Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Setophaga tigrina

A medium-sized (5 inches) wood warbler, the male Cape May Warbler is most easily identified by its streaked olive back, streaked yellow breast and flanks, and yellow face with prominent rusty cheek patches. Female Cape May Warblers are similar to males, but are duller and lack rusty patches on the face. The male is relatively unmistakable in good light, but the female may be confused with other female wood warblers with streaked flanks, such as the female Blackburnian Warbler (Setophaga fusca). The Cape May Warbler primarily breeds in south-central Canada. Smaller numbers breed south of the U.S. border in the upper Midwest and northern New England. The Cape May Warbler winters from the Florida Keys and the Bahamas south to southern Mexico and Central America. Cape May Warblers breed in northern evergreen forests, particularly in areas where spruce and fir trees occur. In winter, this species may be found in a number of shrubby habitat types, including mangroves and forest edges. Cape May Warblers mainly eat small invertebrates, including insects and spiders, although this species may eat fruits or berries in winter. In appropriate habitat, Cape May Warblers may be observed foraging for food located on leaves, needles, and branches in the forest canopy. Birdwatchers may also listen for this species’ song, a high-pitched “seet” note repeated several times in quick succession. Cape May Warblers are primarily active during the day.

Threat Status: Least Concern

  • Baltz, Michael E. and Steven C. Latta. 1998. Cape May Warbler (Setophaga tigrina), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/332
  • Cape May Warbler (Dendroica tigrina). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Dendroica tigrina. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • eBird Range Map - Cape May Warbler. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: northeastern British Columbia and southern Mackenzie to northern Saskatchewan and Nova Scotia, south to central Alberta, central Saskatchewan, northwestern North Dakota, northeastern Minnesota, northern Wisconsin, eastern New York, and northern New England (Baltz and Latta 1998). NON-BREEDING: primarily from central Bahamas through Greater Antilles (fairly common in Puerto Rico) to Virgin Islands; rare in Florida Keys, Lesser Antilles, and on Caribbean islands and coasts of Mexico and Central America (casual from Yucatan to Panama); rare in northeastern Colombia, northern Venezuela; Trinidad; almost regular on Tobago; Netherlands Antilles (Ridgely and Tudor 1989, Baltz and Latta 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Canada and ne US; winters mainly West Indies.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 13 cm

Weight: 11 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: BREEDING: Primarily in forests of spruce (PICEA spp.) and/or fir (ABIES spp.), typically in stands > 50 years old, > 15 m tall, with well developed crowns and some trees that rise above canopy for use as singing posts (AOU 1998, Rosenberg and Hodgeman 2000, Baltz and Latta 1998, Baker 1978, Welsh 1987, Semenchuk 1992). Trees may be scattered or dense; also found near forest edge, especially if birches or hemlocks are present and more open land with small trees (DeGraaf and Rappole 1995). Proliferates in areas heavily infested by spruce-budworms, and may not occur after the outbreak has subsided (Brewster 1938, Erskine 1977, Morse 1989).

In Ontario found in habitats dominated by White (P. GLAUCA) or Black Spruce (P. MARIANA) of at least 30 m height with Balsam Fir (ABIES BALSAMEA) in canopy and an understory of Speckled Alder (ALNUS INCANA), Labrador Tea (LEDUM GROENLANDICUM), and briers (Kendeigh 1947). In Quebec, occurs in White Spruce plantations at least 50 years old with a sparse shrub understory; average distance between trees 2.4 m +/- 1.3 SD and canopy height > 10 m (DesGranges 1980). In Alberta, uses dense, mature White Spruce, stand of coniferous and mixed forest (Semenchuck 1992).

In Michigan, found in wet coniferous bogs dominated by black spruce (Baker 1978, L.C. Binford in Brewer et al. 1991). In New York, occupies stands of medium aged spruce (25-75 years old), with some Balsam Fir (J. M. C. Peterson in Andrle and Carroll 1988). In Maine, uses various coniferous forest stands, including second-growth Balsam Fir and Red Spruce (P. RUBENS) with an open understory (Morse 1978).

