Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Setophaga tigrina

A medium-sized (5 inches) wood warbler, the male Cape May Warbler is most easily identified by its streaked olive back, streaked yellow breast and flanks, and yellow face with prominent rusty cheek patches. Female Cape May Warblers are similar to males, but are duller and lack rusty patches on the face. The male is relatively unmistakable in good light, but the female may be confused with other female wood warblers with streaked flanks, such as the female Blackburnian Warbler (Setophaga fusca). The Cape May Warbler primarily breeds in south-central Canada. Smaller numbers breed south of the U.S.border in the upper Midwest and northern New England. The Cape May Warbler winters from the Florida Keys and the Bahamas south to southern Mexico and Central America. Cape May Warblers breed in northern evergreen forests, particularly in areas where spruce and fir trees occur. In winter, this species may be found in a number of shrubby habitat types, including mangroves and forest edges. Cape May Warblers mainly eat small invertebrates, including insects and spiders, although this species may eat fruits or berries in winter. In appropriate habitat, Cape May Warblers may be observed foraging for food located on leaves, needles, and branches in the forest canopy. Birdwatchers may also listen for this species’ song, a high-pitched “seet” note repeated several times in quick succession. Cape May Warblers are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Canada and ne US; winters mainly West Indies.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: northeastern British Columbia and southern Mackenzie to northern Saskatchewan and Nova Scotia, south to central Alberta, central Saskatchewan, northwestern North Dakota, northeastern Minnesota, northern Wisconsin, eastern New York, and northern New England (Baltz and Latta 1998). NON-BREEDING: primarily from central Bahamas through Greater Antilles (fairly common in Puerto Rico) to Virgin Islands; rare in Florida Keys, Lesser Antilles, and on Caribbean islands and coasts of Mexico and Central America (casual from Yucatan to Panama); rare in northeastern Colombia, northern Venezuela; Trinidad; almost regular on Tobago; Netherlands Antilles (Ridgely and Tudor 1989, Baltz and Latta 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 13 cm

Weight: 11 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: BREEDING: Primarily in forests of spruce (Picea spp.) and/or fir (Abies spp.), typically in stands > 50 years old, > 15 m tall, with well developed crowns and some trees that rise above canopy for use as singing posts (AOU 1998, Rosenberg and Hodgeman 2000, Baltz and Latta 1998, Baker 1978, Welsh 1987, Semenchuk 1992). Trees may be scattered or dense; also found near forest edge, especially if birches or hemlocks are present and more open land with small trees (DeGraaf and Rappole 1995). Proliferates in areas heavily infested by spruce-budworms, and may not occur after the outbreak has subsided (Brewster 1938, Erskine 1977, Morse 1989).

In Ontario found in habitats dominated by White (P. GLAUCA) or Black Spruce (P. MARIANA) of at least 30 m height with Balsam Fir (Abies balsamea) in canopy and an understory of Speckled Alder (Alnus incana), Labrador Tea (Ledum groenlandicum), and briers (Kendeigh 1947). In Quebec, occurs in White Spruce plantations at least 50 years old with a sparse shrub understory; average distance between trees 2.4 m +/- 1.3 SD and canopy height > 10 m (DesGranges 1980). In Alberta, uses dense, mature White Spruce, stand of coniferous and mixed forest (Semenchuck 1992).

In Michigan, found in wet coniferous bogs dominated by black spruce (Baker 1978, L.C. Binford in Brewer et al. 1991). In New York, occupies stands of medium aged spruce (25-75 years old), with some Balsam Fir (J. M. C. Peterson in Andrle and Carroll 1988). In Maine, uses various coniferous forest stands, including second-growth Balsam Fir and Red Spruce (P. RUBENS) with an open understory (Morse 1978).

MIGRATION: In a variety of forest woodlands (conifers and especially spruces are preferred), scrub and thicket (Godfrey 1986, AOU 1983, Dunn and Garrett 1997). In spring found in association with exotic flowering trees such as silk-oats and bottlebrush as well as flower and catkins of hardwoods such as oaks, hickories, and honey locusts. Fall migrants commonly in berry producing shrubs and small vineyards within woodlands. In Indiana, found in such habitats on campuses, golf courses, tree nurseries, pine plantations and residential areas, in brier patches, overgrown fence rows and weedy roadsides (Mumford and Keller 1984, Baltz and Latta 1988).

