Articles on this page are available in 2 other languages: Spanish (7), Chinese (Simplified) (12) (learn more)

Overview

Brief Summary

The familiar Barn Swallow (Hirundo rustica) is a common breeding bird across North America, Europe, and Asia and winters in South America and southern Africa (it is possible that the variation across this enormous distribution may actually represent more than one species). In the New World, Barn Swallows breed from Canada to Mexico. They are also now established as breeders in northeastern Argentina, where a small number of breeding pairs were first documented in 1980 and the species has since been well established (Billerman et al. 2011). They winter from Mexico and Panama, Puerto Rico, and the Lesser Antilles south throughout South America to Tierra del Fuego. In Eurasia, the breeding range extends from Iceland, the British Isles, the Faeroe Islands, Scandinavia, northern Russia, and northern Siberia south to the Mediterranean region, northern Africa, the Near East, Arabia, Iran, the Himalayas, China, Taiwan, and Japan; these Old World populations winter south to tropical Africa, the East Indies, northern Australia, and Micronesia. Winter range can be difficult to delineate due to late fall records (as late as December) and early spring migrants.

Barn Swallows live in open or semi-open country (farms, fields, marshes, lakes), often near water, and capture and eat most of their food (mainly flying insects) in the air.

Courtship involves aerial chases. On a perch, the members of a mated pair sit close together, touch bills, and engage in mutual preening. Several Barn Swallow pairs may nest in the same immediate area, but Barn Swallows do not form dense colonies as some swallows do. Originally, Barn Swallows nested in crevices in cliffs or shallow caves, but today most nest sites are in open buildings, under eaves, under bridges or docks, or in similar situations. The nest, which is built by both sexes, is a cup of mud and dried grass lined with feathers. The 4 to 5 (sometimes 6, rarely 7) eggs are white, spotted with brown. Eggs are incubated by both sexes (but especially by the female) for 13 to 17 days. Both parents feed the young. One or two additional birds, the pair's offspring from previous broods, may attend the nest and sometimes feed the nestlings. Young leave the nest around 18 to 23 days after hatching.

Barn Swallows migrate in flocks, mainly by day.

(Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Billerman, S.M., Huber, G.H., Winkler, D.W., Safran, R.J., and I.J. Lovette. 2011. Population Genetics of a Recent Transcontinental Colonization of South America by Breeding Barn Swallows (Hirundo rustica). The Auk 128(3):506-513.
  • Dunn, J.L. and J. Alderfer. 2011. National Geographic Field Guide to the Birds of North America. National Geographic Society, Washington, D.C.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: south-coastal and southeastern Alaska, across much of Canada south through much of U.S. to central Mexico; also eastern Buenos Aires province, Argentina, in early 1980s (Ridgely and Tudor 1989); across Eurasia to Mediterranean region, northern Africa, China, Japan. NON-BREEDING: mainly South America, regularly from Costa Rica and West Indies to Tierra del Fuego (but in low numbers south of central Chile and northern Argentina, Ridgely and Tudor 1989); Africa and southern Asia; uncommon in Puerto Rico. Accidental in Hawaii.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Barn swallows are native in all the biogeographic regions except Australia and Antarctica. The breeding range of barn swallows includes North America, northern Europe, northcentral Asia, northern Africa, the Middle East, southern China, and Japan. They winter in South America, South Asia, Indonesia, and Micronesia.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); neotropical (Native )

Other Geographic Terms: holarctic

  • Terres, J. 1980. The Audubon Society Encyclopedia of North American Birds. New York: Alfred A. Knopf, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Geographic Range

Barn swallows are native in all the biogeographic regions except Australia and Antarctica. The breeding range of barn swallows includes North America, northern Europe, northcentral Asia, northern Africa, the Middle East, southern China, and Japan. They winter in South America, South Asia, Indonesia, and Micronesia.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); neotropical (Native )

Other Geographic Terms: holarctic

  • Terres, J. 1980. The Audubon Society Encyclopedia of North American Birds. New York: Alfred A. Knopf, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Barn swallows are small birds. They are 14.6 to 19.9 cm long and have a wingspan of 31.8 to 34.3 cm. They weigh between 17 and 20 g. Barn swallows are metallic blue-black above and pale beige below. They have light brown on their throat and forehead, and have a long, deeply-forked tail. Males and females look very similar. However, females tend to be less brightly colored and have shorter tails.

Range mass: 17 to 20 g.

Range length: 14.6 to 19.9 cm.

Range wingspan: 31.8 to 34.3 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger; male more colorful

Average basal metabolic rate: 0.3158 W.

