Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

The Yellow Warbler (Dendroica petechia) breeds from the Arctic Circle across most of Canada and south to Mexico, with closely related species occurring along Neotropical coastlines. The winter range extends from the extreme southern United States and the Bahamas south through Middle America and the southern Lesser Antilles and on through South America (mainly east of the Andes) to Peru and Amazonian Brazil. Resident year-round populations are present from southern Florida and the Bahamas south throughout the West Indies to the northern coast of Venezuela and from Mexico south through Middle America to Panama, as well as along the west coast of South America, from northwestern Colombia south to central Peru and the Galapagos Islands and east along the northern coast of Colombia to northwestern Venezuela. Infraspecific groups within this species have been recognized as Yellow Warbler, Golden Warbler, and Mangrove Warbler (the latter resident in mangroves from Mexico south; adult males generally have chestnut heads).

Yellow Warblers breed in a range of habitats in eastern North America, including thickets, swamp edges, streamsides, second growth woods, orchards, and gardens. In the West, they are largely restricted to streamside thickets. On their tropical wintering grounds, Yellow Warblers are found in semi-open country, woodland edges, and towns.

Yellow Warblers feed mainly on insects; up to two thirds of the diet may consist of caterpillars. They forage alone on their wintering grounds and defend a winter feeding territory.

Males defend nesting territories by singing and sometimes perform fluttering flight displays. The male courts the female by actively pursuing her for 1 to 4 days. The nest, which is built largely by the female, is placed in an upright fork of a shrub, small tree, or thicket from 1 to 18 m above the ground. Females may steal nest material from other nests. Females lay 4 to 5 (sometimes 3 or 6) eggs that are greenish white with a variety of specks or spots of brown, olive, and gray. Eggs are incubated by the female for 11 to 12 days. The male feeds the female on the nest. Young are fed by both parents, but especially the female. They leave the nest 9 to 12 days after hatching.

Yellow Warbler nests are often parasitized by Brown-headed Cowbirds, which lay their eggs in the warbler's nest. In some areas. Yellow Warblers may recognize the problem, build a new floor over the eggs, and lay a new clutch of their own (or, alternatively, simply abandon the nest). In one reported case, cowbirds laid eggs on 5 visits, but the warblers built a new floor after each visit.

Migration is mostly by night. Fall migration begins quite early, with many Yellow Warblers moving south during August.

(Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Dunn, J.L. and J. Alderfer. 2011. National Geographic Field Guide to the Birds of North America. National Geographic Society, Washington, D.C.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Yellow warblers spend the majority of the year throughout much of North America, including Alaska, northern Canada, and the northern 2/3 of the United States. Highly migratory birds, yellow warblers spend the winter in southern California, southern Florida, and as far south as Peru (Ehrlich 1992).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Ehrlich, P., D. Dobkin, D. Wheye. 1992. Birds in Jeopardy: The Imperiled and Extinct Birds of the United States and Canada Including Hawaii and Puerto Rico. Stanford, California: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Yellow warblers spend the majority of the year throughout much of North America, including Alaska, northern Canada, and the northern 2/3 of the United States. A highly migratory bird, Dendroica petechia winters in southern California, southern Florida, and south through the Brazilian Amazon, Bolivia, and Peru (Ehrlich 1992).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Ehrlich, P., D. Dobkin, D. Wheye. 1992. Birds in Jeopardy: The Imperiled and Extinct Birds of the United States and Canada Including Hawaii and Puerto Rico. Stanford, California: Stanford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Breeding range extends from northern Alaska across northern Canada to Labrador, and south to Panama and through the West Indies to the northern coast of South America. Range during the northern winter extends from southern California, southern Arizona, northern Mexico, and southern Florida south to central Peru, northern Bolivia, and Amazonian Brazil. Resident populations exist in the West Indies (Pashley 1988, Pashley 1988, Pashley and Hamilton 1990) and Middle America, along the Gulf-Caribbean coast to Venezuela, and on the Pacific coast of South America south to northwestern Peru.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Yellow warblers are easily recognized. They are the most extensively yellow of warblers, with golden yellow plumage and rusty streaks on the breast. Yellow warbler males and females are similar with golden yellow upper parts tinged with olive, yellow under parts, and thin pointed beaks. Males are generally brighter, especially during the breeding season. Yellow warblers reach an average size of 10 to 18 cm in length (Perrins and Middleton 1985; The Otter Side 2000).

Range mass: 7 to 25 g.

Range length: 10 to 18 cm.

