Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Formicivora grisea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTTTCATTAACCGATGACTATTCTCCACCAATCACAAAGACATTGGCACTCTCTATCTAATCTTTGGTGCATGGGCTGGAATAATTGGAACCGCCCTCAGCCTCCTAATCCGAGCTGAACTAGGACAACCAGGCACTCTGCTAGGAGACGACCAGATTTACAATGTAATTGTTACCGCCCACGCATTTGTCATAATTTTCTTTATAGTTATACCCATCATAATTGGAGGATTTGGCAACTGACTAGTCCCATTAATAATTGGAGCCCCTGATATAGCATTCCCACGAATGAACAACATGAGCTTCTGACTTCTCCCTCCCTCTTTCCTTCTCCTTCTTGCTTCTTCCACAGTAGAAGCAGGAGTAGGAACAGGATGAACAGTTTACCCCCCACTAGCCGGTAACCTAGCCCATGCTGGAGCCTCAGTAGACCTAGCTATCTTCTCCCTCCATCTAGCAGGTGTCTCCTCCATCTTAGGAGCAATCAACTTCATCACAACTGCAATCAACATAAAACCCCCAGCACTATCACAGTATCAAACTCCCCTATTCGTATGATCCGTCCTTATTACTGCCGTATTACTACTGTTATCCCTCCCAGTCCTTGCCGCTGGCATCACTATACTGCTCACAGATCGCAACCTAAATACAACATTCTTCGACCCAGCCGGAGGTGGTGACCCAGTCTTATACCAACCCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Formicivora grisea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-fringed Antwren

The White-fringed Antwren (Formicivora grisea) is a passerine bird in the antbird family. It is a resident breeder in tropical South America from Colombia southeast to the Guianas and Brazil, and on Tobago.

The White-fringed Antwren is typically 12.7 cm long, and weighs 9.4 g. The male has a grey-brown crown and upperparts, and black wings, tail, lower face and underparts. There are two conspicuous white wing bars and a white stripe running from above the eye down the sides of the breast and flanks. The tail feathers are tipped with white. The female's upperparts are much like the male, but females of the southern populations are orange below and have an orange supercilium. These occur south and east from southeastern Colombia and southernmost Venezuela. Northern population's females have underparts which are buff with dark streaks. The Tobagonian subspecies F. g. tobagensis is larger than mainland birds.

It has a tu whistle followed by a trilled churet, and a repeated and accelerating tu-ik call. Southern birds also have a repetitive chump-chump-chump song, quite unlike northern races which are sometimes separated as Northern White-fringed Antwren (Formicivora intermedia). F. grisea proper would then become the Southern White-fringed Antwren.

This is a common and confiding bird of second growth woodland, usually found as territorial pairs. The southern populations are associated with scrubby bushes on white sandy soils and restinga habitat. These birds inhabit the lowlands, up to around 200 m ASL. In some places, they are sympatric with the Rusty-backed Antwren (F. rufa). The White-fringed Antwren feeds on small insects and other arthropods taken from undergrowth twigs and foliage.[1]

The female lays two purple-marked creamy white eggs, which are incubated by both sexes, in a grass hammock nest low in a tree or shrub. Nests are occasionally plundered by predators, for example smallish mammals like the Common Marmoset (Callithrix jacchus), despite the birds' attempts to defend their offspring.[2]

Of a total of 13 birds studied in Colombia—in the Parque Nacional de La Macarena and near Turbo—only one was infected with blood parasites (an undetermined Plasmodium species).[3]

This bird is not considered globally threatened by the IUCN.[4] However, its resilience to human alteration of habitat is not too pronounced, and in some regions its continuing presence would seem to depend on protection of habitat.[1]

Footnotes

  1. ^ a b Venturini & de Paz (2005)
  2. ^ de Lyra-Neves et al. (2007)
  3. ^ Basto et al. (2006), Londono et al. (2007)
  4. ^ BLI (2008)

References

  • Basto, Natalia; Rodríguez, Oscar A.; Marinkelle, Cornelis J.; Gutierrez, Rafael & Matta, Nubia Estela (2006): Haematozoa in birds from la Macarena National Natural Park (Colombia). Caldasia 28 (2): 371–377 [English with Spanish abstract]. PDF fulltext
  • BirdLife International (BLI) (2008). Formicivora grisea. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 16 November 2008.
  • de Lyra-Neves, Rachel M.; Oliveira, Maria A. B.; Telino-Júnior,Wallace R. & dos Santos, Ednilza M. (2007): Comportamentos interespecíficos entre Callithrix jacchus (Linnaeus) (Primates, Callitrichidae) e algumas aves de Mata Atlântica, Pernambuco, Brasil [Interspecific behaviour between Callithrix jacchus (Linnaeus) (Callitrichidae, Primates) and some birds of the Atlantic forest, Pernanbuco State, Brazil]. Revista Brasileira de Zoologia 24 (3): 709–716 [Portuguese with English abstract]. doi:10.1590/S0101-81752007000300022 PDF fulltext.
  • ffrench, Richard; O'Neill, John Patton & Eckelberry, Don R. (1991): A guide to the birds of Trinidad and Tobago (2nd edition). Comstock Publishing, Ithaca, N.Y. ISBN 0-8014-9792-2
  • Hilty, Steven L. (2003): Birds of Venezuela. Christopher Helm, London. ISBN 0-7136-6418-5
  • Londono, Aurora; Pulgarin-R., Paulo C. & Blair, Silva (2007): Blood Parasites in Birds From the Lowlands of Northern Colombia. Caribbean Journal of Science 43 (1): 87–93. PDF fulltext
  • Venturini, Ana Cristina & de Paz, Pedro Rogerio (2005): Observações sobre a distribuição geográfica de Formicivora spp. (Aves: Thamnophilidae), no Estado do Espírito Santo, sudeste do Brasil. Revista Brasileira de Ornitologia 13 (2): 169–175. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!