Overview

Brief Summary

Setophaga pinus

A medium-sized (5-5 ½ inches) wood warbler, the male Pine Warbler is most easily identified by its olive-green back, yellow breast, and dark wings with conspicuous white wing bars. Female Pine Warblers are similar to males, but are somewhat duller. Many North American wood warblers are pale olive-green, but this species alone possesses this plumage in combination with white wing bars. The Pine Warbler breeds across much of the eastern United States and southern Canada, although its range is highly fragmented in much of the Midwest and interior northeast. In winter, northerly-breeding populations abandon their breeding grounds and spend the winter in the southeastern U.S.Populations breeding in the southeast are non-migratory, and isolated non-migratory populations also occur in the Bahamas and on the island of Hispaniola. Appropriately, Pine Warblers primarily breed in pine forests. Migratory populations move into similar habitats in winter as they utilized the summer before, and tropical populations are highly specific to pine barrens or mountain forests where isolated patches of suitable habitat occur. Pine Warblers primarily eat small invertebrates, including insects and spiders, although this species may eat some plant material, particularly fruits and berries, during the winter. In appropriate habitat, Pine Warblers may be observed foraging for food on pine needles and in bark crevices. Birdwatchers may also listen for this species’ song, a trilled “cheeeeeee. ” Pine Warblers are primarily active during the day, but, like many songbirds, migratory populations migrate at night.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: Subspecies PINUS from southeastern Manitoba east across Canada to southwestern New Brunswick, south to eastern Oklahoma and Texas, Gulf Coast, and southern Florida (AOU 1998). However, very local or absent within a broad section of land running east-west from western Ohio, Indiana, Illinois, and Iowa. A disjunct breeding population occurs in the "Lost Pines" area of east-central Texas (Bastrop, Caldwell, and Fayette counties). NON-BREEDING: Subspecies PINUS in the southeastern U.S. from eastern Maryland and Delaware to eastern edge of Oklahoma (Ouachita Mountains) and Texas south through the breeding range; rare to casual in northeastern U.S., Canadian provinces, southern Texas, and the Florida Keys (AOU 1998). Very few records for vagrants (mostly in winter) in Belize, Bermuda, Costa Rica, Cuba, Greenland (October), Jamaica, and northeastern Mexico. Scattered records (mostly spring and fall) in the western U.S. RESIDENT: Subspecies ACHRUSTERA in the Bahamas on Grand Bahama, Abaco, Andros, and New Providence. Subspecies CHRYSOLEUCA in the highlands of Hispaniola in western Haiti and eastern Dominican Republic (Dunn and Garrett 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Pine warblers, Dendroica pinus, range throughout most of eastern North America. Their northern range extends to the most southern portions of Manitoba, Ontario, and Quebec in Canada. The southern extent of their range extends from Florida, to the southern tip of Texas. The eastern border of the range is the Atlantic coast of the United States (US) and Canada, while its western range runs through the US states of Minnesota, Wisconsin, Illinois, Missouri, Arkansas, and Texas. The breeding range of pine warblers covers much of their general range with the exception of parts of southern Texas and Louisiana. Despite the large breeding range, it is worth noting that breeding populations are often quite isolated in the central parts of their range. The winter range of pine warblers includes much of the southern portion of their breeding range which is unusual for a wood warbler. Their winter range extends as far north as mid-Arkansas, southern Tennessee, as well as southern Virginia.

Biogeographic Regions: nearctic (Native )

  • Harrison, H. 1984. Wood Warblers' World. New York: Simon and Schuster.
  • Chapman, F. 1907. The Warblers of North America. New York: D. Appleton & Company.
  • Dunne, P. 2006. Essential Feild Guide Companion. New York: Houghton Mifflin Company.
  • Rodewald, P., J. Withgott, K. Smith. 2011. "Pine Warbler" (On-line). The Birds of North America. Accessed April 15, 2011 at http://bna.birds.cornell.edu/bna/species/438/articles/introduction.
  • Sibley, D. 2003. Sibley Feild guide to Birds. New York: Alfred A. Knopf Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Pine warblers are larger wood warblers with an average wingspan of 22 cm and average length of 14 cm. The average mass of pine warblers is around 12 g, however, individuals have been recorded with body masses ranging from 9.4 to 15.1 g. The average metabolic rate for pine warblers is 30.6 cm^3 oxygen per hour.