Average wingspan: 20 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male more colorful

  • Perrins, C., L. Middleton, ed.. 1985. The Encyclopedia of Birds. London, Sydney: George Allen & Unwin.
  • The Otter Side, 2000. "Yellow Warbler (Dendroica petechia)" (On-line). Accessed October 24, 2000 at http://www.otterside.com/htmfiles/wrbye-h.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Yellow warblers are easily recognized. They are the most extensively yellow of warblers, with golden yellow plumage and rusty streaks on the breast. Yellow warbler males and females are similar with golden yellow upper parts tinged with olive, yellow under parts, and thin pointed beaks. Males are generally brighter, especially during the breeding season. Yellow warblers reach an average size of 10 to 18 cm in length (Perrins and Middleton 1985; The Otter Side 2000).

Range mass: 7 to 25 g.

Range length: 10 to 18 cm.

Average wingspan: 20 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male more colorful

  • Perrins, C., L. Middleton, ed.. 1985. The Encyclopedia of Birds. London, Sydney: George Allen & Unwin.
  • The Otter Side, 2000. "Yellow Warbler (Dendroica petechia)" (On-line). Accessed October 24, 2000 at http://www.otterside.com/htmfiles/wrbye-h.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 13 cm

Weight: 10 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Yellow warblers prefer moist habitats because they offer a large variety of insects. These habitats include the edges of marshes and swamps, willow-lined streams, and leafy bogs. Yellow warblers also inhabit dry areas such as thickets, orchards, farmlands, forest edges, and suburban yards and gardens. They prefer areas of scattered trees, dense shrubbery and any other moist, shady areas.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; rainforest

Wetlands: marsh ; swamp

Other Habitat Features: suburban ; agricultural ; riparian

  • Nuttall, T., M. Chamberlin, ed.. 1903. A Popular Handbook of Birds of the United States and Canada. Boston: Little, Brown, and Company.
  • Celada, C., P. Lowther, N. Klein, C. Rimmer, D. Spector. 1999. Yellow Warber (Dedroica Petechia). The Birds of North America, No. 454.
  • U.S. Department of the Interior, U.S. Geological Survey, 2000. "Yellow Warbler Dendroica Petechia" (On-line). Accessed October 25, 2000 at http://www.mbr.nbs.gov/id/framlst/i6520id.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dendroica petechia prefers moist habitats with high insect abundance. The presence of willows is one common feature of yellow warbler habitat north of Mexico. South of Mexico mangroves are a dominant feature. Habitats include the edges of marshes and swamps, willow-lined streams, and leafy bogs. Dendroica petechia also inhabits dry areas such as thickets, orchards, farmlands, forest edges, and suburban yards and gardens. They seem to prefer areas of scattered trees, dense shrubbery, and any other moist, shady areas (Nuttall and Chamberlin, 1971; USGS, 2000).

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; rainforest

Wetlands: marsh ; swamp

Other Habitat Features: suburban ; agricultural ; riparian

  • Nuttall, T., M. Chamberlin, ed.. 1903. A Popular Handbook of Birds of the United States and Canada. Boston: Little, Brown, and Company.
  • Celada, C., P. Lowther, N. Klein, C. Rimmer, D. Spector. 1999. Yellow Warber (Dedroica Petechia). The Birds of North America, No. 454.
  • U.S. Department of the Interior, U.S. Geological Survey, 2000. "Yellow Warbler Dendroica Petechia" (On-line). Accessed October 25, 2000 at http://www.mbr.nbs.gov/id/framlst/i6520id.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 13.353 - 13.353
  Nitrate (umol/L): 3.951 - 3.951
  Salinity (PPS): 33.310 - 33.310
  Oxygen (ml/l): 6.095 - 6.095
  Phosphate (umol/l): 0.674 - 0.674
  Silicate (umol/l): 5.723 - 5.723
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Habitat includes open scrub, second-growth woodland, thickets, farmlands, and gardens, especially near water; riparian woodlands, especially of willows, are typical habitat in the West. In migration and winter, yellow warblers often occur in open woodland, plantations, brushy areas, and forest edge. Winter habitat in Mexico generally has a clear open understory (Greenberg and Salgado Ortiz 1994). Southern populations occupy mangroves, scrub, and thickets. Nests are placed in upright forks or crotches of bushes (e.g., willow), saplings, or large trees, from less than a meter above ground to high in tall trees.

See Knopf and Sedgwick (1992) for information on nest-site selection in north-central Colorado, where sites were chosen based primarily on characteristics of the vegetation patch rather than on characteristics of the nest plant itself.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrants arrive in breeding areas in northern contiguous United States mainly in Arpil-May, primarily in May in interior Alaska. Southward migration from northern nesting areas begins as early as July (or August in the far north), and southward migration throughout the contiguous United States continues through September-October and rarely into November in some areas.

