Overview

Brief Summary

Carpodacus purpureus

One of the more striking birds in its range, the male Purple Finch is most readily identified by its purplish-red head, breast, and rump. Other field marks include a large bill, dark legs, and notched tail. The female Purple Finch is much less colorful, with a brown back and a brown-streaked breast. The Purple Finch breeds across southern Canada, the northeastern U.S., and the west coast of North America from British Columbia south to central California. In winter, this species withdraws from northern parts of its range, and may be found widely across the eastern U.S.and in southern California. In areas where Purple Finches occur all year, local breeders are displaced in winter by more northerly-breeding birds. In summer, the Purple Finch breeds primarily in evergreen forests. During the winter, this species may also be found in deciduous and mixed deciduous and evergreen forests as well as in thickets and hedges. Purple Finches primarily eat seeds and other plant matter, but may also eat insects when available. Like many finches, the Purple Finch frequently visits bird feeders. In wilder areas, this species may be observed feeding on seeds or buds on the ends of tree branches. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

Commonly known as purple finches, Carpodacus purpureus inhabits the Nearctic region. Carpodacus purpureus is a migratory species, however its entire range is contained within North America. During the spring and summer months, this species breeds across the southern half of Canada and may be found in every province except Nunavut. In central portions of its range, Carpodacus purpureus both breeds and over-winters. This year-round range includes Nova Scotia, and the east coast and New England regions of the United States (U.S.) from Maine to Pennsylvania, as well as portions of Michigan and Wisconsin. In early fall, Carpodacus purpureus migrates south to spend the winter across the eastern half of the US. Some east coast populations migrate further inland or into Baja California, Mexico.

Biogeographic Regions: nearctic (Native )

  • Sibley, D. 2000. The Sibley Guide to Birds. New York: Alfred A. Knopf, Inc.
  • Wootton, T. 1996. "Purple Finch (Carpodacus purpureus)" (On-line). The Birds of North America Online. Accessed July 13, 2011 at http://bna.birds.cornell.edu/bna/species/208.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Carpodacus purpureus is a medium-sized finch that measures 15.2 cm in length, weighs 25 g, and features a 25.4 cm wingspan. Its bill has many finch characteristics in that it is conical, pointed, and well-adapted for cracking open seeds. Males have extensive "wine" red on their heads, backs, throats, breast, flanks, and rumps. Wing and tail feathers are brown, but may also be tinted red. Bellies and undertail coverts are unmarked white. Females are overall brown, and feature a bold brown and white pattern on their heads. Their crowns are brown and are bordered by thick, white supercillia. A brown patch extends from their eye down to cover their ears. Below this patch, there is a thick, white mustache stripe followed by a dark brown malar stripe. Throats are white, and the breast features short, brown streaks that extend into the belly and flanks. As in the males, females' bellies and undertail coverts are white. Their backs are streaked with two tones of brown. Like many finches, Carpodacus purpureus has a deeply notched tail that is visible in flight.

Juveniles of both sexes are nearly identical to adult females, and males may not develop full adult red plumage until after their first year.

This species is often confused with house finches (Carpodacus mexicanus). Where Carpodacus purpureus males are red nearly all over their bodies, Carpodacus mexicanus has less extensive red coloration that is concentrated on the crown, throat, breast and rump. It is often said that C. purpureus males look as though they have been dunked in raspberry jam. Regardless, there is significant variation in coloration among individuals and this is not always a reliable identification characteristic. The most distinguishing features are the flanks: C. mexicanus has brown-streaked flanks, whereas C. purpureus has reddish flanks. Females are also difficult to distinguish, but there are slight differences in coloration. Female C. purpureus have relatively bold, brown and white head patterns while female C. mexicanus have plain, brown heads. The brown streaks on the breast and flanks are blurry and grayish on C. mexicanus versus clear, brown streaks against a white background for C. purpureus. For both sexes, the bill shape may also help to identify the species. For C. purpureus, the bill is straight, whereas C. mexicanus has a slightly curved culmen.

Average mass: 25 g.

Average length: 15.2 cm.

Average wingspan: 25.4 cm.

Range basal metabolic rate: 10 (high) cm^3 oxygen/hour.

Average basal metabolic rate: 4.5 cm^3 oxygen/hour.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Carpodacus purpureus inhabits both forested and urban habitats. It prefers to breed within or at the edge of open coniferous or mixed coniferous-deciduous forests. Other breeding habitats include urban parks, orchards, hedgerows, deciduous forests, or pastures with several suitable trees or shrubs. Studies have shown that this species actually responds positively to forest patches with a large amount of edge. During the winter, Carpodacus purpureus is considered a habitat generalist and will inhabit most any area with ample food resources. Historically this species has adapted well to human development and was an abundant resident in urban parks, gardens, or streets lined with ornamental trees. In recent decades, introduced house finches (Carpodacus mexicanus) have out-competed native Carpodacus purpureus in many habitats, but urban landscapes in particular, where their ranges overlap in the east.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: urban ; suburban ; agricultural

