Overview

Brief Summary

Setophaga pinus

A medium-sized (5-5 ½ inches) wood warbler, the male Pine Warbler is most easily identified by its olive-green back, yellow breast, and dark wings with conspicuous white wing bars. Female Pine Warblers are similar to males, but are somewhat duller. Many North American wood warblers are pale olive-green, but this species alone possesses this plumage in combination with white wing bars. The Pine Warbler breeds across much of the eastern United States and southern Canada, although its range is highly fragmented in much of the Midwest and interior northeast. In winter, northerly-breeding populations abandon their breeding grounds and spend the winter in the southeastern U.S. Populations breeding in the southeast are non-migratory, and isolated non-migratory populations also occur in the Bahamas and on the island of Hispaniola. Appropriately, Pine Warblers primarily breed in pine forests. Migratory populations move into similar habitats in winter as they utilized the summer before, and tropical populations are highly specific to pine barrens or mountain forests where isolated patches of suitable habitat occur. Pine Warblers primarily eat small invertebrates, including insects and spiders, although this species may eat some plant material, particularly fruits and berries, during the winter. In appropriate habitat, Pine Warblers may be observed foraging for food on pine needles and in bark crevices. Birdwatchers may also listen for this species’ song, a trilled “cheeeeeee.” Pine Warblers are primarily active during the day, but, like many songbirds, migratory populations migrate at night.

Threat Status: Least Concern

  • Dendroica pinus. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Pine Warbler (Dendroica pinus). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Rodewald, Paul G., James H. Withgott and Kimberly G. Smith. 1999. Pine Warbler (Setophaga pinus), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/438
  • eBird Range Map - Pine Warbler. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pine warblers, Dendroica pinus, range throughout most of eastern North America. Their northern range extends to the most southern portions of Manitoba, Ontario, and Quebec in Canada. The southern extent of their range extends from Florida, to the southern tip of Texas. The eastern border of the range is the Atlantic coast of the United States (US) and Canada, while its western range runs through the US states of Minnesota, Wisconsin, Illinois, Missouri, Arkansas, and Texas. The breeding range of pine warblers covers much of their general range with the exception of parts of southern Texas and Louisiana. Despite the large breeding range, it is worth noting that breeding populations are often quite isolated in the central parts of their range. The winter range of pine warblers includes much of the southern portion of their breeding range which is unusual for a wood warbler. Their winter range extends as far north as mid-Arkansas, southern Tennessee, as well as southern Virginia.

Biogeographic Regions: nearctic (Native )

  • Chapman, F. 1907. The Warblers of North America. New York: D. Appleton & Company.
  • Dunne, P. 2006. Essential Feild Guide Companion. New York: Houghton Mifflin Company.
  • Harrison, H. 1984. Wood Warblers' World. New York: Simon and Schuster.
  • Rodewald, P., J. Withgott, K. Smith. 2011. "Pine Warbler" (On-line). The Birds of North America. Accessed April 15, 2011 at http://bna.birds.cornell.edu/bna/species/438/articles/introduction.
  • Sibley, D. 2003. Sibley Feild guide to Birds. New York: Alfred A. Knopf Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: Subspecies PINUS from southeastern Manitoba east across Canada to southwestern New Brunswick, south to eastern Oklahoma and Texas, Gulf Coast, and southern Florida (AOU 1998). However, very local or absent within a broad section of land running east-west from western Ohio, Indiana, Illinois, and Iowa. A disjunct breeding population occurs in the "Lost Pines" area of east-central Texas (Bastrop, Caldwell, and Fayette counties). NON-BREEDING: Subspecies PINUS in the southeastern U.S. from eastern Maryland and Delaware to eastern edge of Oklahoma (Ouachita Mountains) and Texas south through the breeding range; rare to casual in northeastern U.S., Canadian provinces, southern Texas, and the Florida Keys (AOU 1998). Very few records for vagrants (mostly in winter) in Belize, Bermuda, Costa Rica, Cuba, Greenland (October), Jamaica, and northeastern Mexico. Scattered records (mostly spring and fall) in the western U.S. RESIDENT: Subspecies ACHRUSTERA in the Bahamas on Grand Bahama, Abaco, Andros, and New Providence. Subspecies CHRYSOLEUCA in the highlands of Hispaniola in western Haiti and eastern Dominican Republic (Dunn and Garrett 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Pine warblers are larger wood warblers with an average wingspan of 22 cm and average length of 14 cm. The average mass of pine warblers is around 12 g, however, individuals have been recorded with body masses ranging from 9.4 to 15.1 g. The average metabolic rate for pine warblers is 30.6 cm^3 oxygen per hour.