  • Moller, A. 1994. Male ornament size as a reliable cue to enhanced offspring viability. Proceedings of the National Academy of Sciences, 91: 6929-6932.
  • Moller, A. 1994. Patterns of fluctuating asymmetry and selection against asymmetry. Evolution, 48: 658-671.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Barn swallows are small birds. They range in size from 14.6 to 19.9 cm long, with a wingspan of 31.8 to 34.3 cm. They weigh between 17 and 20 g. Barn swallows are metallic blue-black above and pale beige below. They have light brown on their throat and forehead, and have a long, deeply-forked tail. Males and females are similar in appearance, though females tend to be less vibrantly colored and have shorter outer tail-streamers.

Asymmetry of physical characteristics in barn swallows tends to be transmitted to the young in distinct parent to offspring patterns. Tail asymmetry tends to pass from father to son and from mother to daughter. Alternatively, wing asymmetry does not appear to transfer at all on a reliable basis from parent to offspring.

Six subspecies of Hirundo rustica are recognized.

Range mass: 17 to 20 g.

Range length: 14.6 to 19.9 cm.

Range wingspan: 31.8 to 34.3 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: male larger; male more colorful

Average basal metabolic rate: 0.3158 W.

  • Moller, A. 1994. Male ornament size as a reliable cue to enhanced offspring viability. Proceedings of the National Academy of Sciences, 91: 6929-6932.
  • Moller, A. 1994. Patterns of fluctuating asymmetry and selection against asymmetry. Evolution, 48: 658-671.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 17 cm

Weight: 19 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Barn swallows are very adaptable birds. They can nest anywhere where there are open areas for foraging, a water source, and a sheltered ledge for their nest. They seek out open habitats of all types, including farms, and are commonly found in barns or other outbuildings. They also build nests under bridges, the eaves of old houses, and boat docks, as well as in rock caves and even on slow-moving trains.

While migrating, barn swallows tend to fly over open habitats, often near water or along mountain ridges. Barn swallows generally nest below 3000 m elevation.

Range elevation: 3000 (high) m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian ; caves

  • McWilliams, G. 2000. The Birds of Pennsylvania. New York: Cornell University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barn swallows are very adaptable birds and can nest anywhere with open areas for foraging, a water source, and a sheltered ledge. They seek out open habitats of all types, including agricultural areas, and are commonly found in barns or other outbuildings. They will also build nests under bridges, the eaves of old houses, and boat docks, as well as in rock caves and even on slow-moving trains.

While migrating, they tend to fly over open areas, often near water or along mountain ridges. Barn swallows generally nest below 3000 m elevation.

Range elevation: 3000 (high) m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian ; caves

  • McWilliams, G. 2000. The Birds of Pennsylvania. New York: Cornell University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 147 specimens in 3 taxa.
Water temperature and chemistry ranges based on 82 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 8.272 - 13.570
  Nitrate (umol/L): 1.249 - 8.636
  Salinity (PPS): 6.428 - 35.485
  Oxygen (ml/l): 5.998 - 8.081
  Phosphate (umol/l): 0.240 - 0.630
  Silicate (umol/l): 1.455 - 10.453

Graphical representation

Temperature range (°C): 8.272 - 13.570

Nitrate (umol/L): 1.249 - 8.636

Salinity (PPS): 6.428 - 35.485

Oxygen (ml/l): 5.998 - 8.081

Phosphate (umol/l): 0.240 - 0.630

Silicate (umol/l): 1.455 - 10.453
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Open situations, less frequently in partly open habitats, frequently near water (AOU 1983). Wintering concentrations often associated with sugar cane fields (Hilty and Brown 1986, Ridgely and Tudor 1989). Nests in barns or other buildings, under bridges, in caves or cliff crevices, usually on vertical surface close to ceiling. Commonly reuses old nests. Usually returns to same nesting area in successive years; yearlings often return to within 30 km or closer to natal site (Turner and Rose 1989, Shields 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Arrives in much of U.S. in April, Alaska in May (Terres 1980). Common migrant in Puerto Rico and the Virgin Islands. Migrates through Costa Rica mainly early to mid-August through October and early March-late May or early June (Stiles and Skutch 1989). In South America mainly August to May (though some may linger throughout year) (Hilty and Brown 1986, Ridgely and Tudor 1989). See Turner and Rose 1989 for information on Old World migrations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Barn swallows are insectivores. Diptera, Acrididae, Gryllidae, Anisoptera, Coleoptera, moths and other flying Insecta make up 99 % of their diet. They catch most of their prey while in flight, and are able to feed their young at the nest while flying.