NON-BREEDING: Overwinter in mature tropical forests, open woodland and exotic shade and flowering trees (e.g., palm, eucalyptus, casuarinas) over a wide range of elevation. Commonly found in gardens or shade coffee plantations, where flowering plants are abundant. Includes towns, ornamental gardens, parklands, montane forest, arid mesquite, pines, mangroves and other flowering trees, and occasionally dense forest (AOU 1983, AOU 1988, Ehrlich, Dobkin, and Wheye, 1988, Dunn and Garrett 1997, Pashley 1989). Nectar sources (flowering plants) are an important winter habitat component.

Variety of habitats in the West Indies; shade coffee plantations, coastal thickets and almost anywhere plants are flowering, but uncommon in native dry forest (Raffaele et al. 1998). In the Bahamas, common in gardens and plantings, second-growth, and Red Mangrove (Rhizophora mangle); rarely in pine forest (Baltz 1993). In Jamaica, primarily in gardens and parklands to 1,500 m (Lack and Lack 1972). In Puerto Rico and Cuba, common in dry coastal vegetation, more commonly in Bucida buceras, Bursera simaruba, and Coccoloba diversifolia (Post 1978, Wallace et al. 1996), and secondary forest (Stacier 1992, Baltz and Latta 1998).

In the Dominican Republic, occurs in pine and broadleaf, dry scrub, pasture and shade-coffee plantations (Arendt 1992, Wunderle and Waide 1993). Common in Cuba where it is found in forests and gardens (Garrido and Kirkconnell 2000). In Mexico, found in semiarid scrub and woodland and gardens at flowering trees (Howell and Webb 1995). In Costa Rica, in open groves, garden trees, open areas, associating with flowering Eucalyptus and Erythrina trees (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

A long-distance migrant with an elliptical migration. Sexes appear to migrate together (Hall 1981). Fall migration is primarily through the northeastern United States. Most birds have departed the breeding grounds by September. In spring, most birds depart the West Indies by early to mid-May (Bond 1985, Baltz and Latta 1998) .

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Primary food is invertebrates. During the breeding season eats insects and spiders, leafhoppers, beetles, fruit juice and sap (Terres 1980). Spruce budworm is an important food source. Primarily forages among tree foliage and in thickets while perched, but known to hawk, hover and flycatch throughout the year (Post 1978, Terres 1980). Differs from other spruce wood-warblers in that it feeds consistently near the tops of trees in the upper, outer portion of spruce and fir; overlaps significantly with Blackburnian Warbler (Dendroica fusca, MacArthur 1958).

Unlike many other warblers, adopts a radically different foraging strategy during migration and on its wintering grounds when it feeds mainly on the ground (Gauthier and Aubrey 1996). During migration, observed foraging at hummingbird feeders, sapsucker holes, grapes and grape vines and on the ground on lawns and at water ditches (McAtee 1904, Burns 1915, Kilham 1953, Morse 1980, Blanich 1988, Sealy 1988, 1989).

During non-breeding season, feeds heavily on nectar, also taking invertebrates and fruit (Pashley 1989); however, not an obligate nectarivore in winter (Baltz and Latta 1998). Gleans and hovers to capture small spiders in foliage and clings to mossy branches to extract larvae and other small invertebrates (Stiles and Skutch 1989). Takes insects and nectar from AGAVE spp. (Emlen 1973), Peach-leaved Willow (Salix amygdaloides) catkins (Sealey 1989) and insects and fruit from Cecropia trees (Lack 1972).

In Jamaica, feeds high in small-leaved trees (but not conifers) taking prey from leaves and occasionally from air by hovering, taking sap from holes bored by sapsuckers and comes to hummingbird feeders in gardens (Lack 1976). In Puerto Rico forages in upper portions of trees; rarely in shrubs (Baltz and Latta 1998). In the Dominican Republic, most foraging is directed toward deciduous substrates in shade coffee plantations (78%, including flowers 40%, leaves 28%, wood 10%) and 57% in pine forest, including flowers (34%) and leaves (23%) in deciduous understory (J. Wunderle and SCL unpubl. data, in Baltz and Latta 1998). In Costa Rica, forages in Eucalyptus and Erythrina trees (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Dendroica tigrina is prey of:
Accipiter striatus
Diptera
Secernentia nematodes