In Costa Rica, abundant fall migrant September-October, with small numbers arriving by mid-August; migrants depart by early to mid-May (Stiles and Skutch 1989). Migrants are present in South America mainly September-April (Ridgely and Tudor 1989). Nonmigratory populations occur in the West Indies, Middle America, and northern coastal South America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Yellow warblers mostly eat insects but will occasionally also eat some berries. They forage for insects and spiders on the limbs of trees and bushes. Small insect larvae and caterpillars are preferred foods.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Dendroica petechia is first and foremost an insect feeder but occasionally supplements the diet with some berries. By gleaning and hawking D. petechia forages for insects and spiders on the limbs of trees and bushes. Small insect larvae and caterpillars are preferred foods. (Ehrlich 1992; Nuttall 1903; USGS 2000)

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: fruit

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats insects (especially caterpillars) and spiders. Takes most food items from leaves or bark; sometimes flycatches; occasionally eats small fruits or probes in flowers (Lack 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Molothrus ater and Molothrus bonariensis will lay their eggs in yellow warblers' nests. As a result the nest may be abandonned or covered over with a new lining, which can involve the loss of warbler eggs. Sometimes, however, warbler young do survive along with the cowbird young.

Yellow warblers are important predators of insects, especially potential pest species, in the ecosystems in which they live. They may help to disperse fruit seeds when they eat fruit.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There is little information on the response of yellow warblers to predators. They have twice been observed to join other bird species in mobbing (attacking, as a group) great horned owls. Females will respond to snakes with distraction displays or give agitated vocalizations.

Yellow warblers are preyed on by a wide variety of small predators, which primarily prey on eggs and young in the nest. Adults and fledged juveniles may be taken by small birds of prey, such as Falco sparverius and Accipiter cooperi.

Known Predators:

  • red squirrels (Tamiasciurus_hudsonicus)
  • long-tailed weasels (Mustela_frenata)
  • raccoons (Procyon_lotor)
  • red foxes (Vulpes_vulpes)
  • American crows (Corvus_brachyrhynchos)
  • common garter snakes (Thamnophis_sirtalis)
  • blue jays (Cyanocitta_cristata)
  • blue racers (Coluber_constrictor)
  • striped skunks (Mephitis_mephitis)
  • domestic cats (Felis_silvestris)
  • American kestrels (Falco_sparverius)
  • Cooper's hawks (Accipiter_cooperii)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Brown-headed Cowbirds and Shiny Cowbirds will lay their eggs in yellow warblers' nests. As a result the nest may be abandonned or covered over with a new lining, which can involve the loss of warbler eggs. Sometimes, however, warbler young do survive along with the cowbird young.

Yellow warblers are important predators of insects, especially potential pest species, in the ecosystems in which they live. They may help to disperse fruit seeds when they eat fruit.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There is little information on the response of yellow warblers to predators. They have twice been observed to join other bird species in mobbing (attacking, as a group) great horned owls. Females will respond to snakes with distraction displays or give agitated vocalizations.

Yellow warblers are preyed on by a wide variety of small predators, which primarily prey on eggs and young in the nest. Adults and fledged juveniles may be taken by small birds of prey, such as American kestrels and Cooper's hawks.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Dendroica petechia preys on:
Araneae
Disyonicha quinquevitata
Insecta
Collembola
Orthoptera
Hemiptera
Auchenorrhyncha
Sternorrhyncha
Coleoptera
Formicidae
Hymenoptera
Lepidoptera
Diptera
fruit and seeds
non-insect arthropods
Arthropoda

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 393 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Breeding territories are as small as 0.16 ha (Harrison 1979).

See Weatherhead 1989 for relations among yellow warbler, red-winged blackbird, and brown-headed cowbird in Manitoba (yellow warbler heavily impacted by cowbird parasitism; cowbirds abundant due to success of cowbirds in blackbird nests).

Migrants are solitary and territorial in winter (Stiles and Skutch 1989, Greenberg and Salgado Ortiz 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Yellow warbler calls include notes given by young begging for food, by birds responding to the presence of predators, and in diverse social situations. A "hiss" call has been described as being used in territorial defense. There are several calls used in the context of nest defense. These include a "Seet" call that may be somewhat specialized for use in response to threats from cowbids attempting to lay their eggs in the warbler's nest. Singing behavior is used for male-female communication, both for mate attraction and for interactions between mates. Songs are sung primarily by males. Females often give simple, high frequency "chip" calls at the end of a male song.  No nonvocal sounds are thought to be used in communication.

Yellow warblers also communicate with postures and perhaps with touch. Yellow warblers perceive their environment with their keen vision, hearing, touch, and limited chemical sensation.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Yellow warbler calls include notes given by young begging for food, by birds responding to the presence of predators, and in diverse social encounters. A "hiss" call has been described as being used in territorial defense. There are several calls used in the context of nest defense, including a "Seet" call that may be somewhat specialized for use in response to threats from parastic cowbids.  Singing behavior is used for male-female communication, both for mate attraction and for interactions between mates. Songs are sung primarily by males. Females often give simple, high frequency "chip" calls at the end of a male song.  No nonvocal sounds are thought to be used in communication.