Barn swallows forage opportunistically. They have been observed following tractors and plows, catching the insects that are disturbed by the machinery. They drink water by skimming the surface of a body of water while flying.

Animal Foods: insects

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Barn swallows are insectivores. Flies, grasshoppers, crickets, dragonflies, beetles, moths and other flying insects make up 99 % of their diet. They catch most of their prey while in flight, and are able to feed their young at the nest while flying.

Barn swallows forage opportunistically. They have been observed following tractors and plows, catching the insects that are disturbed by the machinery. They drink water by skimming the surface of a body of water while flying.

Animal Foods: insects

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Flies over open land and water and forages on insects; forages nearer to the ground than other swallows (usually not greater than 10 meters and often less than 1 meter above the ground) (Brown and Brown 1999). Feeds opportunistically on a wide variety of flying insects; primarily true flies (Diptera), but also beetles, true bugs, leafhoppers, Hymenoptera, dragonflies and damselflies, butterflies and moths, and occasionally grasshoppers and crickets (Beal 1918, Hoskyn 1988). Usually forages within a few hundred meters of nest when breeding. Occasionally may take insects from ground or vegetation; rarely eats berries (Beal 1918).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite / blood sucker
adult of Oeciacus hirundinis sucks the blood of nestling of Hirundo rustica
Other: minor host/prey

Animal / parasite / ectoparasite
imago of Ornithomya biloba ectoparasitises Hirundo rustica
Other: sole host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Barn swallows eat an enormous amount of insects and are very important in the control of their populations. Barn swallows are also a useful food source for many predators.

Molothrus occasionally lay their eggs in barn swallow nests. If the barn swallows incubate the eggs and raise the cowbird chick, they are helping the cowbird population.

Barn swallows sometimes live in a symbiotic relationship with Pandion haliaetus. The barn swallows nest inside or below an osprey nest, which is very big. By nesting near ospreys, the barn swallows are protected from predators, which are driven away by the ospreys. The ospreys benefit because the barn swallows give alarm calls when predators are nearby, alerting the ospreys.

Mutualist Species:

  • Pandion haliaetus

  • Wolfe, D. 1994. Brown-headed Cowbirds fledged from Barn Swallow and American Robin nests. Wilson Bulletin, 106: 764-767.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Falco sparverius and other hawks, such as Accipiter striatus and Accipiter cooperii, Otus asio, Laricidae, Quiscalus quiscula, Quiscalus major, Rattus norvegicus, Sciuridae, Mustela, Procyon lotor, Lynx rufus, Felis silvestris, Squamata, Rana catesbeiana, Actinopterygii and fire Formicidae are predators of barn swallows. Barn swallows usually give alarm calls when predators come near. Most predators of barn swallows attack the nestlings, but Accipitridae, Falconidae, and Strigiformes tend to hunt adults.

Barn swallows mainly escape predators by being swift and agile in flight and by building their nests in places that are difficult for predators to reach.

Known Predators:

  • American kestrels (Falco_sparverius)
  • sharp-shinned hawks (Accipiter_striatus)
  • Cooper's hawks (Accipiter_cooperii)
  • eastern screech owls (Otus_asio)
  • gulls (Laridae)
  • common grackles (Quiscalus_quiscula)
  • boat-tailed grackles (Quiscalus_major)
  • brown rats (Rattus_norvegicus)
  • squirrels (Sciuridae)
  • weasels (Mustela)
  • raccoons (Procyon_lotor)
  • bobcats (Lynx_rufus)
  • domestic cats (Felis_silvestris)
  • snakes (Serpentes)
  • bullfrogs (Rana_catesbeiana)
  • fish (Actinopterygii)
  • fire ants (Formicidae)

  • Barker, E., P. Ewins, J. Miller. 1994. Birds breeding in or beneath Osprey nests. Wilson Bulletin, 106: 743-750.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Although incidents of cowbirds parasitizing barn swallow nests are rare, they have been documented. A 1994 observation of 67 Barn Swallow nests found two of these nests to contain cowbird eggs, which were laid by the parent cowbird and left in the barn swallow nest in a parasitic fashion for the barn swallows to raise. Each of these nests contained 1 cowbird egg and both eggs were incubated by the barn swallows along with their own eggs. However, only one of the cowbird eggs hatched. The single cowbird hatchling fledged normally, thus demonstrating that barn swallows are capable of acting as cowbird hosts.