MIGRATION: In a variety of forest woodlands (conifers and especially spruces are preferred), scrub and thicket (Godfrey 1986, AOU 1983, Dunn and Garrett 1997). In spring found in association with exotic flowering trees such as silk-oats and bottlebrush as well as flower and catkins of hardwoods such as oaks, hickories, and honey locusts. Fall migrants commonly in berry producing shrubs and small vineyards within woodlands. In Indiana, found in such habitats on campuses, golf courses, tree nurseries, pine plantations and residential areas, in brier patches, overgrown fence rows and weedy roadsides (Mumford and Keller 1984, Baltz and Latta 1988).

NON-BREEDING: Overwinter in mature tropical forests, open woodland and exotic shade and flowering trees (e.g., palm, eucalyptus, casuarinas) over a wide range of elevation. Commonly found in gardens or shade coffee plantations, where flowering plants are abundant. Includes towns, ornamental gardens, parklands, montane forest, arid mesquite, pines, mangroves and other flowering trees, and occasionally dense forest (AOU 1983, AOU 1988, Ehrlich, Dobkin, and Wheye, 1988, Dunn and Garrett 1997, Pashley 1989). Nectar sources (flowering plants) are an important winter habitat component.

Variety of habitats in the West Indies; shade coffee plantations, coastal thickets and almost anywhere plants are flowering, but uncommon in native dry forest (Raffaele et al. 1998). In the Bahamas, common in gardens and plantings, second-growth, and Red Mangrove (RHIZOPHORA MANGLE); rarely in pine forest (Baltz 1993). In Jamaica, primarily in gardens and parklands to 1,500 m (Lack and Lack 1972). In Puerto Rico and Cuba, common in dry coastal vegetation, more commonly in BUCIDA BUCERAS, BURSERA SIMARUBA, and COCCOLOBA DIVERSIFOLIA (Post 1978, Wallace et al. 1996), and secondary forest (Stacier 1992, Baltz and Latta 1998).

In the Dominican Republic, occurs in pine and broadleaf, dry scrub, pasture and shade-coffee plantations (Arendt 1992, Wunderle and Waide 1993). Common in Cuba where it is found in forests and gardens (Garrido and Kirkconnell 2000). In Mexico, found in semiarid scrub and woodland and gardens at flowering trees (Howell and Webb 1995). In Costa Rica, in open groves, garden trees, open areas, associating with flowering EUCALYPTUS and ERYTHRINA trees (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

A long-distance migrant with an elliptical migration. Sexes appear to migrate together (Hall 1981). Fall migration is primarily through the northeastern United States. Most birds have departed the breeding grounds by September. In spring, most birds depart the West Indies by early to mid-May (Bond 1985, Baltz and Latta 1998) .

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Primary food is invertebrates. During the breeding season eats insects and spiders, leafhoppers, beetles, fruit juice and sap (Terres 1980). Spruce budworm is an important food source. Primarily forages among tree foliage and in thickets while perched, but known to hawk, hover and flycatch throughout the year (Post 1978, Terres 1980). Differs from other spruce wood-warblers in that it feeds consistently near the tops of trees in the upper, outer portion of spruce and fir; overlaps significantly with Blackburnian Warbler (DENDROICA FUSCA, MacArthur 1958).

Unlike many other warblers, adopts a radically different foraging strategy during migration and on its wintering grounds when it feeds mainly on the ground (Gauthier and Aubrey 1996). During migration, observed foraging at hummingbird feeders, sapsucker holes, grapes and grape vines and on the ground on lawns and at water ditches (McAtee 1904, Burns 1915, Kilham 1953, Morse 1980, Blanich 1988, Sealy 1988, 1989).

During non-breeding season, feeds heavily on nectar, also taking invertebrates and fruit (Pashley 1989); however, not an obligate nectarivore in winter (Baltz and Latta 1998). Gleans and hovers to capture small spiders in foliage and clings to mossy branches to extract larvae and other small invertebrates (Stiles and Skutch 1989). Takes insects and nectar from AGAVE spp. (Emlen 1973), Peach-leaved Willow (SALIX AMYGDALOIDES) catkins (Sealey 1989) and insects and fruit from CECROPIA trees (Lack 1972).