There is no data about sexual dimorphism in size for pine warblers however their sexual dimorphism in plumage is well known. Pine warblers exhibit much more subdued tones than many other warblers. Male breeding plumage includes an olive to yellow crown with this same coloration shared by the auriculars and the mantle. In contrast to the slightly drab crown there will be yellow orbital feathers and yellow lores, malar, and throat. The breast is yellow with olive streaking that fades into a white belly with some continuation of the olive streaks. The coverts, primaries, secondaries, tertials, and tail are grayish in coloration with some faint wing-bars. The legs, feet, and beak are dark in coloration.

Non-breeding males and females tend to be somewhat similar in plumage which is similar in pattern to the female breeding plumage except more subdued in coloration with more olive and brown tones. First year females are very subdued in coloration although they maintain the same characteristic markings. Newborn pine warblers are altricial and eventually develop dark brown, downy feathers.

Range mass: 9.4 to 15.1 g.

Average mass: 11.9 g.

Average length: 14 cm.

Average wingspan: 22 cm.

Average basal metabolic rate: 30.6 cm3.O2/g/hr.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

  • Baicich, P., C. Harrison. 2005. Nests, Eggs, and Nestlings of North American Birds. Princeton: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 14 cm

Weight: 12 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Bay-breasted warbler (DENDROICA CASTANEA) and blackpoll warbler (D. STRIATA) in winter plumage are sometimes confused with the pine warblers. Pine warblers differ from those species in having a heavier-bodied and larger-billed appearance, unstreaked upperparts, a darker face contrasting with paler throat, a longer tail, and narrow and duller edgings on tertials. In addition, pine warblers typically show a pale yellowish or grayish area extending up the sides of the neck, which contrasts with the slightly darker face. Pine warblers have dark legs and feet (adult blackpolls usually have yellowish to pinkish legs) and are usually darker green in upperparts than are bay-breasted warblers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pine warblers can be found almost exclusively in pine forests except during migration, when they may be found in habitats with few or no conifers, in addition to pine forests. There appears to be a preference for open pine forests; however they have been found in dense conifer stands or in small pockets of pines in a predominately deciduous forest.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; forest

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birders handbook. New York: Simon and Schuster.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Strongly associated with presence of pine and pine-hardwood forest during the breeding and winter seasons. A common breeder in most pine forests of the southeastern United States and in areas with pines in southeast Canada and the northeastern United States, but usually at lower densities, less common as a breeder in white pine forest areas. The highest numbers seem to occur where pure stands of pine are found; less abundant as the proportion of hardwood tree species increases. Birds are rarely found in deciduous forest, scrub, and thickets, except during migration and winter.

Breeding occurs in a wide variety of pine forest types but not in other conifer forests (e.g., spruce (PICEA spp.), fir (ABIES spp.), larch (LARIX spp.), or hemlock (TSUGA spp.). In the north-central and northeastern U.S. and Canadian provinces, breeding occurs in stands of red (PINUS RESINOSA), pitch (P. RIGIDA), jack (P. BANKSIANA) and white (P. STROBUS) pines (white pine also being used in the Appalachians). In southern states, breeding and winter habitat consists of stands of shortleaf (P. ECHINATA), longleaf (P. PALUSTRIS), loblolly (P. TAEDA), Virginia (P. VIRGINIANA), and slash (P. ELLIOTTII) pines. Breeding occurs less frequently in sand (P. CLAUSA) (Stevenson and Anderson 1994) and pond pines (P. SEROTINA) (Schroeder 1985) in the southeastern U.S. All forest types used may be mixed with varying proportions of hardwood species. Nesting may occur in areas of primarily deciduous forest where small groves of pines are present. Adapts well to pine plantations, which are used for breeding throughout the range. In Florida, Repenning and Labisky (1985) did not record breeding warblers in 1-, 10-, and 24-year-old slash pine plantations, but recorded 8 birds per sq km in 40-year-old plantation forests. However, they found that the species did use 1-year-old (3 birds per sq km), 24-year-old (20 birds per sq km), and 40-year-old (86 birds per sq km) pine plantations during winter.