Yellow warblers also communicate with postures and perhaps with touch. Yellow warblers perceive their environment with their keen vision, hearing, touch, and limited chemical sensation.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is little information on causes of mortality. The longest known lifespan of a yellow warbler in the wild is 9 years, 11 months.

Range lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: wild:
131 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

There is little information on causes of mortality. The longest known lifespan of a yellow warbler in the wild is 9 years, 11 months.

Range lifespan

Status: wild:
10 (high) years.

Average lifespan

Status: wild:
131 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

From their wintering grounds, yellow warblers arrive in the northern areas with little time between migrations for the reproduction process, which at a minimum takes 45 days. The process begins with a fairly elaborate courtship performed by the male who may sing up to 3,240 songs in a day to attract a mate. Yellow warblers are primarily monogamous, but there are occasional polygynous matings. Although yellow warblers are generally single-brooded, if their first nesting attempt fails they will breed again. (Perrins and Middleton et al. 1985; Rand et al. 1971)

Mating System: monogamous ; polygynous

Yellow warblers usually breed in late May and early June. Females lay 4 to 5 eggs, incubation lasts 10 to 14 days, nestling period lasts from 8 to 12 days, and parental feeding may extend to two weeks after the young leave the nest, sometimes longer. Females and males first attempt to breed in their first year after hatching.

Breeding interval: Normally yellow warblers breed once yearly; second broods are rarely attempted.

Breeding season: Mating occurs from May through June.

Range eggs per season: 1 to 6.

Average eggs per season: 4.5.

Range time to hatching: 10 to 14 days.

Range fledging age: 8 to 12 days.

Range time to independence: 22 to 26 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal )

Average birth mass: 1.32 g.

Average eggs per season: 3.

Both male and female parents participate in feeding the young, usually providing them with different kinds of insect larvae. The responsibility of incubation, construction of the nest, and most feeding of the young lies with the female, while the male contributes more as the young develop. After they mature, some of the fledglings may follow the mother while the rest remain with the father.

Parental Investment: altricial ; male parental care ; female parental care

  • Perrins, C., L. Middleton, ed.. 1985. The Encyclopedia of Birds. London, Sydney: George Allen & Unwin.
  • Rand, A. 1971. Birds of North America. New York: Doubleday & Company, Inc..
  • Celada, C., P. Lowther, N. Klein, C. Rimmer, D. Spector. 1999. Yellow Warber (Dedroica Petechia). The Birds of North America, No. 454.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

From its wintering grounds, D. petechia arrive in the northern areas with little time between migrations for the reproduction process, which at a minimum takes 45 days. The process begins with a fairly elaborate courtship performed by the male who may sing up to 3,240 songs in a day to attract a mate. Yellow warblers are primarily monogamous, but there are occasional polygynous matings. Although yellow warblers are generally single-brooded, if their first nesting attempt fails they will breed again. (Perrins and Middleton et al. 1985; Rand et al. 1971)

Mating System: monogamous ; polygynous

Yellow warblers usually breed in late May and early June. Females lay 4 to 5 eggs, incubation lasts 10 to 14 days, nestling period lasts from 8 to 12 days, and parental feeding may extend to two weeks after the young leave the nest, sometimes longer. Females and males first attempt to breed in their first year after hatching.

Breeding interval: Normally yellow warblers breed once yearly; second broods are rarely attempted.

Breeding season: Mating occurs from May through June.

Range eggs per season: 1 to 6.

Average eggs per season: 4.5.

Range time to hatching: 10 to 14 days.

Range fledging age: 8 to 12 days.

Range time to independence: 22 to 26 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal )

Average birth mass: 1.32 g.

Average eggs per season: 3.

Both male and female parents participate in feeding the young, usually providing them with geometrid, chironomid and other lepidopteran larvae. The responsibility of incubation, construction of the nest, and most feeding of the young lies with the female, while the male contributes more as the young develop. After they mature, some of the fledglings may follow the mother while the rest remain with the father.

Parental Investment: altricial ; male parental care ; female parental care

  • Perrins, C., L. Middleton, ed.. 1985. The Encyclopedia of Birds. London, Sydney: George Allen & Unwin.
  • Rand, A. 1971. Birds of North America. New York: Doubleday & Company, Inc..
  • Celada, C., P. Lowther, N. Klein, C. Rimmer, D. Spector. 1999. Yellow Warber (Dedroica Petechia). The Birds of North America, No. 454.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nesting occurs mainly in May-June but may continue into July or rarely August. Clutch size is 3-6 in most region (usually 4-5, but mean of 2.5 in southern Florida). Incubation, by the female, lasts 11-12 days. Young are tended by both parents, leave nest at 9-12 days. Females generally attempt only one brood per year.