Barn swallows frequently engage in a symbiotic relationship with ospreys, coexisting in a single nesting area to the mutual benefit of both species. Barn swallows will nest either below a much larger osprey nest or in a portion of an abandoned osprey nest. By nesting near an osprey population, the barn swallows receive protection from birds of prey, which are driven away from the nests by the much larger ospreys. In return, ospreys are alerted to the presence of these predators by the barn swallows which give alarm calls when predators are nearby.

Barn swallows eat an enormous amount of insects and are very important in the control of their populations. Barn swallows are also a useful food source for many predators.

Mutualist Species:

  • Ospreys

  • Wolfe, D. 1994. Brown-headed Cowbirds fledged from Barn Swallow and American Robin nests. Wilson Bulletin, 106: 764-767.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

American kestrels and other hawks, such as sharp-shinned hawks and Cooper's hawks, eastern screech owls, gulls, common grackles, boat-tailed grackles, rats, squirrels, weasels, raccoons, bobcats, domestic cats, snakes, bullfrogs, fish and fire ants are predators of barn swallows. Barn swallows usually give alarm calls when predators come near. Most predators of barn swallows attack the nestlings, but hawks, falcons, and owls tend to hunt adults.

Barn swallows mainly escape predators by being swift and agile in flight and by building their nests in places that are difficult for predators to reach.

Known Predators:

  • Barker, E., P. Ewins, J. Miller. 1994. Birds breeding in or beneath Osprey nests. Wilson Bulletin, 106: 743-750.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Hirundo rustica is prey of:
Strigiformes
Falconiformes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Nonbreeding: may form flocks of up to thousands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Barn swallows use vocalizations and body language (postures and movements) to communicate. Barn swallows sing, both individually and as a group. They have a wide variety of calls used in different situations, from predator alarm calls, to courtship calls, and calls of young in nests. Nestlings give off a faint chirp while begging for food. Barn swallows also make clicking noises, which they create by snapping their jaws together.

Communication Channels: visual ; acoustic

Other Communication Modes: choruses

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Barn swallows use vocalizations and body language (postures and movements) to communicate. Barn swallows sing, both individually and as a group. They have a wide variety of calls used in different situations, from predator alarm calls, to courtship calls, and calls of young in nests. Nestlings give off a faint chirp while begging for food. Barn swallows also make clicking noises, which they create by snapping their jaws together.

Communication Channels: visual ; acoustic

Other Communication Modes: choruses

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Not much is known about the lifespan of these birds. The oldest wild barn swallow in North America lived 8 years, but this is considered to be unusual. Most barn swallows probably only live about 4 years.

Range lifespan

Status: wild:
8 (high) years.

Average lifespan

Status: wild:
4 years.

Average lifespan

Status: wild:
106 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

The average lifespan of barn swallows is 4 years. Barn swallows of 8 years of age have been documented, but these are considered the exception. Survival prospects and longevity appear to increase with tail length and wing and tail symmetry.

Range lifespan

Status: wild:
8 (high) years.

Average lifespan

Status: wild:
4 years.

Average lifespan

Status: wild:
106 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 16 years Observations: Barn swallows have been shown to suffer an age-dependent decline in offspring quality, feather development, and body size (Saino et al. 2002).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Barn swallows are socially monogamous (one male mates and raises chicks with one female). However, barn swallows often copulate with other swallows that are not their mate. Therefore, they are probably actually polygamous. Barn swallows form breeding pairs each spring after they arrive on the breeding grounds. They form new pairs each spring, though the same two birds may nest together for several years.

Male barn swallows try to attract females by displaying their tails and singing. Female barn swallows seem to prefer males with long tails that are equal lengths on each side. Long tails and symmetry may be good signals of a male's health and fitness as a mate.

Adults that don't have a mate sometimes join breeding pairs, and help them to build a nest, defend the nest, incubate the eggs and brood the chicks. These "helpers" are usually male. They may mate with the female of the nest.

Mating System: monogamous ; polygynandrous (promiscuous) ; cooperative breeder

Barn swallows usually breed between May and August. They usually raise two broods of chicks each summer. The male and female work together to build a nest. The nest is built of a mud shell, and is lined with grass and feathers. The female lays 3 to 7 eggs (average 5). Both parents incubate the eggs, which hatch in 13 to 15 days. The chicks are naked and helpless when they hatch. Both parents feed and protect the chicks, as well as removing their fecal sacs from the nest to keep it clean. The nestlings stay in the nest for about 20 days. When they are handled by humans they tend to leave the nest at least a day too early. The parents continue to care for the chicks for up to a week after they leave the nest. They feed them and lead them back to the nest at night to sleep. By two weeks after they have fledged from the nest, the chicks have left the area. They often travel quite far, visiting other barn swallow colonies. Young barn swallows are able to breed in spring after they hatch. Young barn swallows generally do not lay as many eggs as older birds.

