interval between renesting and nest failure was 5.5 days (Post et al. 1983), and in Massachusetts, it was 6.0 days (range = four to eight days) (Marshall and Reinert 1990). The interval in a Florida population was 7.6 days (Post et al. 1983). The time from fledging to the initiation of a new clutch on Long Island was 17.5 days (Greenlaw 1992). Breeding season length varied between years from 67-88 days, averaging 76.8 days in New York (Post and Greenlaw 1982). In contrast, total season length averaged 96 days in a Florida population (Post et al. 1983). In Massachusetts, spring tide flooding commonly destroyed early nests; birds renested after nest loss and after fledging young from a previous nest (Marshall and Reinert 1990). In the north, an average of about one-third of eggs yielded fledglings; in Florida, fledging success was only 3% due to high rate of predation, especially by rice rats (Oryzomys palustris) (Post et al. 1983).

MATING: Monogamous, territorial, and altricial. No cases of natural polygyny are known, although males can be induced to accept more than one mate (Greenlaw and Post 1985). Mates remain paired throughout the breeding season (Greenlaw and Post 1985). The female alone builds the nest, incubates eggs, and broods young. On average, males and females provide parental care about equally to dependent young (Post 1974, Post and Greenlaw 1982).

DISPLAY AND SONG: The display repertoire has been examined in New Jersey (Woolfenden 1956), Florida (Werner 1975, McDonald 1983, Werner and Woolfenden 1983), and New York (Post and Greenlaw 1975). Repertoire composition appears to be very similar in all these populations. Northern sparrows employ 14 visual displays and 15 vocal displays in their social system (Post and Greenlaw 1975, Greenlaw 1992). The male's primary song is short (about one second in length) and low-pitched (Borror 1961, Post and Greenlaw 1975). Song structure varies in some details between populations, but not markedly (Hardy 1983, McDonald 1983, Werner and Woolfenden 1983). In the Northeast, song begins with a brief series of sharp notes, and sometimes a short trill phrase, followed by a longer, buzzy trill that is highly frequency modulated. This wheezy, unmusical song and associated behavior commonly receive incidental attention in general accounts (e.g., Howell 1924, 1932, Forbush 1929, Stone 1937, Saunders 1951, Bull 1974, Lowery 1974, Peterson 1980). McDonald's (1989) experimental study in Florida confirmed that primary song contains information that permits the male to establish and hold a territory (agonistic function) and to attract and retain a mate (sexual function). The male also performs a towering flight display that incorporates a complex song vocalization (Post and Greenlaw 1975).

CLUTCH SIZE: In northeastern populations, varies from three to six eggs. Two-egg clutches are very rare and are perhaps incomplete (Post and Greenlaw 1982, Post et al. 1983, Marshall and Reinert 1990). Mean clutch size in populations from New Jersey to Massachusetts was 3.7 eggs (Woolfenden 1956, Post and Greenlaw 1982, Marshall 1986). Average clutch size varies seasonally. Modal clutch size on Long Island in early nests was four eggs, while it was three eggs in later nests (Greenlaw 1992). Clutch size also averages larger in northern than in southern populations; mean clutch size in two Florida populations was 3.2 eggs, about 0.5 eggs smaller than clutches of northeastern sparrows (Post et al. 1983, Werner and Woolfenden 1983).

BREEDING SUCCESS AND PRODUCTIVITY: Reproductive success has been studied in New York (Post 1972, 1974, Post and Greenlaw 1982, Post et al. 1983), Massachusetts (Marshall 1986, Marshall and Reinert 1990), and Florida (Post et al. 1983). Nest mortality is high in all populations, but especially in Florida. The average (all 2-year averages) egg had a 34.4% chance of becoming a fledgling in New York (Post and Greenlaw 1982), a 32.4% chance in Massachusetts (Marshall and Reinert 1990), and only a 3% chance in Florida (Post et al. 1983). However, there is considerable variation between years in average breeding success within a region. In New York, the extremes were 19.8-47.7%, and in Massachusetts 22.1-42.6%. These differences reflected variation in predation (New York) and flooding risks, which are the main causes of nest failure in the Northeast (Post et al. 1983, Marshall and Reinert 1990).