There is no data about sexual dimorphism in size for pine warblers however their sexual dimorphism in plumage is well known. Pine warblers exhibit much more subdued tones than many other warblers. Male breeding plumage includes an olive to yellow crown with this same coloration shared by the auriculars and the mantle. In contrast to the slightly drab crown there will be yellow orbital feathers and yellow lores, malar, and throat. The breast is yellow with olive streaking that fades into a white belly with some continuation of the olive streaks. The coverts, primaries, secondaries, tertials, and tail are grayish in coloration with some faint wing-bars. The legs, feet, and beak are dark in coloration.

Non-breeding males and females tend to be somewhat similar in plumage which is similar in pattern to the female breeding plumage except more subdued in coloration with more olive and brown tones. First year females are very subdued in coloration although they maintain the same characteristic markings.

Newborn pine warblers are altricial and eventually develop dark brown, downy feathers.

Range mass: 9.4 to 15.1 g.

Average mass: 11.9 g.

Average length: 14 cm.

Average wingspan: 22 cm.

Average basal metabolic rate: 30.6 cm^3 oxygen/hour.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

  • Baicich, P., C. Harrison. 2005. Nests, Eggs, and Nestlings of North American Birds. Princeton: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 14 cm

Weight: 12 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Bay-breasted warbler (DENDROICA CASTANEA) and blackpoll warbler (D. STRIATA) in winter plumage are sometimes confused with the pine warblers. Pine warblers differ from those species in having a heavier-bodied and larger-billed appearance, unstreaked upperparts, a darker face contrasting with paler throat, a longer tail, and narrow and duller edgings on tertials. In addition, pine warblers typically show a pale yellowish or grayish area extending up the sides of the neck, which contrasts with the slightly darker face. Pine warblers have dark legs and feet (adult blackpolls usually have yellowish to pinkish legs) and are usually darker green in upperparts than are bay-breasted warblers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Strongly associated with presence of pine and pine-hardwood forest during the breeding and winter seasons. A common breeder in most pine forests of the southeastern United States and in areas with pines in southeast Canada and the northeastern United States, but usually at lower densities, less common as a breeder in white pine forest areas. The highest numbers seem to occur where pure stands of pine are found; less abundant as the proportion of hardwood tree species increases. Birds are rarely found in deciduous forest, scrub, and thickets, except during migration and winter.

Breeding occurs in a wide variety of pine forest types but not in other conifer forests (e.g., spruce (PICEA spp.), fir (ABIES spp.), larch (LARIX spp.), or hemlock (TSUGA spp.). In the north-central and northeastern U.S. and Canadian provinces, breeding occurs in stands of red (PINUS RESINOSA), pitch (P. RIGIDA), jack (P. BANKSIANA) and white (P. STROBUS) pines (white pine also being used in the Appalachians). In southern states, breeding and winter habitat consists of stands of shortleaf (P. ECHINATA), longleaf (P. PALUSTRIS), loblolly (P. TAEDA), Virginia (P. VIRGINIANA), and slash (P. ELLIOTTII) pines. Breeding occurs less frequently in sand (P. CLAUSA) (Stevenson and Anderson 1994) and pond pines (P. SEROTINA) (Schroeder 1985) in the southeastern U.S. All forest types used may be mixed with varying proportions of hardwood species. Nesting may occur in areas of primarily deciduous forest where small groves of pines are present. Adapts well to pine plantations, which are used for breeding throughout the range. In Florida, Repenning and Labisky (1985) did not record breeding warblers in 1-, 10-, and 24-year-old slash pine plantations, but recorded 8 birds per sq km in 40-year-old plantation forests. However, they found that the species did use 1-year-old (3 birds per sq km), 24-year-old (20 birds per sq km), and 40-year-old (86 birds per sq km) pine plantations during winter.

In winter, birds commonly forage in large mixed-species flocks in southern pine forests when numbers increase because of birds migrating from farther north. At that time, flocks may forage in forest leaf litter, or in fields and pastures, usually in the vicinity of forest edge.

Density of pine warblers is inversely related to percent of deciduous vegetation within a stand (Schroeder 1985). In a breeding habitat suitability model developed by Schroeder (1985), three main habitat variables of importance were identified: percent tree canopy closure (excluding white, sand, and pond pines), successional stage of the stand, and percent of dominant canopy pines with deciduous understory in the upper one-third layer. Optimal nesting habitat was provided by pure, dense, mature pine stands (excluding pine species mentioned above) that lack a tall deciduous understory. One shortcoming of this model, however, is that warblers do use white pine forest types for nesting; they simply tend to be less common in those pine habitats.