Breeding interval: Barn Swallows usually produce 2 clutches per season, breeding seasons occur once each year.

Breeding season: Barn Swallows breed from May to August.

Range eggs per season: 3 to 7.

Range time to hatching: 13 to 15 days.

Average fledging age: 20.50 days.

Range time to independence: 2 (high) weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

In North America, both barn swallow parents incubate the eggs and feed the nestlings. However, females provide more parental care than males. During the nestling period, barn swallow parents may feed their chicks up to 400 times per day. Barn swallows feed their chicks a compressed pellet of insects that they carry in their throat.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents

  • Bolzern, A., A. Moller, N. Saino. 1997. Immunocompetence, ornamentation, and viability of male Barn Swallows. Proceedings of the National Academy of Sciences, 94: 54-552.
  • De Lope, F., A. Moller. 1993. Female reproductive effort depends on the degree of ornamentation. Evolution, 47: 1152-1161.
  • McWilliams, G. 2000. The Birds of Pennsylvania. New York: Cornell University Press.
  • Moller, A. 1994. Male ornament size as a reliable cue to enhanced offspring viability. Proceedings of the National Academy of Sciences, 91: 6929-6932.
  • Moller, A. 1994. Patterns of fluctuating asymmetry and selection against asymmetry. Evolution, 48: 658-671.
  • Moller, A. 1993. Sexual selection in the Barn Swallow *Hirundo rustica*: female tail ornaments. Evolution, 47: 417-432.
  • Perrins, C. 1989. Encyclopedia of Birds. England: Equinox Ltd..
  • Terres, J. 1980. The Audubon Society Encyclopedia of North American Birds. New York: Alfred A. Knopf, Inc.
  • Brown, C., B. Brown. 1999. Barn swallow (Hirundo_rustica). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 452. Philadelphia, PA: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barn swallows are socially monogamous. However, extra-pair copulations are common, making this species genetically polygamous. Breeding pairs form each spring after arrival on the breeding grounds. Pairs re-form each spring, though pairs that have nested together successfully may mate together for several years. Males try to attract females by spreading their tails to display them and singing.

Several studies have researched sexual selection in barn swallows. Moller (1994) documented female barn swallows selecting for symmetrical wings and tails in potential mates. Males exhibiting greater symmetry acquired mates more quickly than did asymmetric males. Asymmetry can result from genetic factors such as inbreeding or mutations as well as from environmental stress such as food deficiency, parasite infestation, or the presence of pathogens. Moller observed that individuals affected by these factors not only exhibited asymmetry, but also decreased strength and longevity. Therefor, females that selected symmetrical mates would presumably be selecting superior mates. In addition to selecting for symmetry, females also tend to select males with longer tail feathers. Moller observed a connection between the tail length of male barn swallows and their offspring’s vitality and longevity. Males with longer tail feathers exhibit traits of greater longevity which is passed on to their offspring. Females thus gain an indirect fitness benefit from this form of selection, as longer tail feathers indicate a genetically stronger individual who will produce offspring with enhanced vitality. Individuals with longer tails have also been observed to demonstrate greater disease resistance than their short-tailed counterparts. There is also evidence that males select female mates with long tails.

Unmated adults often associate with a breeding pair for up to an entire season. Though these "helpers" do not usually feed the young, they may help with nest defense, nest building, incubation and brooding. "Helpers" are predominantly male, and may succeed in mating with the resident female, leading to polygyny.

Mating System: monogamous ; polygynandrous (promiscuous) ; cooperative breeder

Barn swallows usually breed between May and August, but this varies greatly with location. They usually raise two broods of chicks each summer. Both birds of a pair make the nest. They build the shell of mud, and line it with grass and feathers. The female lays 3 to 7 eggs (average 5). Both parents incubate the eggs, which hatch in 13 to 15 days. The chicks are naked and helpless when they hatch. Both parents feed and protect the chicks, as well as removing fecal sacs from the nest. The nestlings remain in the nest for about 20 days before fledging. When barn swallows are handled by humans they tend to attempt to fledge at least a day too early. The parents continue to care for the chicks for up to a week after fledging, feeding them and leading them back to the nest to sleep. By two weeks after fledging, the barn swallow chicks have dispersed and often travel widely to other barn swallow colonies. Young barn swallows are able to breed in the first breeding season after they have hatched. Generally, young barn swallows do not produce as many eggs as do older birds.