Occasional storm-driven high tides and heavy rain in New York, and monthly spring high tides in Massachusetts, sometimes caused catastrophic mortality in poorly elevated nests still active at the time of flooding. Sparrows suffering nest loss responded by quickly renesting. The first egg in the replacement nest is laid as early as three to four days following destruction of a nest (Marshall and Reinert 1990, Greenlaw 1992). Habitat differences in overall breeding success are evident as well. Post (1972, 1974) found in New York that 47.0% of sparrow nests in a low marsh fledged young, while in a high marsh nearby, the average was 66.1%. In New York, annual productivity averaged 4.41 young per female and ranged between 3.38-5.57 young per female in different years. The only comparative data are for a Florida population for which productivity was 0.58 young per female per year (Post and Greenlaw 1982, Post et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In non-migratory southern populations of the Seaside Sparrow, members of a pair may stay together on the nesting territory year-round. The nest, which is built by the female alone, is constructed in marsh vegetation just a few inches above the highest tides. Three to four eggs are typical (range two to five). The eggs are bluish white to pale gray and incubation (by female only) is 12 to 13 days. Both parents feed young. Young leave the nest 9 to 11 days after hatching, but cannot fly for another week or so. After fledging, young may continue to be fed by their parents for several weeks. (Kaufman 1996)

Hill and Post (2005) used genetic markers to estimate the prevalence of extra-pair paternity in a population of Seaside Sparrows in South Carolina. They concluded that about 11% of chicks were sired by a male other than the (behaviorally) putative father and that these chicks occurred in just 17% of the broods studied. This is an unusually low rate of extra-pair fertilization based on comparison with related species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Systematics and Taxonomy

As a result of the patchy distribution of its habitat, several forms of Seaside Sparrow with distinctive appearance evolved in relative isolation. One, the Cape Sable Seaside Sparrow, was not discovered until 1918; another, the Dusky Seaside Sparrow, became extinct in the late 1980s despite extreme (if belated) conservation efforts. (Kaufman 1996)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ammodramus maritimus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATCTTCGGCGCATGAGCCGGAATGGTGGGTACCGCCCTAAGCCTCCTCATTCGAGCTGAACTAGGCCAACCCGGGGCTCTCCTGGGAGACGACCAAGTATACAACGTAGTCGTCACAGCCCATGCTTTCGTAATAATCTTCTTCATAGTCATACCAATTATAATCGGAGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTACTCCCCCCATCTTTCCTCCTCCTCCTAGCATCCTCTACCGTTGAAGCAGGTGTCGGTACAGGCTGAACAGTATACCCCCCACTAGCCGGCAACCTAGCCCACGCCGGAGCCTCAGTCGACCTTGCAATCTTCTCCCTACACTTAGCTGGTATTTCCTCAATCCTAGGAGCAATCAACTTCATCACAACAGCAATCAATATGAAACCCCCCGCTCTCTCACAATACCAAACCCCCCTATTTGTATGATCAGTCCTAATTACCGCAGTCCTCCTCCTACTATCTCTCCCAGTCCTTGCTGCAGGAATCACAATACTTCTCACAGATCGTAACCTCAACACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCCGTCCTATACCAGCACCTATTCTGATTCTTCGGACACCCAGAAGTTTACATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ammodramus maritimus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: T3 - Vulnerable