Conner et al. (1983) reported that mature pine forests were favored in east Texas, with increasing abundance as the proportion of pole-size pines and vegetation height increased. Tree and shrub species diversity, and foliage density at different heights had little effect. In addition, stands of sapling-sized pines were avoided.

In eastern Tennessee, Anderson and Shugart (1974) found that distribution was influenced by several habitat variables, the strongest of which was related to average size of understory vegetation, number of canopy trees, and average size of canopy vegetation. In this area, birds selected areas with sparse understory and a dense canopy. In the Ouachita Mountains of Arkansas, Wilson et al. (1995) found significantly higher densities in forests with a more open midstory, lower canopy coverage, lower basal area of conifers and hardwoods, and dense ground cover of grasses, shrubs, vines, and forbs.

Nesting occurs typically in pine trees in forest, rarely in deciduous trees within pine forest. Nests usually are placed on a horizontal branch or among foliage at a branch tip, usually 8-20 m above ground. Nests are usually well hidden and difficult to observe from the ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pine warblers can be found almost exclusively in pine forests except during migration, when they may be found in habitats with few or no conifers, in addition to pine forests. There appears to be a preference for open pine forests; however they have been found in dense conifer stands or in small pockets of pines in a predominately deciduous forest.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; forest

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birders handbook. New York: Simon and Schuster.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migratory in the northern half of the range. In subspecies PINUS, spring migration occurs primarily from late February to mid-May. Fall migration begins in September in northern populations, with the majority of migration occurring in October. Birds in some southern populations may not migrate.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Arthropods are of primary importance. Lepidoptera larvae and pupae probably are the most frequent food items; other foods include Blattidae, Coccididae, Diptera, Homoptera, Hemiptera, Orthoptera, Araneae, Coleoptera, Hymenoptera, and Arachnida (Nesbitt and Hetrick 1976, Sample et al. 1993). During late summer, fall, and winter, the diet also may include fruits of bayberry (MYRICA spp.), dogwood (CORNUS FLORIDA), grape (VITUS spp.), persimmon (DIOSPYROS VIRGINIANA), sumac (RHUS spp.), and Virginia creeper (PARTHENOCISSUS QUINQUEFOLIA) (Bent 1953). This species apparently is unique among warblers in its ability to consume seeds to a large extent. Most seeds eaten are those of pines, such as longleaf, pitch, shortleaf, and loblolly. However, little information exists on the frequency of seed-eating (see Morse 1967).

Foraging consists primarily of gleaning pine foliage and bark substrates, and sometimes deciduous foliage, especially during migration. Foraging occurs commonly on leaf litter of the forest floor in fall and winter, and sometimes in open habitats near forest edge. Sometimes flycatching is used to capture aerial prey items. Resident birds on Grand Bahama island foraged heavily on pine foliage and infrequently on bark surfaces, whereas birds used pine foliage and bark substrates approximately equally on Andros island (Emlen 1981).

Foraging movements are relatively slowly for a wood warbler, consisting of hopping along tree limbs and branches and searching bark and foliage substrates while ducking twigs and foliage. This warbler regularly searches bark of tree trunk by foraging at bases of branches or landing on trunk. This behavior also has been recorded during spring migration in deciduous forest before leaves emerge. Frequently, it forages in pine foliage at branch tips, moving from one branch tip to the next, sometimes hanging sideways or upsidedown to procure prey items.

Birds in the New Jersey Pine Barrens may respond to seasonal changes in arthropod abundance in oaks (Brush and Stiles 1990). In May, similar densities of pine warblers were found in two oak-pine forests, one of which was dominated by pines. However, when arthropod abundances were higher in the pine-dominated forest in June and July, significantly higher densities of birds were recorded in that forest. In pine forests during the breeding season, birds tended to forage higher, often at tips of branches in the canopy. Additional information on foraging can be found in Rodewald et al. (in prep.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Like almost all warblers, pine warblers diets consist mostly of insects and spiders. Most foraging is done in the mid to upper regions of pines and occasionally in deciduous trees. When arthropods are scarce they are able to have more varied diets that include pine seeds, fruit, and berries.