In winter, birds commonly forage in large mixed-species flocks in southern pine forests when numbers increase because of birds migrating from farther north. At that time, flocks may forage in forest leaf litter, or in fields and pastures, usually in the vicinity of forest edge.

Density of pine warblers is inversely related to percent of deciduous vegetation within a stand (Schroeder 1985). In a breeding habitat suitability model developed by Schroeder (1985), three main habitat variables of importance were identified: percent tree canopy closure (excluding white, sand, and pond pines), successional stage of the stand, and percent of dominant canopy pines with deciduous understory in the upper one-third layer. Optimal nesting habitat was provided by pure, dense, mature pine stands (excluding pine species mentioned above) that lack a tall deciduous understory. One shortcoming of this model, however, is that warblers do use white pine forest types for nesting; they simply tend to be less common in those pine habitats.

Conner et al. (1983) reported that mature pine forests were favored in east Texas, with increasing abundance as the proportion of pole-size pines and vegetation height increased. Tree and shrub species diversity, and foliage density at different heights had little effect. In addition, stands of sapling-sized pines were avoided.

In eastern Tennessee, Anderson and Shugart (1974) found that distribution was influenced by several habitat variables, the strongest of which was related to average size of understory vegetation, number of canopy trees, and average size of canopy vegetation. In this area, birds selected areas with sparse understory and a dense canopy. In the Ouachita Mountains of Arkansas, Wilson et al. (1995) found significantly higher densities in forests with a more open midstory, lower canopy coverage, lower basal area of conifers and hardwoods, and dense ground cover of grasses, shrubs, vines, and forbs.

Nesting occurs typically in pine trees in forest, rarely in deciduous trees within pine forest. Nests usually are placed on a horizontal branch or among foliage at a branch tip, usually 8-20 m above ground. Nests are usually well hidden and difficult to observe from the ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migratory in the northern half of the range. In subspecies PINUS, spring migration occurs primarily from late February to mid-May. Fall migration begins in September in northern populations, with the majority of migration occurring in October. Birds in some southern populations may not migrate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Like almost all warblers, the diet of pine warblers consists mostly of insects and spiders. Most foraging is done in the mid to upper regions of pines and occasionally in deciduous trees. When arthropods are scarce, they are able to have more varied diets that include pine seeds, fruit, and berries. During the winter, they have been recorded eating corn, sunflower seeds, and suet from feeders. Pine warblers likely get all the water they need from their food because there are no reports of individuals drinking and they are often found nesting far from any water source.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Arthropods are of primary importance. Lepidoptera larvae and pupae probably are the most frequent food items; other foods include Blattidae, Coccididae, Diptera, Homoptera, Hemiptera, Orthoptera, Araneae, Coleoptera, Hymenoptera, and Arachnida (Nesbitt and Hetrick 1976, Sample et al. 1993). During late summer, fall, and winter, the diet also may include fruits of bayberry (MYRICA spp.), dogwood (CORNUS FLORIDA), grape (VITUS spp.), persimmon (DIOSPYROS VIRGINIANA), sumac (RHUS spp.), and Virginia creeper (PARTHENOCISSUS QUINQUEFOLIA) (Bent 1953). This species apparently is unique among warblers in its ability to consume seeds to a large extent. Most seeds eaten are those of pines, such as longleaf, pitch, shortleaf, and loblolly. However, little information exists on the frequency of seed-eating (see Morse 1967).