Reasons: Restricted geographic range, but fairly numerous within range, some EOs protected, but no enormous or immediate threat to habitat (suggests G4T3)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The last known individual of the form known as the Dusky Seaside Sparrow (from Brevard County, Florida) died in 1987 (see Zink and Kale 1995 for a discussion of the last ditch efforts to save this bird through captive breeding). The Cape Sable form of extreme southern Florida is listed as endangered under the U.S. Endangered Species Act (e.g., USFWS 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Threats include loss and degradation of habitat (e.g., by ditching); may survive in some ditched marshes at lower population density (Greenlaw 1992). The major threat is coastal development and the consequent loss and degradation of habitat through filling, draining, diking, and pollution (Post and Greenlaw 1994). Since the mid-1950s, estuarine wetland loss in the U.S. coastal zone has accelerated to about 0.5% annually. Tidal wetland destruction has occurred in all coastal states, but in the East, losses have been greatest in Florida, Louisiana, New Jersey, and Texas (Tiner 1984). Since the 1700s, an estimated 40% of tidal marshes on Long Island have been destroyed (G. Richard, pers. comm.). By 1938, about 90% of salt marshes from Virginia to Maine were ditched (Nixon 1982). Significant populations are present in all these regions. Most coastal states have enacted special laws to protect estuarine wetlands, but these vary markedly in the extent of protection provided (Tiner 1984). Early symptoms of population trouble are the reduced number of extant populations in a region and the smaller sizes of those that remain. Sparrows are sufficiently adaptable to be able to persist as one or two isolated pairs in a remnant marsh (Greenlaw 1992). However, small populations resulting from diminished marsh size face the increased likelihood of stochastic extinction. This stage is already in progress nearly everywhere along the Atlantic and Gulf coasts. Local losses are cumulative until regional extirpation and range contraction occur. The final stage (extirpation) has been achieved along the Atlantic coast of Florida (Kale 1983). There is no evidence that disease is an important limiting factor, but this may be partly because of a lack of study. A low incidence of pox disease occurs in New York (Greenlaw 1992). Terrestrial and avian predators are an important secondary source of nest mortality in New York and New England (Post et al. 1983, Marshall and Reinert 1990). Known predators on adults or their nests in the Northeast are Norway rats (Rattus norvegicus), northern harriers (Circus cyaneus), fish crows (Corvus ossifragus), and garter snakes (Thamnophis sirtalis) (Post et al. 1983, Greenlaw 1992). The American crow (C. BRACHYRHYNCHOS) and common grackle (Quiscalus quiscula) in New England (Marshall and Reinert 1990), and ardeids on Long Island (Greenlaw 1992) may be problems as well. Predation was low (about 11%) in Massachusetts (Marshall and Reinert 1990), but it was an important secondary source of mortality in New York (Post et al. 1983), and the primary cause of nest loss in Florida (Post 1981, Post et al. 1983). The rice rat took more eggs than young in Florida, but the reverse was true in New York where Norway rats are significant predators (Post et al. 1983). Austin (1983) mentioned other species, including microtine rodents, that may be important predators within the range. On Long Island, the meadow vole (Microtus pennsylvanicus) sometimes uses abandoned sparrow nests (Greenlaw 1992), though there is no evidence that this rodent is a nest predator or that it actively evicts sparrows from their nests. In one case, W. Post (pers. comm.) witnessed an adult drive a vole from the vicinity of its nest. Tidal and weather-related flooding is a significant mortality factor, especially in northern populations (Post et al. 1983, Marshall 1986, Marshall and Reinert 1990). Sparrows adaptively compensate for this ever-present risk to their nests by quickly renesting and by elevating their nests in the vegetation (Marshall and Reinert 1990). Hurricanes represent a substantial risk to coastal species, especially to those in the Southeast. Mirabilis was extirpated from its type locality by a hurricane that struck Cape Sable, Florida, in 1935 (Stimson 1968). Fires are an important factor in some populations in Florida, both from a detrimental (Austin 1983) and beneficial (Werner and Woolfenden 1983) standpoint. Except in certain local areas, fire is not important as an ecological factor in northeastern marshes. Where it does occur, fire tends to be restricted to high marsh environments that support few sparrows or none at all. Fire also occurs as a postbreeding factor rather than during the breeding season. The greatest impact of fire on breeding sparrows might be to destroy clumps of persistent, overwintering marsh grasses that they use as vernal nest sites. Natural successional changes (primary succession) that convert low marsh to high (Niering and Warren 1980) represents a problem over a period of several hundred years (Redfield 1972). High marshes provide suboptimal or marginal habitat (Reinert et al. 1981), so long-term changes in population productivity resulting from succession can be expected even in protected tidal wetlands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Seaside Sparrow is threatened by ongoing destruction of its coastal marsh habitat, which led to the destruction of the form known as the Dusky Seaside Sparrow in the late 1980s. (Kaufman 1996)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Global Protection: Few (1-3) occurrences appropriately protected and managed

Comments: Estimated 25% of available habitat is considered protected (Cox et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Restoration Potential: Capable of scaling important aspects of its behavior to spatial and temporal variation in environmental factors, thus minimizing the effects of this variation on reproduction (Post 1974). In low marsh habitats, New York and Florida populations were able to achieve growth or stabilizing replacement rates in the face of unusually high predation or catastrophic nest losses from flooding (Post et al. 1983). Adults renest quickly and synchronously after flood-related nest destruction (Marshall and Reinert 1990) and readily colonize newly available microhabitats on marshes (Post 1974). There are limits to this adaptability. Although sparrows are able to utilize some human-modified (ditched) marshes, they do so only at reduced densities and are absent on other altered marshes (Stoll and Golet 1983). Since this sparrow tends to occupy an intermediate position along moisture gradients in tidal marshes (Sharp 1969, 1970; Greenlaw 1983), any change that creates drier or wetter conditions will tend to affect it adversely. This sparrow's biological characteristics as an opportunistic species adapted to an unpredictable and variable environment give it a high management potential, as long as its microhabitat requirements are maintained.