During the winter individuals have been noted to eat corn, sunflower seeds, and suet from feeders.

It is believed that pine warblers obtain adequate water from their diet because there are no reports of individuals drinking and they are often found nesting far from any water source.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

There has been very little research about the ecological roles of this species. Pine warblers have been known to join mixed-species flocks during migration which contain both warblers and other passerines. Pine warblers are known hosts of endoparasites from the genera Plasmodium (causing malaria), Leucocytozoon, and Haemoproteus. Pine warblers are also known hosts of the rabbit ticks, louse flies, flies, and deer ticks.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Little information exists about predation on pine warblers. There is at least one account of egg predation by blue jays. Pine warblers are also uncommon hosts for brown-headed cowbirds. Female brown-headed cowbirds may remove the existing warbler eggs or simply add their own. In response to this, some pine warblers have been noted to bury the foreign eggs within in the bottom of the nest.

Known Predators:

  • Beane, J., S. Alford. 1990. Destruction of a Pine Warbler brood by an adult cowbird. Chat, 54: 85-87.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 to >1,000,000 individuals

Comments: No data are available, but total abundance certainly is at least several thousand individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Various population density figures have been reported in the literature. In Georgia, Johnston and Odum (1956) recorded 0.4 territorial males per ha in 25-year-old pine forest, 0.85 males per ha in 35-year-old forest, 1.06 males per ha in 60-year-old forest, and 1.36 males per ha in 100-year-old forest. In Texas, Dickson and Segelquist (1979) reported 0.2 territorial males per ha in pine-hardwood sapling stands, 0.55 males per ha in pine pole stands, 0.35 males per ha in pine-hardwood pole stands, 0.50 males per ha in pine saw timber stands, and 0.20 males per ha in pine-hardwood stands. In pine plantations in southern Illinois, where the species is far less common, Graber et al. (1983) reported 2.2 males per 40.5 ha. In Maryland, Stewart and Robbins (1952) recorded breeding densities of 1.9 territorial males per ha in an immature loblolly-shortleaf pine forest, 0.5 males per ha in pine-oak forest (pitch and Virginia pines, and southern red oak (QUERCUS FALCATA), and 0.25 males per ha in a mature Virginia pine forest.

Winter bird count data from the Archbold Biological Station in central Florida (December 1993), indicate a density of approximately 2.35 birds per ha (J. Fitzpatrick, in litt.). In winter, it can be abundant in pine forests of the southeast where large mixed-species flocks may contain 50-100 or more pine warblers. In fall and winter, mixed-species flocks in southeastern pine forests usually form around Carolina chickadees (POECILE CAROLINENSIS) and tufted titmice (BAEOLOPHUS BICOLOR), and often include woodpeckers, brown-headed nuthatch (SITTA PUSILLA), eastern bluebird (SIALIUS SIALIA), kinglets (REGULUS spp.), and, farther south, blue-gray gnatcatcher (POLIOPTILA CAERULEA), blue-headed vireo (VIREO SOLITARIUS), yellow-rumped (DENDROICA CORONATA) and other warblers, and chipping sparrow (SPIZELLA PASSERINA) (Gaddis 1983, Morse 1970). Warblers in fall and winter flocks can be notoriously aggressive, with males frequently fighting, chasing, or supplanting other males and females (Morse 1974). Winter mixed-species flocks in north-central Florida contained pine warblers 65% of the time and had a mean of 2.6 individuals per flock (+ or - 1.8 SE) (Gaddis 1983).

There are few data on territory size, but size probably varies considerably depending on habitat quality. In pine-oak forest in northwestern Arkansas, two pairs held territories approximately 1.0 ha in size (Rodewald, pers. obs.). Howe (1979) observed a pair in Minnesota nest building on a 0.1-ha lake island located 450 m from shore, indicating territories can be quite small in some cases. However, warblers were more regularly recorded on 1.0-ha lake islands. In oak-pine forests with low percentages of pines, may utilize only a small proportion of a much larger territory, typically moving from pine tree to pine tree and passing over deciduous trees (Morse 1974).