Breeding interval: Barn Swallows usually produce 2 clutches per season, breeding seasons occur once each year.

Breeding season: Barn Swallows breed from May to August.

Range eggs per season: 3 to 7.

Range time to hatching: 13 to 15 days.

Average fledging age: 20.50 days.

Range time to independence: 2 (high) weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

In North America, both barn swallow parents incubate the eggs and feed the nestlings. However, females provide more parental care than do males. During the nestling period, barn swallow parents may feed their nestlings up to 400 times per day. Barn swallows feed their chicks insects compressed into a pellet, which is transported to the nest in the parent’s throat. Although all swallows are socially monogamous, barn swallows differ from most swallow species in the sharing of parental care. Juveniles from the first brood of the season have even been observed assisting their parents in feeding a second brood.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents

  • Bolzern, A., A. Moller, N. Saino. 1997. Immunocompetence, ornamentation, and viability of male Barn Swallows. Proceedings of the National Academy of Sciences, 94: 54-552.
  • De Lope, F., A. Moller. 1993. Female reproductive effort depends on the degree of ornamentation. Evolution, 47: 1152-1161.
  • McWilliams, G. 2000. The Birds of Pennsylvania. New York: Cornell University Press.
  • Moller, A. 1994. Male ornament size as a reliable cue to enhanced offspring viability. Proceedings of the National Academy of Sciences, 91: 6929-6932.
  • Moller, A. 1994. Patterns of fluctuating asymmetry and selection against asymmetry. Evolution, 48: 658-671.
  • Moller, A. 1993. Sexual selection in the Barn Swallow *Hirundo rustica*: female tail ornaments. Evolution, 47: 417-432.
  • Perrins, C. 1989. Encyclopedia of Birds. England: Equinox Ltd..
  • Terres, J. 1980. The Audubon Society Encyclopedia of North American Birds. New York: Alfred A. Knopf, Inc.
  • Brown, C., B. Brown. 1999. Barn swallow (Hirundo rustica). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 452. Philadelphia, PA: The Birds of North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size is usually 4-5. Incubation lasts 13-17 days (less often 11-19 days), mainly or totally (e.g., in Europe) by female. Often 2 broods, except in far north. Young are tended by both adults, fledge at 18-23 days, stay together and are fed by parents for about a week. Females first breed at 1 year, a few males remain unpaired until 2 years old. Adults often have same mate in successive years (Shields 1984). Juveniles may help feed young of second brood.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hirundo rustica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 23 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATACTTAATCTTCGGCGCATGAGCCGGCATGGTAGGTACCTCCCTC---AGTCTCCTAATCCGAGCAGAATTAGGCCAACCCGGCGCCCTGCTCGGAGAT---GACCAAATCTACAATGTGGTAGTTACAGCCCACGCTTTCGTAATAATCTTCTTCATAGTTATGCCAATTATGATCGGAGGATTCGGAAACTGACTAGTTCCCCTAATA---ATCGGCGCCCCCGACATAGCATTCCCACGAATGAACAACATAAGCTTCTGACTACTTCCCCCATCATTCCTTCTCCTCCTAGCCTCATCCACGGTAGAAGCAGGAGTAGGTACTGGATGGACCGTATACCCGCCCCTAGCCGGAAACCTAGCACACGCAGGGGCCTCTGTAGACCTG---GCCATTTTCTCCCTACATCTAGCAGGAATTTCCTCAATCCTAGGTGCAATTAACTTTATCACTACAGCAATCAACATAAAACCCCCAGCTCTATCGCAGTACCAAACACCACTATTCGTTTGATCAGTATTAATCACCGCAGTTCTTCTTCTCCTGTCATTACCCGTACTAGCCGCT---GGCATCACAATGCTACTTACAGACCGCAACCTAAACACTACCTTCTTCGATCCGGCTGGAGGAGGAGACCCAGTACTTTACCAACACCTATTCTGGTTCTTCGGTCACCCAGAAGTTTACATTCTAATTCTACCAGGATTTGGAATTATCTCCCAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hirundo rustica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 50
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

In the past, barn swallows have benefited from human changes to natural landscapes. As humans destroyed vast areas of forest to convert to farmland, they created large areas of new habitat for swallows. Now, as farming is becoming more modernized, barn swallows may be becoming less abundant. Barns and hay lofts are now becoming enclosed, resulting in fewer places for barn swallows to build their nests. However, barn swallows continue to be widespread and common throughout their range. There are about 190,000,000 barn swallows in the world.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barn swallow populations are generally considered to be stable and sufficiently extensive. However, declines in the amount of acreage devoted to agriculture in recent years have resulted in reduced barn swallow numbers. This can be attributed to a reduction in habitat as the barns and outbuildings which once housed barn swallows, give way to more urban settings. Another contributing factor is the reduction in food supply. Insects attracted by the presence of livestock and the ideal surrounding habitat are the primary food source for barn swallows living in agricultural areas. Locations where farming has ceased exhibit a 50% reduction in insect populations.

