Articles on this page are available in 1 other language: Spanish (1) (learn more)

Ecology

Habitat

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 2 - 5

Graphical representation

Depth range (m): 2 - 5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halopeltis australis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACTTTGTATTTAATTTTTGGTGCATTCTCAGGAATTCTCGGGGGTTGTATGTCAGTATTAATCCGAATGGAACTTACGCAACCAGGTAATCATTTACTTTTAGGTAACCATCAGTTATATAATGTTTTAATTACAGCTCACGCATTTCTGATGATTTTCTTTATGGTGATGCCTGTAATGATTGGTGGTTTTGGTAACTGGTTGGTTCCTATTATGATAGGTAGTCCTGATATGGCTTTTCCAAGACTAAATAACATTTCTTTTTGATTGCTACCACCAGCTCTTTGCTTGTTGTTAACTTCAGCTTTAGTAGAAGTAGGAGTAGGTACTGGATGAACTGTATATCCACCACTTAGTTCAATTCAAAGCCATTCTGGTGGATCTGTTGACTTAGCTATATTTAGCCTCCATGTTTCTGGAGCTTCCTCTATACTAGGGGCTATTAATTTTATTTCAACAATCATAAATATGCGTAATTCAGGACAAAGCATGTACCGAATACCTCTATTCGTTTGGTCAATACTTGTGACAGCTTTTTTATTGCTGTTAGCAGTGCCCGTATTAGCGGGAGCTATCACTATGCTTTTAACGGATCGTAATTTTAACACCACATTCTTTGATCCCGCTGGTGGCGGAGATCCTATTTTGTACCAACATCTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Halopeltis australis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!