Articles on this page are available in 1 other language: Spanish (7) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyanerpes cyaneus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATCTTCGGCGCATGAGCTGGAATAGTAGGTACTGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCCGGAGCCCTCCTAGGAGACGACCAAGTCTACAACGTAATCGTCACGGCTCATGCTTTCGTAATAATTTTCTTCATAGTTATACCAATTATAATCGGAGGGTTTGGAAACTGACTAGTCCCTCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCTTTCCTTCTCCTCTTAGCATCCTCCACAGTTGAAGCAGGCGTTGGTACCGGCTGAACAGTGTACCCCCCACTAGCCGGCAATCTAGCCCATGCTGGAGCCTCAGTAGATCTAGCAATCTTCTCCCTACATCTAGCTGGCATCTCTTCAATCCTAGGGGCAATCAACTTTATTACAACAGCAATTAACATAAAACCCCCTGCTCTCTCACAATACCAAACCCCCCTCTTCGTCTGATCCGTCCTAATCACCGCAGTCCTACTACTCCTATCTCTCCCAGTCCTTGCCGCAGGAATCACAATACTCCTTACAGACCGAAACCTCAACACCACATTCTTTGACCCCGCTGGAGGAGGAGACCCCGTCCTATACCAACACCTCTTCTGATTCTTTGGCCACCC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cyanerpes cyaneus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 5,000,000-50,000,000 individuals (A. Panjabi in litt. 2008).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-legged honeycreeper

The red-legged honeycreeper (Cyanerpes cyaneus) is a small songbird species in the tanager family (Thraupidae). It is found in the tropical New World from southern Mexico south to Peru, Bolivia and central Brazil, Trinidad and Tobago, and on Cuba, where possibly introduced.

Description[edit]

Adult female (left) with male in right background

The red-legged honeycreeper is on average 12.2 cm (4.8 in) long, weighs 14 g (0.49 oz) and has a medium-long black, slightly decurved, bill. The male is violet-blue with black wings, tail and back, and bright red legs. The crown of its head is turquoise, and the underwing, visible only in flight, is lemon yellow. After the breeding season, the male moults into an eclipse plumage, mainly greenish with black wings.

Females and immatures are mainly green, with paler, faintly streaked underparts. The legs are red-brown in the female, and brown in young birds.

The call of red-legged honeycreeper is a thin, high-pitched tsip.

Several subspecies are known. Differences are generally slight, with the Tobago race C. c. tobagensis being slightly larger than the mainland forms for example.

The purplish honeycreeper (Chlorophanes purpurascens), a bird from Venezuela known only from the type specimen, is considered to be an intergeneric hybrid between the green honeycreeper and either the red-legged honeycreeper or the blue dacnis.[2]

Ecology[edit]

This is a species of forest edge, open woodland, and cocoa and citrus plantations. The red-legged honeycreeper is often found in small groups. It feeds on insects and some fruit[3] and nectar.[4] It responds readily to the (easily imitated) call of the ferruginous pygmy owl (Glaucidium brasilianum).

The female red-legged honeycreeper builds a small cup nest in a tree, and incubates the clutch of two brown-blotched white eggs for 12–13 days, with a further 14 days to fledging.

A specimen studied in the Parque Nacional de La Macarena of Colombia was found to be free of blood parasites.[5]

Common and widespread, the red-legged honeycreeper is not considered a threatened species by the IUCN.[1]

References[edit]

  1. ^ a b BirdLife International (2012). "Cyanerpes cyaneus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Storer, Robert W. (1957). "The Hybrid Origin of Chlorophanes purpurascens". The Auk 74 (4): 507. doi:10.2307/4081756. 
  3. ^ e.g. of Trophis racemosa (Moraceae): Foster, Mercedes S. (2007). "The potential of fruit trees to enhance converted habitats for migrating birds in southern Mexico". Bird Conservation International 17: 45. doi:10.1017/S0959270906000554. 
  4. ^ e.g. of Dimorphandra sp.: O'Shea, B.J.; Milensky, Christopher M.; Claramunt, Santiago; Schmidt, Brian K.; Gebhard, Christina A.; Schmitt, C. Gregory; Erskine, Kristine T. (2007). "New records for Guyana, with description of the voice of Roraiman Nightjar Caprimulgus whitelyi". Bulletin of the British Ornithologists' Club 127 (2): 118–128. 
  5. ^ Basto, Natalia; Rodríguez, Oscar A.; Marinkelle, Cornelis J.; Gutierrez, Rafael; Matta, Nubia Estela (2006). "Haematozoa in birds from la Macarena National Natural Park (Colombia)". Caldasia 28 (2): 371–377. 

Further reading[edit]

  • ffrench, Richard; O'Neill, John Patton; Eckelberry, Don R. (1991). A Guide to the Birds of Trinidad and Tobago (2nd ed.). Ithaca, N.Y.: Comstock Publishing. ISBN 0-8014-9792-2. 
  • Hilty, Steven L. (2003). Birds of Venezuela. Princeton University Press. ISBN 0-7136-6418-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!