Overview

Brief Summary

Biology

Usually seen in pairs, the reclusive straight-billed reedhaunter spends most of the day concealed amongst dense, low vegetation. It will, however, move to a more exposed perch during territorial displays, when it produces a series of high-pitched notes ending in a trill, tsi-tsi-tsi-tsi-tsi-tititititititi (3) (5). Little is known about the reproductive behaviour of the straight-billed reedhaunter, but it is known to lay an average of three eggs in a dome-shaped nest situated within vegetation (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

After its discovery by Charles Darwin in 1833, this species became known as “Darwin's lost bird”, as it took almost a century before further specimens were located (3) (4). The straight-billed reedhaunter is slender-bodied, with greyish-brown upperparts, becoming greyer on the crown, and with an indistinct whitish band running above the eye. By contrast, the wings and long, pointed tail are reddish-brown, while the underparts are white becoming buff on the flanks (2) (5). Perhaps the most distinctive feature of the straight-billed reedhaunter is the very long, straight bill (5), which may be an adaptation for extracting insect prey from amongst the leaves and flower heads of spiny plant species (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Extreme s Brazil to s Uruguay and e Argentina.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Limnoctites rectirostris occurs in extreme south Brazil (Santa Catarina and Rio Grande do Sul), south Uruguay and east Argentina (Entre Ríos and extreme north-east Buenos Aires)1,4. It is very locally distributed, but locally common in appropriate habitats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The straight-billed reedhaunter has a relatively small range, extending from the states of Santa Catarina and Rio Grande do Sul in extreme southern Brazil, through to southern Uruguay and eastern Argentina in the provinces of Entre Ríos and extreme north-east Buenos Aires. Within this range, the straight-billed reedhaunter is very sparsely distributed, but is locally common in appropriate habitats (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs up to 1,100 m, in small marshes and swales, as well as short trees and shrubs bordering wet areas. It is closely associated with the spiny apiaceous herb "caraguata" Eryngium spp., which is abundant in marshes throughout its range4. It also occurs locally away from water in upland thickets of Epyngium pandanifolum.

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The straight-billed reedhaunter is most commonly found in marshland, but also occupies stands of short trees and shrubs bordering wet areas up to elevations of 1,100 metres. This species has a close association with the spiny herb commonly called caraguata (Eryngium species), which grows around marshes and in upland thickets (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Limnornis rectirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTTTACCTAATTTTCGGAGCATGAGCCGGCATGATTGGAACCGCCCTCAGCCTTCTAATCCGAGCTGAACTTGGACAACCAGGTACCCTTCTAGGCGACGACCAGATTTACAATGTAATCGTTACTGCCCATGCTTTCGTAATAATCTTCTTTATAGTCATACCTATTATAATTGGCGGCTTTGGCAACTGATTAGTCCCATTAATAATCGGTGCTCCTGACATAGCCTTCCCTCGAATAAACAACATAAGCTTCTGACTACTACCTCCATCCTTCTTACTTCTCCTAGCCTCCTCAACAGTAGAAGCAGGAGTAGGAACAGGATGAACAGTCTACCCTCCACTAGCAGGCAACTTAGCCCACGCTGGTGCTTCAGTCGACCTGGCCATCTTCTCCCTCCACTTAGCTGGCGTATCCTCTATCCTAGGAGCCATCAACTTTATTACAACCGCTATTAACATAAAACCACCCGCTCTCTCACAATATCAAACACCACTATTTGTTTGATCTGTCCTTATCACTGCTGTACTTCTCCTACTCTCACTCCCTGTCCTAGCTGCTGGCATCACAATATTACTAACAGATCGTAACCTAAACACTACGTTCTTCGATCCAGCCGGAGGCGGAGACCCAGTCCTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Limnornis rectirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
BirdLife International

Reviewer/s
Gilroy, J., Butchart, S.

Contributor/s

Justification
This species has narrow habitat requirements, and is likely to have a moderately small and fragmented population which may be declining owing to habitat loss. It is therefore considered Near Threatened.

History
  • 2004
    Near Threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common but patchily distributed' (Stotz et al. 1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
In Argentina, and particularly in the heavily populated Buenos Aires province, its habitat is threatened by house-building, rubbish dumps and water pollution2. It is presumably also threatened by intensive grazing, marsh drainage, extensive willow Salix plantations and, particularly in east Entre Ríos, the drying effects of Eucalyptus and Pinus spp. plantations3.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The major threat to the straight-billed reedhaunter is habitat degradation and clearance as a result of human development. This is particularly problematic in the heavily populated province of Buenos Aires, where house-building, rubbish dumping and water pollution are threatening to destroy the remaining areas of marshland that this species occupies. In other areas, its habitat is also threatened by intensive grazing, marsh drainage, and plantations of Eucalyptus and pine species, which have a drying effect on the surrounding land (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway

