Articles on this page are available in 1 other language: Chinese (Simplified) (11) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Uragus sibiricus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTNTATTTAATCTTCGGCGCATGAGCTGGGATAGTAGGTACCGCCCTAAGCCTCCTAATTCGAGCAGAACTAGGCCAACCCGGAGCACTCCTGGGAGACGACCAAGTCTACAACGTAATCGTCACGGCACATGCCTTTGTCATAATTTTCTTCATAGTTATACCCATTATAATTGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTTCCTCCATCCTTCCTCCTGCTACTAGCCTCCTCCACAGTCGAAGCAGGGGTAGGCACAGGCTGAACAGTGTACCCACCACTAGCTGGTAACCTAGCCCATGCCGGAGCATCAGTCGACCTTGCAATCTTCTCCCTACACCTGGCCGGTATTTCCTCAATCCTTGGTGCAATCAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCTTATCACAATATCAAACCCCCCTATTCGTCTGATCAGTTTTAATCACCGCAGTACTCCTTCTTCTTTCCCTCCCAGTCCTAGCCGCAGGGATCACAATACTTCTAACAGACCGCAACCTCAACACTACATTCTTCGACCCTGCAGGAGGAGGAGACCCAGTCCTGTACCAACACCTATTCTGATTCTTTGGTCACCCAGAAGTATACATCCTGATTCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Uragus sibiricus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as common, although rare or scarce in some places (Clement 1999), while national population estimates include: c.100-100,000 breeding pairs in China; possibly c.100-10,000 breeding pairs, c.50-1,000 individuals on migration and c.50-1,000 wintering individuals in Korea; c.100-100,000 breeding pairs, c.50-10,000 individuals on migration and c.50-1,000 wintering individuals in Japan and c.100-100,000 breeding pairs and c.50-10,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Long-tailed rosefinch

The long-tailed rosefinch (Uragus sibiricus) is a species of finch of the Fringillidae family. It is currently monotypic in the genus Uragus.

It is found in China, Japan, Kazakhstan, North Korea, South Korea, and Russia. Its natural habitats are temperate forests, subtropical or tropical moist shrubland, and temperate grassland.

It is a very rare vagrant to Europe, but like several related Asiatic rosefinches is reasonably frequent in the cage-bird trade so many records have been considered to relate to escapes.

Taxonomy[edit]

Uragus sibiricus was separated from any family of birds. However, it was been genetically grouped with Carpodacus rubicilloides.[2][3][4]

female in Japan

References[edit]

  1. ^ BirdLife International (2012). "Uragus sibiricus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Arnaiz-Villena, A; Moscoso J; Ruiz-del-Valle V; González J; Reguera R; Ferri A; Wink M; Serrano-Vale JI (2008). "Mitochondrial DNA Phylogenetic Definition of a Group`of "Arid-Zone" Carduelini Finches". The Open Ornithology Journal 1: 1–7. doi:10.2174/1874453200801010001. 
  3. ^ Arnaiz-Villena, A.; Guillén, J.; Ruiz-del-Valle, V.; Lowy, E.; Zamora, J.; Varela, P.; Stefani, D.; Allende, L. M. (2001). "Phylogeography of crossbills, bullfinches, grosbeaks, and rosefinches". Cellular and Molecular Life Sciences 58 (8): 1159–1166. doi:10.1007/PL00000930. PMID 11529508. 
  4. ^ Arnaiz-Villena, A; Gómez-Prieto P; Ruiz-de-Valle V (2009). "Phylogeography of finches and sparrows". Nova Science Publishers. ISBN 978-1-60741-844-3. 


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!