Yellow warblers are commonly subjected to brood parasitism by brown-headed cowbirds. Adult warblers often can be seen feeding much larger cowbird fledglings.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendroica petechia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 31 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAACTAGGCCAACCCGGAGCCCTTCTGGGAGACGACCAAGTCTATAATGTAGTCGTCACGGCCCATGCCTTCGTAATAATTTTCTTTATAGTTATGCCGATTATAATTGGAGGATTCGGAAACTGACTAGTCCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCACCATCGTTCCTTCTCCTTCTAGCGTCCTCCACGGTTGAAGCAGGAGTAGGTACAGGCTGAACAGTGTACCCCCCACTAGCCGGTAACCTGGCCCACGCCGGAGCCTCAGTCGACCTCGCAATCTTCTCTCTACACCTAGCCGGTATTTCCTCAATCCTCGGAGCAATCAACTTCATTACAACAGCAATTAACATGAAACCTCCTGCCCTCTCACAATACCAAACCCCACTATTCGTCTGATCAGTCCTTATCACTGCAGTTCTACTACTCCTTTCTCTTCCAGTTCTAGCTGCAGGGATCACAATGCTCCTTACAGATCGCAACCTCAATACCACATTCTTCGACCCCGCCGGAGGAGGAGATCCCGTCCTATACCAACATCTTTTCTGATTCTTCGGTCACCCAGAAGTCTACATCCTAATTCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dendroica petechia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 31
Specimens with Barcodes: 59
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Dendroica_petechia is common, but due to loss of riparian woodland habitat and extensive paratism by cowbirds there has been a decline in yellow warbler populations. An increase in population occurs in areas where grazing and herbicide are restricted, permitting regrowth of riparian vegetation. One subspecies, the Barbados Yellow Warbler, D._petechia_petechia, is on the U.S. endangered species list (Ehrlich et al. 1992; IUCN 2000; CITES 2000; USFW 2001).

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: endangered; no special status

CITES: appendix iii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dendroica petechia is common, but due to loss of riparian woodland habitat and extensive paratism by cowbirds there has been a decline in yellow warbler populations. An increase in population occurs in areas where grazing and herbicide are restricted, permitting regrowth of riparian vegetation. One subspecies, the Barbados Yellow Warbler, D. petechia petechia, is on the U.S. endangered species list (Ehrlich et al. 1992; IUCN 2000; CITES 2000; USFW 2001).

US Migratory Bird Act: protected

US Federal List: endangered; no special status

CITES: appendix iii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Jeopardized in some areas by loss of riparian habitat in combination with heavy brood parasitism by cowbirds (Ehrlich et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known negative effects of yellow warblers on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Primarily an insectivore, yellow warblers forage for food in suburban areas, ridding farms and gardens of unwanted insect pests. Additionally, yellow warblers are popular with birders, they have lovely golden yellow plumage and musical song.

Positive Impacts: ecotourism ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known negative effects of yellow warblers on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Primarily an insectivore, D. petechia forages for food in suburban areas, ridding farms and gardens of unwanted insect pests. Additionally, yellow warblers are popular with birders, they have lovely golden yellow plumage and musical songs (Ehrlich et.al., 1992).

Positive Impacts: ecotourism ; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American Yellow Warbler

Yellow Warbler redirects here. For the yellow warbler genus in the Acrocephalidae, see Chloropeta. "Yellowbird" redirects here. For other uses, see Yellow Bird.

The American Yellow Warbler (Setophaga petechia, formerly Dendroica petechia) is a New World warbler species. Sensu lato, they make up the most widespread species in the diverse Setophaga genus, breeding in almost the whole of North America and down to northern South America.

Contents

Description and taxonomy

Resident adult male mangrove warbler in mangroves near Quepos, Costa Rica
Breeding male Golden Warbler, Washington-Slagbaai National Park, Bonaire (Netherlands Antilles)
Breeding male aureola Mangrove Warbler at Puerto Ayora, Santa Cruz (Galápagos Islands)
Breeding female Yellow Warbler, Horicon Marsh, Wisconsin (USA)
Yellow warbler in Ontario, Canada

Other than in male breeding plumage and body size, all subspecies are very similar. Winter, female and immature birds all have similarly greenish-yellow uppersides and are a duller yellow below. Young males soon acquire breast and, where appropriate, head coloration. Females are somewhat duller, most notably on the head. In all, the remiges and rectrices are blackish olive with yellow edges, sometimes appearing as an indistinct wing-band on the former. The eyes and the short thin beak are dark, while the feet are lighter or darker olive-buff.[2][3]

The 35 subspecies of D. petechia sensu lato can be divided into three main groups according to the males' head color in the breeding season.[3] Each of these groups is sometimes considered a separate species, or the aestiva group (Yellow Warbler) is considered a species different from D. petechia (Mangrove Warbler, including Golden Warbler); the latter option is the one currently accepted by the International Ornithological Congress World Bird List.[4]