  • 1907. Bird-lore: a bi-monthly magazine devoted to the study and protection of birds and mammals. Washington, D.C.: National Association of Audubon Societies.
  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York, NY: Simon and Schuster Inc.
  • Wootton, J. 1987. Interspecific competition between introduced house finch populations and two associated passerine species. Oecologia, 71/3: 325-331.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Carpodacus purpureus is primarily a granivore and consumes mostly seeds. Diet changes seasonally to include abundant food resources, such as insects in the spring and fruits in the summer. This species will often prefer to eat the seeds of fruits rather than the fleshy portions. It will also eat tree buds and blossoms in early spring. The young are fed almost exclusively seeds. This species frequently forages on the seeds and buds of elms (Ulmus species), tuliptree (Liriodendron tulipifera), maples (Acer species), sweet gum (Liquidambar styraciflua), sycamores (Platanus species), ash (Fraxinus species), redcedar (Juniperus virginiana), juniper (Juniperus communis), and mountain ash (Sorbus species). Carpodacus purpureus consumes the seeds and berries of hackberries (Celtis species), dogwoods (Cornus species), sumacs (Rhus species), hop-hornbeam (Ostrya virginiana), beech (Fagus grandifolia), grapes (Vitis species), poison ivy (Toxicodendron radicans), strawberries (Fragaria species), and raspberries and blackberries (Rubus species), among others. This species tends to forage on the outer portions of a tree or bush and rarely feeds on the ground.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit; nectar; flowers

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

As primarily a seed eater, Carpodacus purpureus may be an important seed disperser for plants on which it feeds. Adults, young, and eggs serve as prey for a variety of avian and mammalian predators. This species is an occasional host to brown-headed cowbirds, and eastern populations are parasitized more often than western. Carpodacus purpureus is presumed to be a poor host, as its young are fed mostly seeds and young cowbirds are adapted to an insect-based diet. Nests of this species often host several types of fly larvae including those of bird blowflies and botflies. Adult finches are parasitized by trematodes, bird lice, ticks, and nasal mites.

Commensal/Parasitic Species:

  • Spicer, G. 1977. Two nasal mites of the genus Ptilonyssus (Mesostigmata: Rhinonyssidae) from Texas. Acarologia, 18: 594-601.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Carpodacus purpureus suffers most predation during the breeding season, when eggs and young are abundant and helpless prey for predators. Common nest predators include blue jays, scrub jays, Clark’s nutcrackers, common grackles, and red squirrels. To avoid nest predation, the female uses nesting materials from the surrounding environment to create a well-camouflaged nest. If their nest is attacked, a breeding pair will often remain close and make frequent calls or mob the predator. Adult Carpodacus purpureus also fall prey to blue jays, barn owls, merlins, sharp-shinned hawks, American kestrels, domestic cats, and domestic dogs.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Carpodacus purpureus is well-known for its bright, musical warble that males sing during late winter or early spring. This is better known as the "warbling song" and consists of 6 to 23 undulating notes of varying pitch, usually sung while the birds are traveling in flocks. During the breeding season, males use a different song in defense of their territories which is characterized by several notes of the same pitch given at the beginning and an accented, high-pitched note at the end. There are usually several warbling notes in between these definitive start and end notes. Males also give a third song that is similar to a vireo's, in that it has several paired phrases. Females also give a short song that is described as finch-like, yet different from a male's song. Females sing while sitting on the nest, but the purpose is currently unknown. Both males and females give a sharp "tick" call when in flight, likely used to keep in contact with others.

This species also uses body postures to communicate, mostly in aggressive situations. Three specific aggressive postures have been identified: Low head forward, high head forward, and bill display. Low head forward is used in low-intensity situations and consists of an individual holding the body horizontal, neck extended and bill pointed at opponent. Postures with the body held upright are considered high head forward, and are usually given with the beak held open. In high intensity encounters, bill displays are given in which the bird holds body at maximum height and points bill downwards towards opponent. These postures may also be species specific, for example, low head forward displays are given more often to American goldfinches. Studies suggest that Carpodacus purpureus employs the display that will be most successful in displacing the opponent without inducing an attack.

Like most birds, Carpodacus purpureus perceives its environment through auditory, tactile, visual and chemical stimuli.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The maximum lifespan for Carpodacus purpureus is 14 years. This record is held by a male that was banded at approximately 2 years old, and was then recaptured 12 years later. Average wild lifespan is estimated at 2 years. Causes of adult mortality are largely unknown, but nestlings are often lost to weather, predation, or brood parasitism. Lifespan in captivity is unknown as this species only lives in the wild.

Range lifespan

Status: wild:
14 (high) years.

Average lifespan

Status: wild:
2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14 years (wild) Observations: One male banded when about 2 years of age was recovered 12 years later (http://bna.birds.cornell.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Carpodacus purpureus is a monogamous species, although the length of a pair-bond is unknown. Males perform elaborate courtship displays to attract mates. Once a female is in his territory, a male will rapidly flutter his wings while hopping, thrusting out his breast, raising his crest feathers, cocking up his tail, and singing a soft warble. During this display he often holds nesting material in his bill. The male then flies directly upwards to about 30 cm high. Upon landing, he droops his wings and uses his tail to support him as he raises his head and tilts his body backwards as far as possible. Interested females may respond by drooping and fluttering their wings or beginning to search for a nesting site.