Foraging consists primarily of gleaning pine foliage and bark substrates, and sometimes deciduous foliage, especially during migration. Foraging occurs commonly on leaf litter of the forest floor in fall and winter, and sometimes in open habitats near forest edge. Sometimes flycatching is used to capture aerial prey items. Resident birds on Grand Bahama island foraged heavily on pine foliage and infrequently on bark surfaces, whereas birds used pine foliage and bark substrates approximately equally on Andros island (Emlen 1981).

Foraging movements are relatively slowly for a wood warbler, consisting of hopping along tree limbs and branches and searching bark and foliage substrates while ducking twigs and foliage. This warbler regularly searches bark of tree trunk by foraging at bases of branches or landing on trunk. This behavior also has been recorded during spring migration in deciduous forest before leaves emerge. Frequently, it forages in pine foliage at branch tips, moving from one branch tip to the next, sometimes hanging sideways or upsidedown to procure prey items.

Birds in the New Jersey Pine Barrens may respond to seasonal changes in arthropod abundance in oaks (Brush and Stiles 1990). In May, similar densities of pine warblers were found in two oak-pine forests, one of which was dominated by pines. However, when arthropod abundances were higher in the pine-dominated forest in June and July, significantly higher densities of birds were recorded in that forest. In pine forests during the breeding season, birds tended to forage higher, often at tips of branches in the canopy. Additional information on foraging can be found in Rodewald et al. (in prep.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Pine warblers have been known to join mixed-species flocks during migration which contain both warblers and other passerines. Pine warblers are also uncommon hosts for brown-headed cowbirds. Female brown-headed cowbirds may remove the existing warbler eggs or simply add their own. In response to this, some pine warblers have been noted to bury the foreign eggs within in the bottom of the nest. Pine warblers are known hosts of endoparasites from the genera Plasmodium (causing malaria), Leucocytozoon, and Haemoproteus. Pine warblers are also known hosts of the rabbit ticks, louse flies, flies, and deer ticks.

Commensal/Parasitic Species:

  • endoparasites (Plasmodium)
  • endoparasites (Leucocytozoon)
  • endoparasites (Haemoproteus)
  • rabbit ticks (Haemaphysalis leporispalustris)
  • louse flies (Ornithoica confluenta)
  • flies (Ornithomya fringillina)
  • deer ticks (Ixodes scapularis)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Little information exists about predation on pine warblers, but there is least one account of egg predation by blue jays.

Known Predators:

  • blue jays (Cyanocitta cristata)

  • Beane, J., S. Alford. 1990. Destruction of a Pine Warbler brood by an adult cowbird. Chat, 54: 85-87.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

2500 to >1,000,000 individuals

Comments: No data are available, but total abundance certainly is at least several thousand individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Various population density figures have been reported in the literature. In Georgia, Johnston and Odum (1956) recorded 0.4 territorial males per ha in 25-year-old pine forest, 0.85 males per ha in 35-year-old forest, 1.06 males per ha in 60-year-old forest, and 1.36 males per ha in 100-year-old forest. In Texas, Dickson and Segelquist (1979) reported 0.2 territorial males per ha in pine-hardwood sapling stands, 0.55 males per ha in pine pole stands, 0.35 males per ha in pine-hardwood pole stands, 0.50 males per ha in pine saw timber stands, and 0.20 males per ha in pine-hardwood stands. In pine plantations in southern Illinois, where the species is far less common, Graber et al. (1983) reported 2.2 males per 40.5 ha. In Maryland, Stewart and Robbins (1952) recorded breeding densities of 1.9 territorial males per ha in an immature loblolly-shortleaf pine forest, 0.5 males per ha in pine-oak forest (pitch and Virginia pines, and southern red oak (QUERCUS FALCATA), and 0.25 males per ha in a mature Virginia pine forest.