Depending on subspecies, the American Yellow Warbler may be between 10–18 cm (3.9–7.1 in) long, with a wingspan from 16 to 22 cm (6.3 to 8.7 in). They weigh 7–25 g (0.25–0.88 oz), varying between subspecies and whether on migration or not, globally averaging about 16 g (0.56 oz) but only 9–10 g (0.32–0.35 oz) in most breeding adults of the United States populations. Among standard measurements throughout the subspecies, the wing chord is 5.5 to 7 cm (2.2 to 2.8 in), the tail is 3.9 to 5.6 cm (1.5 to 2.2 in), the bill is 0.8 to 1.3 cm (0.31 to 0.51 in) and the tarsus is 1.7 to 2.2 cm (0.67 to 0.87 in).[3] The summer males of this species are generally the yellowest "warblers" wherever they occur. They are brilliant yellow below and golden-green above. There are usually a few wide washed-out rusty-red streaks on the breast and flanks. The various subspecies in this group mostly in brightness and size as per Bergmann's and Gloger's Rule.[5]

The Golden Warbler (petechia group; 17 subspecies[3]) is generally resident in the mangrove swamps of the West Indies. Local seasonal migrations may occur. On the Cayman Islands for example, D. p. eoa was found to be "decidedly scarce" on Grand Cayman and apparently absent from Cayman Brac in November 1979, while it had been a "very common" breeder in the group some 10 years before, and not frequently seen in the winters of 1972/1973; apparently, the birds disperse elsewhere outside the breeding season. The Cuban Golden Warbler (D. p. gundlachi) barely reaches the Florida Keys where it was first noted in 1941, and by the mid-20th century a breeding population was resident.[6] Though individual birds may stray farther north, their distribution is restricted by the absence of mangrove habitat.

They are generally smallish, usually weighing about 10 g (0.35 oz) or less and sometimes[7] as little as 6.5 g (0.23 oz). The summer males differs from those of the Yellow Warbler in that they have a rufous crown, hood or mask. The races in this group vary in the extent and hue of the head patch.

The Mangrove Warbler (erithachorides group; 12 subspecies[3]) tends to be larger than other Yellow Warbler subspecies groups, averaging 12.5 cm (4.9 in) in length and 11 g (0.39 oz) in weight. It is resident in the mangrove swamps of coastal Middle America and northern South America; D. p. aureola is found on the oceanic Galápagos Islands.[3] The summer males differ from those of the Yellow Warbler in that they have a rufous hood or crown. The races in this group vary in the extent and hue of the hood, overlapping extensively with the Golden Warbler group in this character.[3]

The American Yellow Warbler (aestiva group; 6 subspecies[3] breeds in the whole of temperate North America as far south as central Mexico in open, often wet, woods or shrub. It is migratory, wintering in Central and South America. They are very rare vagrants to western Europe.[2]

Vocalizations

The song is a musical strophe that can be rendered sweet sweet sweet, I'm so sweet, although it varies considerably between populations. The call is a soft or harder chip or ship. This is particularly frequently given by females after a male has finished his song. In territorial defence, they give hissing calls, while seet seems to be a kind of specialized cowbird alert (see below). Other calls are given in communication between pair-members, neighbors, or by young begging for food. These birds also communicate with postures and perhaps with touch.[2]

Ecology

Female Yellow Warbler attending nestlings, Yukon Flats National Wildlife Refuge, Alaska (USA)
Male (above) and female Yellow Warblers foraging in a reedbed, Mill Creek Streamway Park, Kansas (USA)

American Yellow Warblers breed in most of North America from the tundra southwards, but they do not range far southwestwards and avoid the Gulf of Mexico coasts also.[2] The Mangrove and Golden Warblers occur to the south of it, to the northern reaches of the Andes. American Yellow Warblers winter to the south of their breeding range, from southern California to the Amazon region, Bolivia and Peru.[2]

American Yellow Warblers arrive in their breeding range in late spring – generally about April/May – and move to winter quarters again starting as early as July, as soon as the young are fledged. Most, however, stay a bit longer; by the end of August, the bulk of the northern populations has moved south, though some may linger almost until fall. At least in northern Ohio, Yellow Warblers do not seem to remain on their breeding grounds longer than they did 100 years ago.[8]

The breeding habitat of American Yellow Warblers is typically riparian or otherwise moist land with ample growth of small trees, in particular willows (Salix). The other groups, as well as wintering birds, chiefly inhabit mangrove swamps and similar dense woody growth. Less preferred habitat are shrubland, farmlands and forest edges. In particular American Yellow Warblers will come to suburban or less densely settled areas, orchards and parks, and may well breed there. Outside the breeding season, these warblers are usually encountered in small groups, but while breeding they are fiercely territorial and will try to chase away any conspecific intruder that comes along.[2]

