Articles on this page are available in 1 other language: Spanish (16) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyanerpes lucidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CTGTACCTAATCTTCGGCGCATGAGCCGGGATAGTAGGCACTGCCCTAAGCCTCCTCATCCGAGCAGAACTAGGCCAACCTGGGGCTCTCCTAGGAGACGACCAAGTCTACAACGTAATCGTCACGGCCCATGCTTTCGTAATAATTTTCTTCATAGTCATACCAATCATGATCGGAGGGTTCGGAAACTGACTAGTCCCTCTAATAATTGGAGCCCCAGACATAGCATTCCCGCGAATAAACAACATAAGCTTCTGACTGCTCCCCCCATCCTTCCTCCTCCTCCTAGCATCTTCCACCGTTGAAGCAGGTGTCGGTACGGGCTGAACAGTGTACCCCCCACTAGCTGGTAACCTAGCCCATGCTGGAGCCTCAGTCGACCTCGCAATCTTCTCCCTACATCTAGCCGGCATCTCTTCAATTCTAGGAGCAATCAACTTCATCACAACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACTCCCCTTTTCGTCTGATCAGTCCTAATTACCGCAGTCCTATTGCTCCTATCTCTCCCAGTCCTTGCCGCAGGAATCACAATACTCCTCACAGACCGAAACCTCAATACCACATTCTTCGACCCCGCCGGAGGAGGAGACCCCGTCCTATACCAACACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cyanerpes lucidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 50,000-499,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Shining Honeycreeper

The shining honeycreeper (Cyanerpes lucidus) is a small bird in the tanager family. It is found in the tropical New World in Central America from southern Mexico to Panama and northwest Colombia. It is sometimes considered to be conspecific with the purple honeycreeper (C. caeruleus), but the two species breed sympatrically in eastern Panama and northwest Colombia.

This is a forest canopy species, but also occurs in forest edges and secondary growth. The female builds a shallow cup nest in a tree, and incubates the clutch of two eggs.

The shining honeycreeper is 10 cm long, weighs 11 g and has a long black decurved bill. The male is purple-blue with black wings, tail and throat, and bright yellow legs. The female has green upperparts, a greenish-blue head, buff throat and buff-streaked bluish underparts. The immature is similar to the female, but is greener on the head and breast.

The call of this honeycreeper is a thin high-pitched seee, and the male’s song is a pit pit pit pit pit-pit repeated for minutes at a time.

This species is very similar to the purple honeycreeper, but the male of the latter species is overall slightly darker and its black throat patch is smaller. Unlike the female shining honeycreeper, the female purple honeycreeper has buff (not dusky) lores and, except for its malar, no clear blue tinge to the head.

The shining honeycreeper is easily distinguished from the larger red-legged honeycreeper with which its shares its range by the latter species’ red legs and, in the male, black mantle.

The shining honeycreeper is usually found in pairs or family groups. It feeds on nectar, berries and insects, mainly in the canopy. It responds readily to the call of the ferruginous pygmy owl.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!