Interspecifically aggressive towards many bird species, especially yellow-throated warblers (D. DOMINICA) during the breeding season on Delmarva peninsula in Maryland. Pine warblers typically prevail in aggressive encounters, and were even recorded displaying towards and countersinging with yellow-throated warblers (Ficken et al. 1968, Morse 1974). Aggressive behavior towards yellow-throated warblers has also been noted in northwestern Arkansas (Rodewald, pers. obs.). Brown-headed nuthatches flocking with pine warblers in Louisiana foraged heavily on distal parts of limbs and twigs, whereas warblers foraged in areas near tree trunks. In the absence of one another, the two species exhibited similar foraging distributions, indicating that each has an influence on the foraging behavior of the other (Morse 1967).

Individuals wintering in southern forests are susceptible to extremes in weather and temperature. After 5 inches of snow and near-zero temperatures in coastal South Carolina in February 1899, Wayne (1899) reported finding countless dead birds of 16 species, including many pine warblers, a species he described as "decimated" by the cold.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like most warblers, only male pine warblers will sing. Unlike most other warblers, males can be heard singing throughout the year although there is a noticeable increase in the frequency of their songs during the early part of the breeding season. Songs are short, and typically only last a second or two. Their song is characterized as a short rapid trill that can have a fair amount of improvisation. Notes are often similar in pitch and slightly slurred.

Pine warblers' contact calls, which are made by both sexes, are high chirps of short duration. There is also a flight call “seet”, however this call is often very weak and therefore rarely heard.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: No quantitative information is available on diurnal fluctuations in activity, but birds seem more active from early to mid-morning, and late afternoon to early evening.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Little is known about the lifespan of pine warblers, but the oldest recorded banded individual was 6 years old when it was recaptured for the second time.

Range lifespan

Status: wild:
6 (low) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.2 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Perhaps due to the usual nesting high in trees, there are little data on reproduction. Breeding territories are established from late winter in the south to spring farther north. Breeding can begin in early-March in deep southern populations, later in the north, and may extend to early August. Based on 226 clutches from throughout the range, McNair (1987) reported a mean clutch initiation date of 20 April +/- 25 days (standard deviation). Median initiation date was 12 April; clutches were initiated between 7 March and 7 July. During an early spring in Georgia, one unfinished nest was found on 17 February (Burleigh 1958); however, most nest building does not begin until March in southern states. In more northerly states, nesting begins in April, May, or early June.

Males establish territories through persistent singing, continuous presence, and chasing or attacking intruding birds. Fights and chases among males become less common as season progresses, at which time males seem to maintain territories primarily through singing.

Clutch size is three to five (usually four). Although it is widely mentioned that the species is double-brooded, and even triple-brooded (Potter et al. 1980), there are no data to support those claims. It is almost certain the species can raise more than one brood per year, especially in southern states. Incubation, primarily by the female (male occasionally assists), lasts 12-13 days. Males feed the female on the nest. Young are fed by both parents during nestling and fledgling stages. The period of time parents feed young after fledging is unknown. Birds reach sexual maturity within one year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Little is known about the courtship behaviors of pine warblers. There is some evidence to suggest that mate guarding takes place and males have been observed to be antagonistic towards other males. It is believed that they are monogamous throughout the breeding season with no extra pair copulations being recorded. It is unknown if pairs remain coupled for more than one breeding season.

Mating System: monogamous

Nest building normally begins in late March to early June in the north. Nests are almost always built in one of 15 species in the genus Pinus. Nests are constructed normally between 8 and 12 meters off the ground although finding a nest between 3 and 35 meters high is not that uncommon and there is one report of ground nesting. Nests are built almost exclusively on horizontal branches, often at a fork which gives a sturdy base to build a nest. Their compact cup nests are constructed from strips of bark, plant stems, pine twigs, and leaves bound with silk form caterpillar cocoons or spider’s webs. Nests are then lined with feathers, hair, and soft plant material. Nest building is done almost exclusively by females, however males often accompany their mates while singing frequently.

A clutch of 4 white spotted eggs are laid, although in rare cases 3 or 5 are laid. The eggs are incubated almost exclusively by females, but males are known to feed mates during egg incubation which lasts for a period of 12 to 13 days. Newborns are ready to leave the nest after about 10 days. A pair of pine warblers may brood 1 to 3 clutches per year.

It is believed that individuals are sexually mature after one year however there is no direct evidence to support this.

Breeding interval: Pine warblers will brood 1 or 3 clutches per year.

Breeding season: The breeding season for pine warblers takes place from late March to early June.

Range eggs per season: 3 to 5.

Range time to hatching: 12 to 13 days.

