Articles on this page are available in 3 other languages: Arabic (14), Chinese (Simplified) (13), Dutch (1) (learn more)

Overview

Brief Summary

Description

The chaffinch is one of the best-known and most common of all British birds (5). Both sexes can be easily identified in flight when they reveal double white flashes on the wings and white tail-sides (3). In summer the males have colourful plumage, with a rosy-red breast and cheeks and a bluish-grey crown and nape of the neck. These colours fade somewhat in winter. Adult females and juveniles have a buff or greyish coloured breast and greyish-green upperparts (2). Chaffinches produce a variety of calls, including a loud, clear pink call when perched (2). The musical rattling song is also loud (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Male chaffinches are beautiful birds and are also great singers. They seem to think so themselves, as they sit high up in a tree where they can be seen and heard from a far distance. Finches make nests wherever there are trees: in forests, woods, city parks and gardens. In the winter, they are often in open terrains and close by towns. They like to visit bird feeding tables. Finches used to be eaten by the Dutch and were caught with special nets.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Chaffinches feed on seeds, particularly of cereals or weeds, taken from the ground (5), in summer they may also take invertebrates from the ground or in the air (6). In winter, native birds tend to feed in small groups near hedges or in woodlands and roost singly or in pairs, whereas migrants from mainland Europe occur in large flocks in fields and roost communally (5).  During the breeding season, the male performs a courtship display, showing off his bright breeding plumage (6). The female builds the nest (5), typically in the fork of a tree and camouflages it with lichen and moss (2). The female incubates the eggs alone (6) for 11-14 days. One brood of around 4 eggs is produced each year (5). The young chaffinches will have fully fledged 13-14 days after hatching from the egg, and the maximum known lifespan of this species is 14 years (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Widespread throughout Britain; absent only from high ground such as the Scottish Highlands (5). During winter, birds from northern Europe migrate to Britain. It is typically the females that migrate, and Linnaeus named the species coelebs, meaning 'the bachelor' because it was the male birds that remained in his native Sweden for the winter (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

fringilla coelebs

mannetje: heeft grijs kapje.
vrouwtje: heeft geen grijs kapje.
Public Domain

Supplier: geron

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.590 - 11.396
  Nitrate (umol/L): 5.547 - 8.636
  Salinity (PPS): 34.665 - 35.167
  Oxygen (ml/l): 6.315 - 6.398
  Phosphate (umol/l): 0.476 - 0.574
  Silicate (umol/l): 2.687 - 3.347

Graphical representation

Temperature range (°C): 9.590 - 11.396

Nitrate (umol/L): 5.547 - 8.636

Salinity (PPS): 34.665 - 35.167

Oxygen (ml/l): 6.315 - 6.398

Phosphate (umol/l): 0.476 - 0.574

Silicate (umol/l): 2.687 - 3.347
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 9.590 - 11.396
  Nitrate (umol/L): 5.547 - 8.636
  Salinity (PPS): 34.665 - 35.167
  Oxygen (ml/l): 6.315 - 6.398
  Phosphate (umol/l): 0.476 - 0.574
  Silicate (umol/l): 2.687 - 3.347

Graphical representation

Temperature range (°C): 9.590 - 11.396

Nitrate (umol/L): 5.547 - 8.636

Salinity (PPS): 34.665 - 35.167

Oxygen (ml/l): 6.315 - 6.398

Phosphate (umol/l): 0.476 - 0.574

Silicate (umol/l): 2.687 - 3.347
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in woodland, gardens and parks (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Fringilla coelebs preys on:
Acyrthosiphon spartii
Aphis sarathamni
Arytaina spartii
Arytaina genistae

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 29 years (captivity) Observations: One captive specimen reportedly lived to the age of 29 (http://www.demogr.mpg.de/longevityrecords).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Fringilla coelebs

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCACAAAGACATTGGCACCCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTCAGCCTCCTCATCCGAGCAGAACTGGGCCAACCCGGAGCTCTTCTAGGAGACGACCAAGTCTACAATGTAGTTGTCACGGCCCATGCTTTCGTAATGATTTTCTTTATAGTTATGCCTATTATAATCGGAGGGTTCGGAAACTGATTAGTTCCCCTGATAATTGGAGCCCCCGACATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTACTTCCACCATCTTTTCTCCTTCTACTAGCATCCTCCACCGTAGAAGCAGGAGTAGGTACAGGATGAACTGTATATCCCCCACTAGCCGGCAATCTGGCCCACGCTGGAGCCTCAGTAGACCTAGCAATCTTTTCATTACACCTAGCCGGCATCTCTTCAATCCTAGGAGCAATCAACTTCATCACAACAGCAATCAACATAAAACCACCTGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTAATCACTGCAGTACTCCTCCTCCTATCTCTGCCAGTTCTCGCTGCAGGGATTACAATGCTTCTCACAGATCGTAACCTCAATACTACTTTCTTTGACCCCGCAGGCGGAGGAGACCCTGTACTATACCAACACCTGTTCTGATTCTTTGGCCACCCCGAAGTATACATCCTAATCCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Fringilla coelebs

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 104
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5