Preserve Selection and Design Considerations: In much of its range, a specialist on Spartina alterniflora. For this reason, not only are these birds sensitive indicators of the health of tidal wetlands, but they are also vulnerable to habitat modification. Saltmarsh protection is paramount for their survival. In many areas, especially in New England and parts of Florida, populations are small and widely scattered, so local losses quickly lead to range contraction (Sykes 1980, Kale 1983). Simple marsh protection may not always be sufficient to stem local extinctions since small populations are notoriously subject to stochastic processes. Recent studies (Greenlaw 1983, Stoll and Golet 1983, DeRagon 1988, Marshall and Reinert 1990) showed that certain vegetative and physiognomic characteristics associated with small changes in marsh relief were the principal factors affecting sparrow dispersion and density in the Northeast. Optimal habitat is found in unaltered low marsh that contains expanses of medium-height cordgrass with medium to high stem density and a turf of clumped, residual stems. Spots that are not subject to regular and extreme flooding from tides and that have pools or open muddy areas are especially suitable (Post 1970, 1974). Stoll and Golet (1983) discovered that this microhabitat profile occurred at eight of nine sites in Rhode Island where seaside sparrows were observed. These characteristics were absent or confined to small areas at 24 other uninhabited marshes. A similar pattern was found on Long Island (Greenlaw 1983). High marshes that support sparrows fulfill the birds' basic requirements in other ways, but not all high marshes provide compensating conditions. In general, large marshes are preferred over small areas of remnant marsh. The key requisite is that populations should be as large as possible in each favorable locality. This means that the mix of preferred microhabitats should be as expansive as possible (Greenlaw 1992).

Management Requirements: Management intervention may be necessary to enhance or restore habitat. Since poorly-drained sections of tidal wetland where medium-length cordgrass grows is favored, managers should consider blocking selected ditches on altered marshes to create additional habitat. Intervention that forms a mosaic of habitat patches consisting of favorable nesting substrate and suitable foraging sites should increase local populations significantly. Predator control may be necessary in some areas. On high marshes, shallow pools constructed near spoil deposits (soon colonized by IVA spp.) should encourage sparrows to settle, albeit at relatively low densities (Greenlaw 1992, Post and Greenlaw 1994). Controlled burning during the August-November wet season maintains favorable habitat (Post and Greenlaw 1994). Densely vegetated areas should be burned every five years and less dense areas every 8-10 years, with no more than 10% of the available habitat for a population burned in any given year.

Management Research Needs: From Greenlaw (1992): The primary objectives of any management program should be to maintain present distribution and abundance in regions where current vulnerability is low and to undertake wetland enhancement steps to improve numbers where they are at greater risk. Research needs that particularly address these concerns are most appropriate. Following are some pertinent questions:

1) What are the present patterns of distribution and abundance in each region? To answer this, surveys must be conducted on specific marshes. State Breeding Bird Atlas surveys do not supply this information because they vary in quality and do not provide data on numbers of birds on specific marshes.

2) How variable are annual productivity and survival within and between populations, and how much recruitment occurs between marshes in a local area? At the moment, only one population in the Northeast (New York) has been studied sufficiently to characterize most of these parameters (Post and Greenlaw 1982, Post et al. 1983, Greenlaw 1992), but this population may be atypical since sparrow density was exceptionally high during the years of investigation (Post 1970). Nest studies and banding programs in selected populations should be undertaken.

3) Where do sparrows from the Northeast spend the winter? Further information on the wintering ecology and behavior of sparrows in southeastern marshes should be gathered. In conjunction with color-marking programs in selected populations in the Northeast, intensive searches for marked birds employing cooperators in the Southeast should be undertaken in potential wintering marshes. The localized nature of saltmarshes and the sparrow's habitat specialization make this approach feasible.