Average fledging age: 10 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Females both construct nests and perform all incubation duties. During these periods, males will occasionally bring food to their mates as well as sing to defend the territory. The chicks are born altricial and are fed by both parents until they are ready to leave the nest. Time to independence is currently unknown, but parents likely continue to care for their brood for several days post-fledging.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Harrison, H. 1984. Wood Warblers' World. New York: Simon and Schuster.
  • Baicich, P., C. Harrison. 2005. Nests, Eggs, and Nestlings of North American Birds. Princeton: Princeton University Press.
  • Chapman, F. 1907. The Warblers of North America. New York: D. Appleton & Company.
  • Dunne, P. 2006. Essential Feild Guide Companion. New York: Houghton Mifflin Company.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birders handbook. New York: Simon and Schuster.
  • Morse, D. 1989. American Warblers. Cambridge: Harvard University Press.
  • Reed, C. 1965. North American Bird Eggs. New York: Dover Publications.
  • Rodewald, P., J. Withgott, K. Smith. 2011. "Pine Warbler" (On-line). The Birds of North America. Accessed April 15, 2011 at http://bna.birds.cornell.edu/bna/species/438/articles/introduction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendroica pinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTAATTCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTGGGAGACGACCAAGTCTACAATGTAGTTGTCACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTTATGCCAATTATGATCGGTGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTACCACCATCATTCCTTCTCCTCCTAGCATCTTCCACAGTCGAAGCAGGCGTAGGTACAGGCTGAACAGTATACCCCCCACTAGCTGGCAACCTAGCCCACGCCGGAGCCTCAGTCGACCTCGCAATCTTCTCTCTACACCTAGCCGGTATTTCCTCAATCCTCGGGGCAATCAACTTTATTACAACAGCAATTAACATGAAACCTCCTGCCCTCTCACAATACCAAACCCCACTATTCGTATGATCAGTCCTAATCACTGCAGTCCTACTACTCCTTTCCCTTCCAGTCCTAGCTGCAGGAATCACAATACTCCTCACAGACCGCAACCTCAACACCACATTCTTTGACCCTGCTGGAGGAGGAGATCCCGTCCTATACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dendroica pinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large breeding range in eastern North America; common in many areas; increasing in recent decades.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pine warblers are currently listed as a species of least concern. This species occupies a large range throughout most of the eastern United States, however its range is threatened by logging and development causing habitat loss and fragmentation. Future studies should focus on the impacts of this habitat loss and ensure that populations are large enough to persist.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: North American Breeding Bird Survey (BBS) data indicate a significant population increase in North America: 65% increase between 1966 and 1993, 30% increase from 1984 to 1993 (Price et al. 1995). Range-wide BBS data indicate a significant population increase of 1.6% per year during the period 1966-1994 (Sauer et al. 1997). During 1966-1979, the species showed a nonsignificant range-wide decrease of 0.8% per year (Peterjohn and Sauer 1993), and from 1980-1994 it significantly increased 2.7% per year. Witham and Hunter (1992) analyzed 1966-1987 BBS data from the northern New England region and reported a significant population increase of 5.1% per year (P < 0.05); in central New England the population increased by 8.6% per year (P < 0.01). No large-scale historical changes in distribution are known. Nesting range in Connecticut, Long Island, and locally elsewhere in the eastern United States has decreased as a result of habitat loss (Bull 1974, Zeranski and Baptist 1990). Kerlinger and Doremus (1981) reported a local extirpation in an isolated area of pine barrens near Albany, New York, even though the species was apparently not uncommon there in 1954 (Bull 1974). In Huron County, southeastern Michigan, was abundant in the early 1900s, but was not recorded in the area by the state breeding bird atlas (Brewer et al. 1991). However, in southeast Ohio, the range expanded in the 20th century in the unglaciated Allegheny Plateau (Peterjohn and Rice 1991). In areas where deciduous forest has been converted to pine plantations, such as in areas of the Ozark Highlands (e.g., Smith and Petit 1988), warblers have undoubtedly increased.