These birds feed mainly on arthropods, in particular insects. They acquire prey by gleaning in shrubs and on tree branches, and by hawking prey that tries to fly away. Other invertebrates and some berries and similar small juicy fruits[9] are also eaten, the latter especially by American Yellow Warblers in their winter quarters. Caterpillars are the staple food for nestlings, with some – e.g. those of geometer moths (Geometridae) – preferred over others.[10]

The predators of Yellow and Mangrove Warblers are those typical of such smallish tree-nesting passerines. The odds of an adult American Yellow Warbler to survive from one year to the next are on average 50%; in the southern populations, by contrast, about two-thirds of the adults survive each year. Conversely, less than one American Yellow Warbler nest in three on average suffers from predation in one way or another, while two out of three Mangrove and Golden Warbler nests are affected.[11]

Snakes,[12] corvids[13] and large climbing rodents[14] are significant nest predators. Carnivores, in particular Musteloidea[15] as well as the Red Fox (Vulpes vulpes) and domestic or feral cats, prey on nestlings and fledglings as well as sick or distracted adults. These predators pose little threat to the nimble, non-nesting adults, but certain smallish and agile birds of prey do, especially the American Kestrel (Falco sparverius) and Cooper's Hawk (Accipiter cooperii), and[citation needed] the Sharp-shinned Hawk (A. striatus) and screech owls (Megascops).[2]

These New World warblers seem to mob predators only rarely. An exception are cowbirds, which are significant brood parasites. The Yellow Warbler is a regular host of the Brown-headed Cowbird (Molothrus ater), with about 40% of all nests suffering attempted or successful parasitism. By contrast, the tropical populations are host to the Shiny Cowbird (M. bonariensis), but less than one nest in 10 is affected. Upon recognizing a cowbird egg in its nest, the warbler will often smother it with a new layer of nesting material. It will usually not try to save any own eggs that have already been laid, but produce a replacement clutch. Sometimes, the parents desert a parasitized nest altogether and build a new one. Unlike some cuckoos, cowbird nestlings will not actively kill the nestlings of the host bird; mixed broods of Dendroica and Molothrus may fledge successfully.[11]

Other than due to predation, mortality reasons are not well known. The maximum recorded ages[16] of wild Yellow Warblers are around 10 years. A wintering American Yellow Warbler examined near Turbo, Colombia was not infected with blood parasites, unlike other species in the study. It is unclear whether this significant, but wintering birds in that region generally lacked such parasites.[17]

Breeding

Yellow Warbler nest with small clutch

As usual for New World warblers (Parulidae), they nest in trees, building a small but very sturdy cup nest. Females and males share the reproductive work about equally, but emphasize different tasks: females are more involved with building and maintaining the nest, and incubating and brooding the offspring. Most of the actual feeding is also done by them. Males are more involved in guarding the nest site and procuring food, bringing it to the nest and passing it to the waiting mother. As the young approach fledging, the male's workload becomes proportionally higher.[2]

The American Yellow and Mangrove (including Golden) Warblers differ in some other reproductive parameters. While the former is somewhat more of an r-strategist, the actual differences are complex and adapted to different environmental conditions. The Yellow Warbler starts breeding in May/June, while the Mangrove Warbler can be found breeding all year round. American Yellow Warblers have been known to raise a brood of young in as little as 45 days, but usually take about 75 days. The tropical populations, by contrast, need more than 100 days per breeding. Males court the females with songs; an American Yellow Warbler has been observed to sing more than 3,200 songs in one day. They are, like most songbirds, generally serially monogamous; some 10% of Mangrove Warbler and about half as many American Yellow Warbler males are bigamous. Very few if any American Yellow Warblers breed more than once per year; around one in twenty Mangrove Warbler females will do so however. If a breeding attempt fails, either will usually try and raise a second brood successfully though.[11]

The clutch of the American Yellow Warbler is 3–6 (typically 4–5, rarely 1–2) eggs. Incubation to hatching usually takes 11 days, but may take up to two weeks. The nestlings weigh 1.3 g (0.046 oz) on average, and are brooded for an average 8–9 days after hatching, and leave the nest the following day or the one thereafter. Mangrove Warblers, on the other hand, have only 3 eggs per clutch on average and incubate some 2 days longer. Its average post-hatching brooding time is 11 days. Almost half of the parents (somewhat more in the Mangrove Warbler, somewhat less in the American Yellow Warbler) attend the fledglings for some time after these leave the nest. This post-fledging care can extend for two additional weeks or more, and sometimes the pairs separate early, each accompanied by one to three of the young.[18]

Some 3–4 weeks after hatching, the young are fully independent of their parents. They become sexually mature at one year of age, and attempt to breed right away. Only about one in four Mangrove Warbler nests successfully fledge any offspring, due to accidents and predation frequently causing total loss of the clutch. By contrast, 55% of all American Yellow Warbler nestings are successful in raising at least one young.[18]