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Solitary during breeding season excluding interactions with mate and young. During migration will join mixed foraging flocks of up to 30 birds (Burns 1915), but also solitary, defending short-term territories (Sealy 1988, 1989). Behavior on wintering grounds depends upon habitat. Some birds join mixed species flocks, others are solitary. Most Puerto Rico birds were territorial (Hagan and Johnston 1992), while birds in some Dominican Republic habitats joined foraging flocks (never in coffee plantations, Latta and Wunderle 1996). In the Bahamas, known to defend widely spaced blooming century plants that provide insects and nectar (Emlen 1973, Morse 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but they have been reported to live up to 4.3 years in the wild (Klimkiewicz et al. 1983).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Basic information is sparse due to the extreme height of the nest and the female's elusive behavior. Nest is invariably in the uppermost clump of thick foliage near the top of tall conifers (DeGraaf and Rappole 1995). Most often in spruce, occasionally in fir (Bent 1953), and concealed in thick foliage against main tree stem (Phillip and Bowdish 1919, Pettinghill 1971). Height typically 9-18 m (Baicich and Harrison 1997). Nest is a bulky cup composed of sphagnum moss, spruce twigs, grass, pine needles, cedar bark, and plant down, lined with animal hair, rootlets, and feathers (Baicich and Harrison 1997). Typically visible from below.

Incubation by female. Female lays in June; 4-9 eggs, usually 6-7, up to 9 in spruce budworm years (Baltz and Latta 1998, Baicich and Harrison 1997). Parents approach nest by hopping upward from base of nest tree (Pettinghill 1971). Reproductive output increases when spruce budworm is abundant. No information on nestling or fledgling period. Single brooded. An apparently rare host of the Brown-headed Cowbird (Friedman and Kiff 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendroica tigrina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTAATTTTCGGCGCATGAGCCGGAATGGTGGGTACCGCTCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTGGGAGACGACCAAGTCTACAACGTGGTTGTCACGGCCCATGCCTTCGTAATAATCTTCTTTATAGTTATGCCGATTATAATCGGAGGATTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTTCCGCGAATAAACAACATAAGCTTCTGACTACTCCCACCATCATTCCTCCTCCTCTTAGCATCCTCCACAGTGGAAGCAGGCGTAGGTACAGGCTGAACAGTGTATCCCCCACTAGCTGGCAACCTAGCTCATGCCGGGGCCTCAGTCGACCTCGCAATCTTCTCCTTACACCTAGCTGGTATTTCCTCAATCCTCGGAGCAATTAACTTCATTACAACAGCAATTAACATGAAACCTCCTGCCCTCTCACAATACCAAACCCCACTATTCGTCTGATCAGTGTTAATTACTGCAGTCCTCCTTCTCCTTTCCCTTCCAGTTCTAGCTGCAGGAATCACAATGCTCCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCTGCCGGAGGAGGAGATCCCGTCCTATATCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dendroica tigrina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread in breeding range; no significant, range-wide decline evident. However, some local declines are occurring and concerns exist regarding loss of forest habitat, both on breeding and wintering grounds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Trend data must be carefully interpreted as populations of Cape May Warbler fluctuate more than populations of most warblers, with highest breeding densities reached during outbreaks of spruce budworm. Budworm populations are cyclical and regional densities may undergo drastic changes in population density in response. Survey-wide Breeding Bird Survey (BBS) data for the most recent time period (1980-2000) show a non-significant decline of -1.4% per year with a similar but shallower trend for Canada, where the bulk of the population is found. Of all states and provinces, only New Brunswick and Maine showed a negative, statistically significant, long-term population trend (-11.1 and -11.3%/year respectively, 1980-2000). However, even those these are 'statistically significant,' the data is such that any interpretations must be made with caution. For the same period, BBS data also indicates a significant -9.4% (n = 61) annual decline in the U.S. population. For the period 1966-1979, BBS data show a continent-wide annual increase of 1.7% (Sauer et al. 2001). Trends varied between physiographic regions from non-significant changes to highly significant short-term declines (Baltz and Latta 1998). Some local increases over historical numbers have been noted, such as in northern Michigan (Dunn and Garrett 1997). Ridgely and Gwynne (1989) suggest that populations in Panama were increasing, possibly correlated with increases on the breeding grounds, but the dearth of monitoring throughout the non-breeding range make computing population trends impossible.