Mating System: monogamous

Carpodacus purpureus breeds once annually between the months of April and August. After pair formation, pairs select a suitable nesting site which is most often in the branches of a conifer. The female completes most of the nest construction alone, with only occasional assistance from the male. She builds a cup-shaped nest out of twigs, roots, grasses, hair, or moss. The construction process typically lasts 3 to 8 days. One to five days after the nest is complete, the female lays 4 to 6 eggs which are greenish-blue in color and speckled with brown or black. The female alone develops a brood patch and thus she performs all incubation duties. During this time, the male frequently provides food to the female whether she is on or off the nest. The young hatch after an average 13 day incubation period and the young fledge after an additional 13 to 16 days. Fledglings are fed by the parents for an unknown period of time. Carpodacus purpureus juveniles may breed during the following breeding season when they are less than 1 year old.

Breeding interval: Purple finches breed once annually.

Breeding season: The breeding season for purple finches occurs from April to August.

Range eggs per season: 3 to 6.

Average eggs per season: 4 to 5.

Average time to hatching: 13 days.

Range fledging age: 13 to 16 days.

Average fledging age: 14 days.

Average age at sexual or reproductive maturity (female): <1 years.

Average age at sexual or reproductive maturity (male): <1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Carpodacus purpureus is born altricial and therefore requires a significant parental investment. Both the male and female select a nesting location, however the female completes most or all of the nest construction. As only the female develops a brood patch, she also performs all of the incubation and brooding. While the female is busy incubating the male frequently provides her with food. Once the young hatch, both parents actively feed the young through regurgitation. The young are fed a diet that is almost entirely seeds. Both parents also participate in nest sanitation and will remove nestlings' fecal sacs to reduce predation or spread of disease. After the young have fledged, both parents continue to provide food for an unknown period of time.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birder's Handbook: A Field Guide to the Natural History of North American Birds. New York, NY: Simon and Schuster Inc.
  • Wootton, T. 1996. "Purple Finch (Carpodacus purpureus)" (On-line). The Birds of North America Online. Accessed July 13, 2011 at http://bna.birds.cornell.edu/bna/species/208.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Carpodacus purpureus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Carpodacus purpureus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTATACCTAATCTTCGGCGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTTATCCGAGCAGAACTAGGCCAACCCGGAGCTCTTCTGGGGGACGACCAGGTCTATAACGTAGTCGTCACAGCCCATGCCTTCGTAATAATCTTCTTCATAGTTATGCCTATTATAATCGGAGGATTTGGGAACTGACTAGTCCCTCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCGTTCCTCCTACTACTAGCGTCCTCTACTGTAGAAGCAGGAGTTGGCACAGGATGAACAGTATACCCACCATTAGCCGGCAACTTAGCCCACGCTGGAGCTTCAGTTGACTTAGCAATCTTCTCTCTGCACCTAGCTGGTATCTCCTCAATCCTAGGAGCAATCAACTTTATTACAACTGCAATTAACATAAAACCTCCCGCTCTGTCACAATACCAAACACCTCTATTCGTCTGATCAGTACTAATCACTGCAGTACTTTTACTGCTCTCCCTTCCAGTCCTCGCCGCAGGAATTACAATGCTCCTAACAGACCGTAACCTCAACACTACATTCTTTGACCCCGCAGGAGGAGGGGACCCAGTCCTATACCAGCACCTCTTCTGATTTTTCGGACACCCAGAAGTATACATCCTAATTCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Carpodacus purpureus is listed as "Least Concern" by the International Union for Conservation of Nature and Natural Resources' (IUCN) Red List. However, the population is currently in decline, which is likely due to habitat loss and interspecific competition with introduced house finches. Annual rate of population decline is estimated at 1.7 %, but the New England region in the United States has seen an increased decline of 2.43 % annually. As a result, the Atlantic Northern Forest (Bird Conservation Region 14) in New England has listed it as a high conservation priority. It is currently still present across a large geographic range despite being extirpated from many historical breeding sites in the New England region. More research is needed to pinpoint causes of decline and develop specific conservation strategies, especially within the breeding range.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

  • U.S. Fish and Wildlife Service. A Blueprint for the Design and Delivery of Bird Conservation in the Atlantic Northern Forest. Version 1.0. Hadley, MA: Atlantic Coast Joint Venture. 2006.
  • University of New Hampshire Cooperative Extension. New Hampshire Wildlife Action Plan. Species Profile: Purple Finch (Caprodacus purpureus). New Hampshire: New Hampshire Fish and Game. 2007.
  • BirdLife International, 2009. "Carpodacus purpureus" (On-line). IUCN Red List of Threatened Species. Accessed July 19, 2011 at http://www.iucnredlist.org/apps/redlist/details/149563/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Carpodacus purpureus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Carpodacus purpureus provides little economic benefit to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!