Winter bird count data from the Archbold Biological Station in central Florida (December 1993), indicate a density of approximately 2.35 birds per ha (J. Fitzpatrick, in litt.). In winter, it can be abundant in pine forests of the southeast where large mixed-species flocks may contain 50-100 or more pine warblers. In fall and winter, mixed-species flocks in southeastern pine forests usually form around Carolina chickadees (POECILE CAROLINENSIS) and tufted titmice (BAEOLOPHUS BICOLOR), and often include woodpeckers, brown-headed nuthatch (SITTA PUSILLA), eastern bluebird (SIALIUS SIALIA), kinglets (REGULUS spp.), and, farther south, blue-gray gnatcatcher (POLIOPTILA CAERULEA), blue-headed vireo (VIREO SOLITARIUS), yellow-rumped (DENDROICA CORONATA) and other warblers, and chipping sparrow (SPIZELLA PASSERINA) (Gaddis 1983, Morse 1970). Warblers in fall and winter flocks can be notoriously aggressive, with males frequently fighting, chasing, or supplanting other males and females (Morse 1974). Winter mixed-species flocks in north-central Florida contained pine warblers 65% of the time and had a mean of 2.6 individuals per flock (+ or - 1.8 SE) (Gaddis 1983).

There are few data on territory size, but size probably varies considerably depending on habitat quality. In pine-oak forest in northwestern Arkansas, two pairs held territories approximately 1.0 ha in size (Rodewald, pers. obs.). Howe (1979) observed a pair in Minnesota nest building on a 0.1-ha lake island located 450 m from shore, indicating territories can be quite small in some cases. However, warblers were more regularly recorded on 1.0-ha lake islands. In oak-pine forests with low percentages of pines, may utilize only a small proportion of a much larger territory, typically moving from pine tree to pine tree and passing over deciduous trees (Morse 1974).

Interspecifically aggressive towards many bird species, especially yellow-throated warblers (D. DOMINICA) during the breeding season on Delmarva peninsula in Maryland. Pine warblers typically prevail in aggressive encounters, and were even recorded displaying towards and countersinging with yellow-throated warblers (Ficken et al. 1968, Morse 1974). Aggressive behavior towards yellow-throated warblers has also been noted in northwestern Arkansas (Rodewald, pers. obs.). Brown-headed nuthatches flocking with pine warblers in Louisiana foraged heavily on distal parts of limbs and twigs, whereas warblers foraged in areas near tree trunks. In the absence of one another, the two species exhibited similar foraging distributions, indicating that each has an influence on the foraging behavior of the other (Morse 1967).

Individuals wintering in southern forests are susceptible to extremes in weather and temperature. After 5 inches of snow and near-zero temperatures in coastal South Carolina in February 1899, Wayne (1899) reported finding countless dead birds of 16 species, including many pine warblers, a species he described as "decimated" by the cold.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Like most warblers, only male pine warblers sing. Unlike most other warblers, males can be heard singing throughout the year, though there is a noticeable increase in the frequency of their songs during the early part of the breeding season. Songs are short, and typically only last a second or two. Their song is characterized as a short rapid trill that can have a fair amount of improvisation. Notes are often similar in pitch and slightly slurred. Both sexes also make contact calls, which are high chirps of short duration. Rarely, they make a flight call that sounds like “seet”, but this call is often very weak and therefore rarely heard.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: No quantitative information is available on diurnal fluctuations in activity, but birds seem more active from early to mid-morning, and late afternoon to early evening.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Little is known about the lifespan of pine warblers, but the oldest recorded banded individual was 6 years old when it was recaptured for the second time.

Range lifespan

Status: wild:
6 (low) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.2 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Little is known about the courtship behaviors of pine warblers. There is some evidence to suggest that mate guarding takes place and males have been observed to be antagonistic towards other males. It is believed that they are monogamous throughout the breeding season with no extra pair copulations being recorded. It is unknown if pairs remain coupled for more than one breeding season.

Mating System: monogamous

Pine warblers normally begin nest building in late March to early June in the north. Nests are almost always built in one of 15 species in the genus Pinus. Nests are constructed normally between 8 and 12 meters off the ground although finding a nest between 3 and 35 meters high is not that uncommon and there is one report of ground nesting. Nests are built almost exclusively on horizontal branches, often at a fork which gives a sturdy base to build a nest. Their compact cup nests are constructed from strips of bark, plant stems, pine twigs, and leaves bound with silk form caterpillar cocoons or spider’s webs. Nests are then lined with feathers, hair, and soft plant material. Nest building is done almost exclusively by females, however males often accompany their mates while singing frequently.