4) How are sparrows affected by ongoing "open marsh water management" programs? These programs represent a developing strategy to control mosquito populations while minimizing changes in normal marsh hydrology (Lent et al. 1990). Maryland, Delaware, New Jersey, and Massachusetts have been especially active in pursuing such programs on an experimental basis (Nixon 1982, Lent et al. 1990), but the effects of such programs on populations are not yet known.

Research efforts of this sort must be long-term enterprises. To reduce uncertainties related to multi-year commitments of time and effort by academic investigators, the task of undertaking and coordinating these efforts should reside with federal (U.S. Fish and Wildlife Service) and state nongame wildlife agencies. The actual field work could be performed by personnel at research-oriented wildlife observatories and field stations (e.g., Manomet Bird Observatory, Manomet, Massachusetts; Seatuck Foundation Environmental Program at Seatuck National Wildlife Refuge, Islip, New York; Cape May Bird Observatory, Cape May, New Jersey), or by other biologists under contract to appropriate governmental agencies. Earmarked funds for research could be provided by private conservation organizations, state wildlife agencies, and Natural Heritage Programs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: Occurs in relatively small, localized populations mostly confined to coastal saltmarshes within its range in the eastern U.S. It has attracted the interest of systematists since the end of the nineteenth century, but serious field studies were not undertaken on any population until the mid-twentieth century. In the early 1960s, concern about the status of two east and south Florida populations focused renewed attention. Currently, as wetlands around the nation are destroyed or disrupted by drainage and development activities, and those remaining are increasingly threatened, there is heightened concern for the welfare of all species dependent on these habitats. The seaside sparrow, as a maritime wetland specialist, represents a potentially valuable "indicator" of the continued ecological integrity of certain types of coastal marshes, and has already proven to be sensitive to habitat modification in the southeastern sections of its range. Populations in the Northeast are likely as susceptible to habitat disturbance and restriction as those now threatened or endangered in Florida (Greenlaw 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Seaside Sparrow

The Seaside Sparrow (Ammodramus maritimus) is a small American sparrow.

Adults have brownish upperparts with grey on the crown and nape, and a grayish buff colored breast with dark streaks; they have a dark face with grey cheeks, a white throat, and a short pointed tail. Birds show a small yellow streak just above the eye.

Their breeding habitat is salt marshes on the Atlantic and Gulf coasts of the United States from southern New Hampshire to southern Texas. The nest is an open cup usually built in the salt marsh on tidal reeds and spartina grasses. Females lay 2-5 eggs.

Northern birds most often migrate further south along the eastern coast of the United States.

Male Dusky Seaside Sparrow (Ammodramus maritimus nigrescens) Extinct since June 17, 1987

They forage on the ground or in marsh vegetation, sometimes probing in mud. They mainly eat insects, marine invertebrates and seeds. Their feeding areas are often some distance away from the areas they choose to nest.

One of the numerous subspecies of this bird, the Dusky Seaside Sparrow (A. m. nigrescens), has recently become extinct, and the Cape Sable subspecies, A. m. mirabilis, is endangered. Occurring in a restricted range but of uncertain validity is Scott's Seaside Sparrow, (A. m. peninsulae). Those were formerly considered a separate species.

The call closely resembles a raspy buzz, similar to a distant Red-winged Blackbird.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This subspecies is of questionable validity as a distinct entity (see Post and Greenlaw 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Often placed in the genus Ammospiza (AOU 1998). Composed of three groups which formerly were treated as distinct species: MARITIMUS (Common Seaside-Sparrow), NIGRISCENS (Dusky Seaside-Sparrow), and Mirabilis (Cape Sable Seaside-Sparrow) (AOU 1983, 1998). See McDonald (1988), Stevenson and Anderson (1994), and Post and Greenlaw (1994) for evidence supporting the merger of subspecies PELONOTUS (extinct) into subspecies MACGRILLIVRAII and the merger of subspecies JUNCICOLUS into subspecies PENINSULAE. McDonald (1988) further recommended the merger of subspecies MACGRILLIVRAII into subspecies MARITIMUS, but Stevenson and Anderson (1994) took no position on this recommendation pending an examination of specimens collected in fall from the breeding range of MARITIMUS. Post and Greenlaw (1994) pointed out the need for a modern study of range-wide geographic variation.

See Zink and Avise (1990) for information on relationships within the genus Ammodramus (based on analysis of mtDNA and allozymes); Ammodramus (sensu AOU 1983) possibly is not monophyletic; previous generic limits (AOU 1957) seem better to reflect phylogeny than current taxonomy.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!