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Some forest management practices, such as clearcutting, should adversely affect the warbler because of its dependence on forest habitat. While it may be found during the breeding season in younger forests, those individuals are not necessarily breeding or breeding successfully. In Virgina, Conner et al. (1979) examined relative bird abundance in pine-oak forest clearcuts of differing ages. The species was found in increasing abundance in clearcuts greater than 10 years old and were most abundant in mature 80-year-old stands. Single-tree and group-selection cutting, while removing fewer canopy trees from forest areas, may cause increased nest predation from birds and mammals, and nest parasitism from brown-headed cowbirds (MOLOTHRUS ATER). Spread of suburban areas in pine forest regions could also cause local declines or extirpation through increased fragmentation and/or loss of forest habitat. Spraying of pesticides is of concern. Whitmore et al. (1993) found that warblers in forests treated for gypsy moths with Diflubenzuron (Dimilin [registered trademark]) had significantly lower fat reserves than birds in an untreated forest. On the same study site, Sample et al. (1993) showed no significant dietary differences of warblers between treated and untreated forests, and birds consumed the same biomass of prey on both treatments. Casualties have been recorded in areas where DDT was used to control Dutch elm disease in the 1950s (Wallace et al. 1961), and where arsenical spray had been used (Barbour 1937). Nocturnal migrants are killed at television and radio towers, though this species seems less common in kills than other species. In a 25-year study at a north Florida tower, 217 individuals were found dead (Crawford 1981). Johnston and Haines (1957) reported 106 pine wrblers killed at television towers, tall buildings, and airport ceiliometers during two nights of migration in the eastern U.S. in October 1954. Predators are not well known. Egg predators probably include blue jay (CYANOCITTA CRISTATA), American crow (CORVUS BRACHYRHYNCHOS), common grackle (QUISCALUS QUISCULA), red squirrel (TAMIASCIURUS HUDSONICUS), gray squirrel (SCIURUS CAROLINENSIS), raccoon (PROCYON LOTOR), opossum (DIDELPHIS VIRGINIANUS), and snakes. Nestling predators probably are similar, but may include domestic cats, owls, and hawks. A blue jay was observed consuming a nestling in Arkansas (Rodewald, pers. obs.). Sharp-shinned (ACCIPITER STRIATUS) and Cooper's (A. COOPERII), hawks probably prey on adults. Adults are known to mob eastern screech-owl (OTUS ASIO) (Rodewald, pers. obs.) and chuck-will's-widow (CAPRIMULGUS CAROLINENSIS) (Ficken et al. 1967), indicating those are also potential predators of adults. Reported infrequently as hosts for parasitic brown-headed cowbirds (MOLOTHRUS ATER). Friedmann and Kiff (1985) mentioned only 15 known cases of nest parasitism by cowbirds on pine warblers. Given that little is known about the breeding biology of warblers, it seems likely that it is a more frequent host of cowbirds than currently known. There is also a record of an adult female cowbird removing four warbler young from a nest and dropping them to the ground (Beane and Alford 1990). Reed (1992) used a classification system to rank neotropical migrant birds based on their relative susceptibility to extinction. Based on considerations of range, habitat specificity, distribution, and population size, the pine warbler received a "5" on a scale from 1-8, with 1 being the rating of highest concern.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: With populations apparently increasing, the potential of restoring this species to higher population levels is quite good. Some habitat will be lost in the future through expanding urban/suburban areas. However, changes in land and forest management practices could expand available habitat and improve existing habitats to make them more productive for this and possibly other species (e.g., Bachman's sparrow (AIMOPHILA AESTIVALIS), brown-headed nuthatch, and red-cockaded woodpecker (PICOIDES BOREALIS) in southern pine forests).