Global Long Term Trend: Increase of 10-25% to decline of 50%

Comments: Has undoubtedly declined somewhat as a result of loss of forested habitat throughout its range in the past 300 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: HABITAT LOSS: Breeding: The continued loss of mature forest throughout the breeding range will undoubtedly contribute to long-term declines in this species. Much of the core of this species' range is in the western boreal forest, so is threatened by forest conversion to agriculture along the southern edges of the boreal zone. In Saskatchewan alone, 4368 square kilometers of forest was lost to agriculture in the period 1966-1994, a rate of -0.87%/year (Hobson et al. 2002). Much of the remaining southern boreal forest in western Canada has been leased to forestry companies (Cummings et al. 1994, Stelfox 1995). Logging is also a concern in southeastern Canada and the northeastern U.S.

Urban sprawl, roadworks, dredging and reclamation of wetlands and tidal mangroves, problems of sewage and solid waste disposal are threats to wintering habitat throughout the Caribbean (Raffaele et al. 1998). Rising human populations and increasingly unfavorable patterns of land ownership are likely to accelerate habitat destruction and degradation in the region.

Non-breeding: Cape May Warblers are particularly common in shade coffee plantations on the wintering grounds. As these plantations are converted to shadeless plantations, winter habitat may be lost as well. For a more detailed regional summaries of regional threats, legislation efforts, and research and monitoring needs see Raffaele et al. (1998).

PESTICIDES AND CONTAMINANTS: Intensive aerial spraying programs to control spruce budworms could have a negative impact on this and other warblers that specialize on this food source (Dunn and Garrett 1997, Pearce et al. 1976). Pesticide spraying to eradicate mosquitoes, malaria, yellow fever and crop pests threaten to poison birds and reduce arthropod prey abundance in the Caribbean (Raffaele et al. 1998).

COLLISIONS: Collisions with communication towers a significant cause of mortality during migration (Owre 1967, Taylor 1973). 6% of band recoveries from Cape May Warblers have come from birds hit by cars (Taylor 1973). Construction of communication towers (including radio, television, cellular, and microwave) in the United States has been growing at an exponential rate, increasing at an estimated 6 percent to 8 percent annually. According to the Federal Communication Commission's 2000 Antenna Structure Registry, the number of lighted towers greater than 199 feet above ground level (AGL) currently number over 45,000 and the total number of towers over 74,000. Non-compliance with the registry program is estimated at 24 percent to 38 percent, bringing the total to 92,000 to 102,000. By 2003, all television stations must be digital, adding potentially 1,000 new towers exceeding 1,000 feet AGL. This increasingly large number of obstacles will likely result in larger numbers of migrating birds killed by collisions.

HURRICANES: Hurricanes may reduce local wintering populations of neotropical migrants in the West Indies.

PREDATORS: Cats are a major source of bird mortality throughout the Caribbean (Raffaele et al. 1998) and are likely a significant threat to this species during migration and the non-breeding season when it is found nearer the ground. 11% of Cape May Warbler band recoveries have been from birds killed by cats.

HUNTING: 19% of banded birds recovered were shot, mostly on the non-breeding grounds (Taylor 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Preserve Selection and Design Considerations: Large forest tracts should be preserved on the breeding and wintering grounds. Higher priority areas are those with greater forest connectivity and less fragmentation. Because shade-grown coffee plantations are a major source of habitat throughout the non-breeding range, maintaining the presence of these plantations in the landscape, rather than less favorable, more intensive coffee cultivation or other agricultural crops is a priority.

Management Requirements: BREEDING: LOGGING. While much of the boreal forest remains relatively unmodified by forest management, the increasing demand for aspen and 60-100-year-old coniferous pulp production threatens to increase the pace of logging and the effects of habitat alteration. Currently, intensive harvesting and forest planting now occurs in boreal forests in Ontario, Minnesota, and northern Maine (Askins 2000). Without careful management, homogenization and decimation of this ecotype could lead to the extirpation of Cape May Warbler and many other species of wildlife.

It is likely that repeated fires and logging are a primary factor limiting the availability of suitable breeding habitat, especially in the western half of the range. Short-rotation cutting cycles, combined with high frequencies of fire prevent development of the mature forests needed by both the warbler and its budworm prey (Erskine 1977, Baltz and Latta 1998). Present management is favoring younger, more even-aged stands. As a result, poorly managed, unsustainable logging practices may be more important than the frequency and extent of budworm outbreaks; without a suitable forest type, budworm outbreaks will not occur (A. Erskine in Baltz and Latta 1998).