Conservation Actions Proposed
Repeat surveys of known sites in order to determine rates of population decline and range contraction. Encourage the conservation of wetland habitats within the range, including the gazetting of protected areas at key sites.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In order to gauge the current level of decline of the straight-billed reedhaunter population, further surveys must be undertaken. In addition, efforts should be made to increase protection of this species' habitat, through the designation of protected areas (2). The conservation organisation, Aves Argentina, is working to ensure that important bird habitats within Argentina are properly conserved and protected. This includes assisting in the management of Otamendi Nature Reserve, which contains the only known breeding population of the straight-billed reedhaunter, and is one of the few places in its range where it receives protection (6) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Straight-billed Reedhaunter

The Straight-billed Reedhaunter (Limnoctites rectirostris) is a South American bird species in the family Furnariidae. It is today placed in the monotypic genus Limnoctites.[2]

Formerly it was – and in some works it still is – placed in Limnornis with the Curve-billed Reedhaunter (Limnornis curvirostris) which lives in the same general region and habitat, and thus shares some adaptations with L. rectirostris. But L. rectirostris seems closer to the typical spinetails (Cranioleuca) than to the Curve-billed Reedhaunter. The modern treatment thus makes Limnornis monotypic also. As using monotypic genera if not really necessary is eschewed by most taxonomists today, the Straight-billed Reedhaunter is liable to be placed in Cranioleuca if further studies verify its placement.[3]

This bird is found in north-eastern Argentina, south-eastern Brazil and Uruguay. In its range it is essentially limited to marshy areas in the pampas and planalto grasslands. In Brazil, it is found in Rio Grande do Sul and Santa Catarina States. In Argentina, it occurs in Entre Ríos and the extreme nort-east of Buenos Aires Provinces. In Uruguay, it is limited to the erastern and southern part of the country. In recent years, it has been recorded in Cerro Largo, Canelones, Maldonado – where Charles Darwin recorded it in 1833 at Laguna José Ignacio and Laguna del Diario, where it can still be found –, Rocha, San José and Treinta y Tres Departments. From Lavalleja Department, there are only records from 1994, but the bird probably is still found there.[4]

This species prefers marshy and swampy localities between sea level and 1,100 m ASL, and also occurs in more wooded habitat if suitable wetlands are nearby. A key feature of prime habitat is an abundant growth of caraguata (spiny eryngos, Eryngium spp.), such as E. pandanifolium which it utilizes particularly in upland localities. It is sometimes claimed that the two reedhaunters differ in microhabitat preference, occurring sympatrically in the same region but not within the same locality, but this seems to be incorrect.[5]

As with many of its relatives, rather little is known about its reproductive habits. In the south of Uruguay, a juvenile was observed in mid-January (i.e. midsummer).[6]

The Straight-billed Reedhaunter may be common in suitable habitat, but globally its numbers are decreasing and is becoming rare due to habitat loss. Significant threats are pollution and the draining of wetlands, particularly for construction on the outskirts of larger towns. Invasive willows (Salix spp.) as well as plantations of eucalypt (Eucalyptus spp.) and pine (Pinus spp.) are also detrimental to habitat quality. The species occurs in some protected areas, such as Área Protegida Quebrada de los Cuervos in Uruguay's Treinta y Tres Department.[7]

Footnotes

  1. ^ BirdLife International (2012). "Limnoctites rectirostris". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106004932. Retrieved 16 July 2012.
  2. ^ BLI (2009)
  3. ^ Olson et al. (2005)
  4. ^ Accordi & Barcellos (2006), Bencke (2007), Azpiroz & Menéndez (2008), BLI (2009)
  5. ^ Olson et al. (2005), Azpiroz & Menéndez (2008), BLI (2009)
  6. ^ Azpiroz & Menéndez (2008)
  7. ^ Azpiroz & Menéndez (2008), BLI (2009)

References

  • Accordi, Iury Almeida & Barcellos, André (2006): Composição da avifauna em oito áreas úmidas da Bacia Hidrográfica do Lago Guaíba, Rio Grande do Sul [Bird composition and conservation in eight wetlands of the hidrographic basin of Guaíba lake, State of Rio Grande do Sul, Brazil]. Revista Brasileira de Ornitologia 14 (2): 101-115 [Portuguese with English abstract]. PDf fulltext
  • Azpiroz, Adrián B. & Menéndez, José L. (2008): Three new species and novel distributional data for birds in Uruguay. Bulletin of the British Ornithologists' Club 128 (1): 38-56.
  • Bencke, Glayson Ariel (2007): Avifauna atual do Rio Grande do Sul, Brasil: aspectos biogeográficos e distribucionais ["The Recent avifauna of Rio Grande do Sul: Biogeographical and distributional aspects"]. Talk held on 2007-JUN-22 at Quaternário do RS: integrando conhecimento, Canoas, Rio Grande do Sul, Brazil. PDF abstract
  • Olson, Storrs L.; Irestedt, M.; Ericson, Per G.P. & Fjeldså, Jon (2005): Independent evolution of two Darwinian marsh-dwelling ovenbirds (Furnariidae: Limnornis, Limnoctites). Ornitología Neotropical 16 (3): 347-359. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!