Barn swallows continue to be widespread and common throughout their range. There are an estimated 190,000,000 individuals worldwide.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident breeder, regular passage visitor, non-breeding summer visitor and winter visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Range expanded in the southeastern U.S. in the middle part of the 1900s (NGS 1983), and North American Breeding Bird Survey (BBS) data indicated a significant population increase surveywide of 3.8% annually from 1966 through 1979. But in the years following (1980-1999), the same source showed a significant annual surveywide decline of -1.9% (Droege et al. 2000). The decline is most extreme in the north: Canada had a significant decline of -4.1% annually 1980-1999, and other significant declines greater than -4% per year were registered in the following BBS regions: Adirondacks, Northern New England, Northern Spruce Hardwoods, Central Rockies, and Northern Pacific Rainforests. The only region showing any significant increases was the southeast: Mississippi had an annual increase of 2.8% and Georgia showed an increase of 4.1% (Droege et al. 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: See Turner and Rose 1989 for comments on status in Old World. In general, has benefited from presence of humans and their structures. Small numbers inadvertently killed by intentional spraying of Dickcissel (Spiza americana) roosts in Venezuela in non-breeding season (Basili and Temple 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: See Mitchell (1988) for specifications for the construction and placement of nest shelves. See Winkler and McCarty (1990) for information on a method for transplanting nestlings from one site to another.

Biological Research Needs: Need to resolve the systematics of this species and its genus. Studies on sexual selection in North American race would be valuable (Brown and Brown 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Some humans feel that barn swallow nests are a nuisance, and are ugly when they are attached to buildings and other man-made structures. Large colonies in urban areas can also create heath risks for humans. Finally, the disease called salmonella can be transmitted through the feces of barn swallows. This poses a threat to animals that live near barn swallow colonies.

Negative Impacts: causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Barn swallows helps farmers get rid of insect pests that would affect them, their livestock, and their crops. They are a welcome insect predator on most farms.

Positive Impacts: controls pest population

  • Moore, P. 2001. Dairy declines hard to swallow. Nature, 411: 904-905.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Some humans feel that barn swallow nests are a nuisance, and are unsightly when they are attached to buildings and other man-made structures. Large colonies in urban areas can also create detrimental cleanliness and health issues for humans. Finally, salmonella can be transmitted through their feces, posing a threat to livestock that live in close proximity to barn swallow colonies.

Negative Impacts: causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Barn swallows are quite effective in reducing insect pest populations. They also can serve as an indicator or trigger organism, indicating possible environmental trouble, as declines in their relatively abundant numbers may precede other more obvious effects of environmental stress.

Positive Impacts: controls pest population

  • Moore, P. 2001. Dairy declines hard to swallow. Nature, 411: 904-905.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Barn Swallow

The Barn Swallow (Hirundo rustica) is the most widespread species of swallow in the world.[2] It is a distinctive passerine bird with blue upperparts, a long, deeply forked tail and curved, pointed wings. It is found in Europe, Asia, Africa and the Americas.[2] In Anglophone Europe it is just called the Swallow; in Northern Europe it is the only common species called a "swallow" rather than a "martin".[3]

There are six subspecies of Barn Swallow, which breed across the Northern Hemisphere. Four are strongly migratory, and their wintering grounds cover much of the Southern Hemisphere as far south as central Argentina, the Cape Province of South Africa, and northern Australia.[2] Its huge range means that the Barn Swallow is not endangered, although there may be local population declines due to specific threats.

The Barn Swallow is a bird of open country which normally uses man-made structures to breed and consequently has spread with human expansion. It builds a cup nest from mud pellets in barns or similar structures and feeds on insects caught in flight.[4] This species lives in close association with humans, and its insect-eating habits mean that it is tolerated by man; this acceptance was reinforced in the past by superstitions regarding the bird and its nest. There are frequent cultural references to the Barn Swallow in literary and religious works due to both its living in close proximity to humans and its annual migration.[5] The Barn Swallow is the national bird of Austria and Estonia.