A 1995 forest-management plan for New Brunswick (New Brunswick Department. of Natural Resources and Energy 1995) projected that mature and over-mature classes of spruce-dominated coniferous forest will decline more rapidly over the next 40 years (from 46% of land area to 8%) than any other habitat-community type. This projection may also apply to large portions of Nova Scotia, Quebec, and the industrial forests of northern Maine (Rosenberg and Hodgeman 2000).

Unlike patchily distributed species where a site specific approach is appropriate, successful management for species occupying mature coniferous forest will need to focus on maintenance of minimum percentages of the landscape mosaic to prevent local loss of this habitat type. Cooperative relationships with industrial forest landowners seems to be the best approach in the U.S. (Rosenberg and Hodgeman 2000).

BUDWORM CONTROL. Budworms are considered a pest in industrial forests and efforts have been made to control them using chemical insecticides. Some poisons are considered lethal to songbirds and are considered to be likely causes of decline in some regions . Modifications in spraying regimes and chemicals used may have greatly reduced the numbers of birds killed directly (Pearce et al. 1976), but few data exist on whether the decrease in insect abundance has negatively affected bird populations or affected life span and/or productivity.

Budworm outbreaks are thought to have been more frequent in twentieth century than previously (Baltz and Latta 1998). Fire protection and the use of pesticides to maintain forests stands have not entirely eradicated budworms. Instead, it has had the effect of maintaining them at low levels (Blais 1983). As a result, spraying may have had the effect of stabilizing populations of Cape May Warbler at or near a historic high (Morse 1989).

NON-BREEDING: Little known. There are indications that fragmentation of tropical forests may lead to increased mortality for migrants occupying those patches. Until further research proves otherwise, limiting fragmentation and increasing forest connectivity should be guidelines for forest management in the tropics as well as in the temperate forests of North America (Petit et al. 1995).

Management Programs: There are no management programs specifically for Cape May Warbler. Its widespread geographic distribution coupled with its broad habitat requirements on both breeding and non-breeding grounds indicate a low risk of extinction (Reed 1992). Modifications of spruce budworm spraying regimes and chemicals have likely reduced acute mortality (Pearce and Garrity 1981).

Monitoring Programs: The BBS is the only systematic survey that gathers data throughout the breeding range of most neotropical migrants (Sauer et al. 2000). Cape May Warbler is monitored by this survey, but is not a special target species. Partners-In-Flight is increasing efforts to monitor all neotropical migrants throughout North and South America. Their goals are to improve understanding of neotropical migrants, identify species most at risk, and develop habitat protection plans.

The Forest Bird Monitoring Program (FBMP) has been on-going in Ontario, Canada, since 1987. In 1993, 125 sites (600 listening stations) were surveyed for a number of species, including the Cape May Warbler. Contact: Mike Cadman, Canadian Wildlife Service, 75 Farquhar St, Guelph, ON N1H 3N4, 519-826-2094 (phone), 519-826-2113 (fax), Mike.Cadman@ec.gc.ca (Last update: 12/21/1999). Results available online: http://www.cws-scf.ec.gc.ca/canbird/news/bt98/ins9_e.html.

Birdcast is a pilot radar ornithology project that focuses on the mid-Atlantic region, and is designed to monitor the migration of neotropical migratory birds and hope to improve identification of important migratory habitat. Birdcast is a cooperative project of the National Audubon Society, the Cornell Lab of Ornithology, Clemson's Radar Ornithology Laboratory, the Academy of Natural Science with support from the Environmental Protection Agency. Information available online: http://birdsource.cornell.edu/BirdCast/.

Management Research Needs: Baltz and Latta (1998) suggest the following research needs related to management:

1. Further study is needed on breeding cycle including incubation, growth and development of young, parental care, and demographic variables including reproductive success.

2. Investigation of the behavior during budworm outbreaks that may shed light on whether clutches are laid during infestations; may also reveal different foraging niches than those described by MacArthur (1958).

3. Studies of dispersal and site fidelity and how these relate to the spatial and temporal occurrence of spruce budworm outbreaks.

4. Studies of site fidelity, dispersal, mating, and reproductive success in fragmented and unfragmented forest.

5. Long term studies of the possible negative effects of spruce budworm spraying.

6. Further study and quantitative data is needed on habitat use and spacing on the non-breeding grounds.

7. Investigation of wintering ecology is needed including site fidelity, sex ratios and annual survival rates; the Bahamas, have high densities of this species and may be an appropriate study site.