A clutch of 4 white spotted eggs are laid, although in rare cases 3 or 5 are laid. The eggs are incubated almost exclusively by females, but males are known to feed mates during egg incubation which lasts for a period of 12 to 13 days. Newborns are ready to leave the nest after about 10 days. A pair of pine warblers may have 1 to 3 clutches per year. It is believed that individuals are sexually mature after one year however there is no direct evidence to support this.

Breeding interval: Pine warblers will brood 1 or 3 clutches per year.

Breeding season: The breeding season for pine warblers takes place from late March to early June.

Range eggs per season: 3 to 5.

Range time to hatching: 12 to 13 days.

Average fledging age: 10 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Females both construct nests and perform all incubation duties. During these periods, males will occasionally bring food to their mates as well as sing to defend the territory. The chicks are born altricial and are fed by both parents until they are ready to leave the nest. Time to independence is currently unknown, but parents likely continue to care for their brood for several days post-fledging.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Baicich, P., C. Harrison. 2005. Nests, Eggs, and Nestlings of North American Birds. Princeton: Princeton University Press.
  • Chapman, F. 1907. The Warblers of North America. New York: D. Appleton & Company.
  • Dunne, P. 2006. Essential Feild Guide Companion. New York: Houghton Mifflin Company.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birders handbook. New York: Simon and Schuster.
  • Harrison, H. 1984. Wood Warblers' World. New York: Simon and Schuster.
  • Morse, D. 1989. American Warblers. Cambridge: Harvard University Press.
  • Reed, C. 1965. North American Bird Eggs. New York: Dover Publications.
  • Rodewald, P., J. Withgott, K. Smith. 2011. "Pine Warbler" (On-line). The Birds of North America. Accessed April 15, 2011 at http://bna.birds.cornell.edu/bna/species/438/articles/introduction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Perhaps due to the usual nesting high in trees, there are little data on reproduction. Breeding territories are established from late winter in the south to spring farther north. Breeding can begin in early-March in deep southern populations, later in the north, and may extend to early August. Based on 226 clutches from throughout the range, McNair (1987) reported a mean clutch initiation date of 20 April +/- 25 days (standard deviation). Median initiation date was 12 April; clutches were initiated between 7 March and 7 July. During an early spring in Georgia, one unfinished nest was found on 17 February (Burleigh 1958); however, most nest building does not begin until March in southern states. In more northerly states, nesting begins in April, May, or early June.

Males establish territories through persistent singing, continuous presence, and chasing or attacking intruding birds. Fights and chases among males become less common as season progresses, at which time males seem to maintain territories primarily through singing.

Clutch size is three to five (usually four). Although it is widely mentioned that the species is double-brooded, and even triple-brooded (Potter et al. 1980), there are no data to support those claims. It is almost certain the species can raise more than one brood per year, especially in southern states. Incubation, primarily by the female (male occasionally assists), lasts 12-13 days. Males feed the female on the nest. Young are fed by both parents during nestling and fledgling stages. The period of time parents feed young after fledging is unknown. Birds reach sexual maturity within one year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendroica pinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTAATTCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTGGGAGACGACCAAGTCTACAATGTAGTTGTCACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTTATGCCAATTATGATCGGTGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTACCACCATCATTCCTTCTCCTCCTAGCATCTTCCACAGTCGAAGCAGGCGTAGGTACAGGCTGAACAGTATACCCCCCACTAGCTGGCAACCTAGCCCACGCCGGAGCCTCAGTCGACCTCGCAATCTTCTCTCTACACCTAGCCGGTATTTCCTCAATCCTCGGGGCAATCAACTTTATTACAACAGCAATTAACATGAAACCTCCTGCCCTCTCACAATACCAAACCCCACTATTCGTATGATCAGTCCTAATCACTGCAGTCCTACTACTCCTTTCCCTTCCAGTCCTAGCTGCAGGAATCACAATACTCCTCACAGACCGCAACCTCAACACCACATTCTTTGACCCTGCTGGAGGAGGAGATCCCGTCCTATACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dendroica pinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5