In Jamaica, feeds high in small-leaved trees (but not conifers) taking prey from leaves and occasionally from air by hovering, taking sap from holes bored by sapsuckers and comes to hummingbird feeders in gardens (Lack 1976). In Puerto Rico forages in upper portions of trees; rarely in shrubs (Baltz and Latta 1998). In the Dominican Republic, most foraging is directed toward deciduous substrates in shade coffee plantations (78%, including flowers 40%, leaves 28%, wood 10%) and 57% in pine forest, including flowers (34%) and leaves (23%) in deciduous understory (J. Wunderle and SCL unpubl. data, in Baltz and Latta 1998). In Costa Rica, forages in EUCALYPTUS and ERYTHRINA trees (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Dendroica tigrina is prey of:
Accipiter striatus
Diptera
Secernentia nematodes

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

100,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Solitary during breeding season excluding interactions with mate and young. During migration will join mixed foraging flocks of up to 30 birds (Burns 1915), but also solitary, defending short-term territories (Sealy 1988, 1989). Behavior on wintering grounds depends upon habitat. Some birds join mixed species flocks, others are solitary. Most Puerto Rico birds were territorial (Hagan and Johnston 1992), while birds in some Dominican Republic habitats joined foraging flocks (never in coffee plantations, Latta and Wunderle 1996). In the Bahamas, known to defend widely spaced blooming century plants that provide insects and nectar (Emlen 1973, Morse 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but they have been reported to live up to 4.3 years in the wild (Klimkiewicz et al. 1983).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Basic information is sparse due to the extreme height of the nest and the female's elusive behavior. Nest is invariably in the uppermost clump of thick foliage near the top of tall conifers (DeGraaf and Rappole 1995). Most often in spruce, occasionally in fir (Bent 1953), and concealed in thick foliage against main tree stem (Phillip and Bowdish 1919, Pettinghill 1971). Height typically 9-18 m (Baicich and Harrison 1997). Nest is a bulky cup composed of sphagnum moss, spruce twigs, grass, pine needles, cedar bark, and plant down, lined with animal hair, rootlets, and feathers (Baicich and Harrison 1997). Typically visible from below.

Incubation by female. Female lays in June; 4-9 eggs, usually 6-7, up to 9 in spruce budworm years (Baltz and Latta 1998, Baicich and Harrison 1997). Parents approach nest by hopping upward from base of nest tree (Pettinghill 1971). Reproductive output increases when spruce budworm is abundant. No information on nestling or fledgling period. Single brooded. An apparently rare host of the Brown-headed Cowbird (Friedman and Kiff 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendroica tigrina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTAATTTTCGGCGCATGAGCCGGAATGGTGGGTACCGCTCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTGGGAGACGACCAAGTCTACAACGTGGTTGTCACGGCCCATGCCTTCGTAATAATCTTCTTTATAGTTATGCCGATTATAATCGGAGGATTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTTCCGCGAATAAACAACATAAGCTTCTGACTACTCCCACCATCATTCCTCCTCCTCTTAGCATCCTCCACAGTGGAAGCAGGCGTAGGTACAGGCTGAACAGTGTATCCCCCACTAGCTGGCAACCTAGCTCATGCCGGGGCCTCAGTCGACCTCGCAATCTTCTCCTTACACCTAGCTGGTATTTCCTCAATCCTCGGAGCAATTAACTTCATTACAACAGCAATTAACATGAAACCTCCTGCCCTCTCACAATACCAAACCCCACTATTCGTCTGATCAGTGTTAATTACTGCAGTCCTCCTTCTCCTTTCCCTTCCAGTTCTAGCTGCAGGAATCACAATGCTCCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCTGCCGGAGGAGGAGATCCCGTCCTATATCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dendroica tigrina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5