The effect of habitat fragmentation and loss of connectivity in tropical environments is poorly understood. Further investigation of this question is of immediate concern because of the rapidly increasing human populations throughout Central and South America and the Caribbean.

Biological Research Needs: Baltz and Latta (1998) suggest research is needed to further investigate vocalization types.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

Stewardship Overview: Habitat loss is an increasing threat in the spruce-hardwood region of North America and throughout much of the non-breeding range where tropical deforestation is an ever-increasing problem. Pesticides used to manage the transmission of human disease and to maintain timber production, as well as the increasing pace of communication tower construction will likely continue to detrimentally affect populations. Successful management of this species will require protection of existing habitat. Forest management should focus on maintaining a designated minimum acreage of suitable habitat, especially where logging and fires affect forest size, shape, and plant species composition. Conservation should focus on the maintenance of tropical forest cover and encouraging farmers to cultivate shade-grown coffee rather than more intensive farming methods.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cape May Warbler

The Cape May Warbler (Setophaga tigrina) is a species of New World warbler. It breeds in northern North America. Its breeding habitat spans across all but the westernmost parts of southern Canada, and into the Great Lakes region and New England. It is migratory, wintering in the West Indies. This species is a very rare vagrant to western Europe. The species is named after Cape May in New Jersey where Alexander Wilson collected the first type specimen. Ironically, another of this species was not verified in Cape May for another 100 years, although it is now known that the species is an uncommon migrant through the area.[2]

Contents

Description [edit]

Cape may WARBLER X.jpg

This bird is a small passerine and mid-sized New World warbler. Length can vary from 12 to 14 cm (4.7 to 5.5 in), wingspan is 19–22 cm (7.5–8.7 in) and body mass can range from 9 to 17.3 g (0.32 to 0.61 oz).[2][3][4] Among standard measurements, the wing chord is 6.1 to 7.3 cm (2.4 to 2.9 in), the tail is 4.3 to 5 cm (1.7 to 2.0 in), the bill is 0.9 to 1.2 cm (0.35 to 0.47 in) and the tarsus is 1.7 to 1.9 cm (0.67 to 0.75 in).[5] The summer male Cape May Warbler has a brown back, yellowish rump and dark brown crown. The underparts are yellow, streaked black, giving rise to the bird's scientific name. The throat and nape are bright yellow and the face is striking chestnut with a black eyestripe. There is a narrow white wing bar.

Other plumages resemble washed-out versions of the summer male, and, in particular, lack the strong head pattern. The yellowish rump and, at least indications of the white wing bar, are always present.

Biology [edit]

This species is insectivorous, and lays larger clutches in years when Spruce Budworm is abundant. It picks insects up from the tips of conifer branches or flies out to catch insects in flight. The Cape May Warbler also feeds on berry juice and nectar while winter, and has, uniquely for a warbler, a tubular tongue to facilitate this action.[2]

The breeding habitats of this bird is the edges of coniferous woodland. Cape May Warblers nest in dense foliage near the trunk of a conifer, commonly a Black Spruce, and lay 4–9 eggs in a cup nest. It has the potential to lay largest clutch of any New World warbler, possibly due to population increases in response to Spruce Budworm outbreaks.[2]

The song of the Cape May Warbler is a simple repetition of high tsi notes. The call is a thin sip. This bird usually sings from high perches.[2]

References [edit]

  1. ^ BirdLife International (2004). "Dendroica tigrina". IUCN Red List of Threatened Species. Version 2006. International Union for Conservation of Nature. Retrieved 12 May 2006. 
  2. ^ a b c d e "Cape May Warbler". All About Birds. Cornell Lab of Ornithology. Retrieved 24 August 2012. 
  3. ^ Raffaele, Herbert; Wiley, James; Garrido, Orlando H.; Keith, Allan; Raffaele, Janis I. (2010). Birds of the West Indies. Princeton University Press. pp. 166–. ISBN 978-0-691-11319-7. 
  4. ^ Taylor, Walter Kingsley. "Black-Throated Blue and Cape May Warblers Killed in Central Florida". Journal of Field Ornithology 44: 258–266. JSTOR 4511981. 
  5. ^ Curson, Jon; Quinn, David; Beadle, David (1994). New World Warblers. London: Christopher Helm. ISBN 0-7136-3932-6. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!