Status and conservation

To humans, these birds are quite beneficial. For one thing, in particular the young devour many pest insects during the breeding season. For another, the plumage and song of the breeding males have been described[2] as "lovely" and "musical", and they can help to generate revenue from ecotourism. Adult American Yellow Warblers are significant dispersers of plants via the ingested seeds, though this may of course spread any invasive weed whose fruits they find tasty. No significant negative effects of American Yellow and Mangrove Warblers on humans have been recorded though.[2]

These birds are generally common and occur over a wide range; consequently, the IUCN[19] does not consider them a threatened species. A local decline in numbers has been noted here and there. This is generally due to habitat destruction and pollution, mainly by land clearance and herbicide and pesticide overuse of agriculture, and sometimes overgrazing. However, especially American Yellow Warblers are prolific, and the stocks will usually rebound quickly if riparian habitat is allowed to recover.[2][1]

The North American populations are legally protected by the Migratory Bird Treaty Act. The Barbados Golden Warbler[20] (D. p. petechia) is listed as "Endangered Foreign Wildlife" by the United States' Endangered Species Act (ESA) since 1970; other than for scientific, educational or conservation purposes (for which a permit may be available) importing it into the USA is illegal. The Californian Yellow Warbler (D. p./a. brewsteri) and Sonoran Yellow Warbler (D.p./a. sonorana) are listed as "Species of Concern" by the ESA.[21]

The American Yellow Warbler is sometimes colloquially called the "Summer Yellowbird".[22]

Footnotes

  1. ^ a b BirdLife International (2012). Dendroica petechia. In: IUCN 2012. IUCN Red List of Threatened Species. Version 2012.2.
  2. ^ a b c d e f g h i j k Bachynski & Kadlec (2003)
  3. ^ a b c d e f g h Curson et al. (1994)
  4. ^ IOC World Bird List Family Parulidae
  5. ^ Bachynski & Kadlec (2003), AnAge (2009)
  6. ^ Cunningham (1966)
  7. ^ Olson et al. (1981)
  8. ^ Henninger (1906), Bachynski & Kadlec (2003), OOS (2004)
  9. ^ E.g. of Trophis racemosa (Moraceae): Foster (2007)
  10. ^ Bachynski & Kadlec (2003), Foster (2007)
  11. ^ a b c Bachynski & Kadlec (2003), Salgado-Ortiz et al. (2008)
  12. ^ E.g. Blue Racer (Coluber constrictor foxii), Common Garter Snake (Thamnophis sirtalis): Bachynski & Kadlec (2003)
  13. ^ E.g. American Crow (Corvus brachyrhynchos), Blue Jay (Cyanocitta cristata): Bachynski & Kadlec (2003)
  14. ^ E.g. American Red Squirrel (Tamiasciurus hudsonicus): Bachynski & Kadlec (2003)
  15. ^ E.g. Striped Skunk (Mephitis mephitis), Long-tailed Weasel (Mustela frenata) or Common Raccoon (Procyon lotor): Bachynski & Kadlec (2003)
  16. ^ "Average lifespan (wild) 131 months" in Bachynski & Kadlec (2003) is a lapsus
  17. ^ Bachynski & Kadlec (2003), Londono et al. (2007), AnAge [2009]
  18. ^ a b Bachynski & Kadlec (2003), Salgado-Ortiz et al. (2008), AnAge [2009]
  19. ^ CITES and State of Michigan List listing are lapsus in Bachynski & Kadlec (2003)
  20. ^ As "Barbados Yellow Warbler", but being the nominate subspecies it belongs to the Golden/Mangrove Warbler group
  21. ^ Bachynski & Kadlec (2003), USFWS (1970, 2009abc)
  22. ^ Grant, John Beveridge (1891). Our Common Birds and How to Know Them. New York: Charles Scribner's Sons. p. 112. Retrieved 23 November 2011. 

References

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Comprises three groups that formerly were regarded as separate species: D. AESTIVA (Yellow Warbler, of Canada and U.S.), D. PETECHIA (Golden Warbler, of southern Florida and West Indies), and D. ERITHACHORIDES (Mangrove Warbler, of both coasts of Middle America and northern South America) (AOU 1983, 1998). Browning (1994) examined geographic variation in plumage color and pattern and recognized 43 subspecies, some of which he described as new. Undoubtedly, some would question whether all of these represent units worthy of taxonomic recognition. Klein and Brown (1994) examined mtDNA variation in populations from North America, Central America, South America, and the West Indies. Only one of 37 identified haplotypes was found in more than one of these regions. The mtDNAs from North American migratory populations clearly were differentiated from those of most tropical sedentary populations. Apparently multiple colonizations of the West Indies archipelago and of individual Caribbean islands have occurred.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!