Preserve Selection and Design Considerations: Given the present knowledge of the natural history of the warbler, it is difficult to make entirely informed suggestions about characteristics of preserve design. There is strong indication that large forest area is important to sustain viable populations. Whitcomb et al. (1981) considered it a forest-interior species. Schroeder (1985) mentions a minimum estimate of 10-15 ha of forest habitat as required to sustain a breeding population and Robbins (1979) estimated the minimum area to be 30 ha. However, Robbins et al. (1989) found no significant relationship between probability of occurrence and forest area for pine warblers. While this study found no indications that forest isolation is of importance to this species, it is likely that high isolation of fragments could lead to declines or extirpation in isolated patches. Lynch and Whigham (1984) showed that even a modest degree of habitat isolation reduced abundance of some migratory bird species in Maryland.

In a old-growth hammock in Florida, Noss (1991) recorded significantly higher numbers of warblers closer to edges than in the forest interior during the breeding season, and considered it an "edge-attracted species." While this species may be attracted to edge habitats in some areas, edge habitats of small forest blocks probably do not support viable populations. It is advisable that pine forest preserves be subjected to as little internal fragmentation as possible; edges may cause increases in nest predation and parasitism.

Management Requirements: In southern forests, controlled burning that creates habitat for red-cockaded woodpecker, Bachman's sparrow, and brown-headed nuthatch also provides habitat for warblers. Wilson et al. (1995) documented higher densities of the species on stands subjected to wildlife stand improvement in Arkansas (includes prescribed fire, thinning of midstory and codominant trees). In pine forests where fire suppression is practiced, expanding hardwood midstory should decrease warbler abundance, and may, in some areas, exclude the species. Manual hardwood midstory cutting (without burning) would also likely create adequate habitat for the species.

Management Research Needs: 1) Pine warblers occupy a wide variety of pine forest types throughout their range. Those forests vary somewhat in vegetative composition and the dominant pine species present. While habitat-relationships have been studied in some areas of the range, a range-wide survey of habitats and habitat preferences would be useful from a management perspective.

2) Surprisingly little is known about basic natural history. Information on nesting biology (including nest-site selection) and territory/home range size would be particularly useful.

Biological Research Needs: 1) During winter in pine forests of the southeastern U.S., when many warblers are found in mixed-species flocks, a significant number of individuals, primarily males, are regularly observed outside flocks. Are these birds nonmigratory residents maintaining winter territories? Interestingly, both solitary males and males in flocks sing during winter. Studies with color-banded populations could yield interesting information on flocking behavior and possible winter territoriality.

2) Seed-eating by this species is of much interest. The pine warbler is apparently the only warbler that consumes seeds (primarily pine seeds) in any significant amount. However, few data exist on how regular this behavior may be or on the importance of seeds in the fall/winter diet. In addition, little is known about how this primarily insectivorous bird may make the seasonal physiological changes required to allow for the digestion of seeds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: Probably there are at least several protected occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative economic impacts from pine warblers.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known economic uses for pine warblers however there may be a small amount of ecotourism from birders. Pine warblers may also benefit people by consuming insects which are pests to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: BBS data indicate that populations were increasing during the years of 1966-1991 (Peterjohn and Sauer 1993). Thus, this is not currently a species of high management concern in much of its range. However, in areas where native pine forests have been severely reduced in extent or marginalized for breeding by fragmentation, habitat management for this species may be necessary to maintain viable populations. Breeding habitat can be managed through controlled burning and/or forest midstory thinning.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pine Warbler

The Pine Warbler (Setophaga pinus) is a small songbird of the New World warbler family.

Description[edit]

These birds have white bellies, white wing bars, dark legs and thin, relatively long pointed bills; they have yellowish lines over their eyes. Adult males have olive upperparts and bright yellow throats and breasts; females and immatures display upperparts which are olive-brown. Their throats and breasts are paler.

The song of this bird is a musical trill. Their calls are slurred chips.

Distribution and habitat[edit]

Female

Their breeding habitats are open pine woods in eastern North America. These birds are permanent residents in southern Florida. Some of them, however, migrate to northeastern Mexico and islands in the Caribbean. The first record for South America was a vagrant wintering female seen at Vista Nieve, Colombia, on 20 November 2002; this bird was foraging as part of a mixed-species feeding flock that also included wintering Blackburnian and Tennessee Warblers.[2]

Behavior[edit]

They forage slowly on tree trunks and branches by poking their bill into pine cones. These birds also find food by searching for it on the ground. These birds mainly eat insects, seeds and berries.

Their nests are deep, open cups, which are placed near the end of a tree branch. Pine Warblers prefer to nest in pine trees, hence their names.

References[edit]

  1. ^ BirdLife International (2012). "Dendroica pinus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Strewe, Ralf & Navarro, Cristobal (2004): New and noteworthy records of birds from the Sierra Nevada de Santa Marta region, north-eastern Colombia. Bull. B.O.C. 124(1): 38-51. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Phylogenetic analyses of sequences of mitochondrial and nuclear DNA (Lovette et al. 2010) indicate that all species formerly placed in Dendroica, one species formerly placed in Wilsonia (citrina), and two species formerly placed in Parula (americana and pitiayumi) form a clade with the single species traditionally placed in Setophaga (ruticilla). The generic name Setophaga has priority for this clade (AOU 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!