Contents

Description[edit]

H. r. rustica in England

The adult male Barn Swallow of the nominate subspecies H. r. rustica is 17–19 cm (6.7–7.5 in) long including 2–7 cm (0.79–2.8 in) of elongated outer tail feathers. It has a wingspan of 32–34.5 cm (13–13.6 in) and weighs 16–22 g (0.56–0.78 oz). It has steel blue upperparts and a rufous forehead, chin and throat, which are separated from the off-white underparts by a broad dark blue breast band. The outer tail feathers are elongated, giving the distinctive deeply forked "swallow tail." There is a line of white spots across the outer end of the upper tail.[4] The female is similar in appearance to the male, but the tail streamers are shorter, the blue of the upperparts and breast band is less glossy, and the underparts paler. The juvenile is browner and has a paler rufous face and whiter underparts. It also lacks the long tail streamers of the adult.[2]

The song of the Barn Swallow is a cheerful warble, often ending with su-seer with the second note higher than the first but falling in pitch. Calls include witt or witt-witt and a loud splee-plink when excited (or trying to chase intruders away from the nest).[4] The alarm calls include a sharp siflitt for predators like cats and a flitt-flitt for birds of prey like the Hobby.[6] This species is fairly quiet on the wintering grounds.[7]

The distinctive combination of a red face and blue breast band render the adult Barn Swallow easy to distinguish from the African Hirundo species and from the Welcome Swallow (Hirundo neoxena) with which its range overlaps in Australasia.[2] In Africa the short tail streamers of the juvenile Barn Swallow invite confusion with juvenile Red-chested Swallow (Hirundo lucida), but the latter has a narrower breast band and more white in the tail.[8]

Taxonomy[edit]

The Barn Swallow was described by Linnaeus in his Systema Naturae in 1758 as Hirundo rustica, characterised as H. rectricibus, exceptis duabus intermediis, macula alba notatîs.[9] Hirundo is the Latin word for "swallow"; rusticus means "of the country."[10] This species is the only one of that genus to have a range extending into the Americas, with the majority of Hirundo species being native to Africa. This genus of blue-backed swallows is sometimes called the "barn swallows."[2][3]

The Oxford English Dictionary dates the English common name "barn swallow" to 1851, though an earlier instance of the collocation in an English-language context is in Gilbert White's popular book The Natural History of Selborne, originally published in 1789:

The swallow, though called the chimney-swallow, by no means builds altogether in chimnies [sic], but often within barns and out-houses against the rafters... In Sweden she builds in barns, and is called ladu swala, the barn-swallow.[11]

This suggests that the English name may be a calque on the Swedish term.

There are few taxonomic problems within the genus, but the Red-chested Swallow—a resident of West Africa, the Congo basin and Ethiopia—was formerly treated as a subspecies of Barn Swallow. The Red-chested Swallow is slightly smaller than its migratory relative, has a narrower blue breast-band, and the adult has shorter tail streamers. In flight, it looks paler underneath than Barn Swallow.[8]

Subspecies[edit]

Video clip of European Barn Swallow in Lindisfarne, England

Six subspecies of Barn Swallow are generally recognized. In eastern Asia, a number of additional or alternative forms have been proposed, including saturata by Robert Ridgway in 1883,[12] kamtschatica by Benedykt Dybowski in 1883,[13] ambigua by Erwin Stresemann[14] and mandschurica by Wilhelm Meise in 1934.[12] Given the uncertainties over the validity of these forms,[13][15] this article follows the treatment of Turner and Rose.[2]

  • H. r. rustica, the nominate European subspecies, breeds in Europe and Asia, as far north as the Arctic Circle, south to North Africa, the Middle East and Sikkim, and east to the Yenisei River. It migrates on a broad front to winter in Africa, Arabia, and the Indian subcontinent.[2] The Barn Swallows wintering in southern Africa are from across Eurasia to at least 91°E,[16] and have been recorded as covering up to 11,660 kilometres (7,250 mi) on their annual migration.[17]
  • H. r. transitiva was described by Ernst Hartert in 1910. It breeds in the Middle East from southern Turkey to Israel and is partially resident, though some birds winter in East Africa. It has orange red underparts and a broken breast band.[2]
H. r. gutturalis in Japan
  • H. r. gutturalis, described by Giovanni Antonio Scopoli in 1786,[12] has whitish underparts and a broken breast band. Breast chestnut and lower underparts more pink-buff.[19] The populations that breed in the central and eastern Himalayas have been included in this subspecies,[20] although the primary breeding range is Japan and Korea. The east Asian breeders winter across tropical Asia from India and Sri Lanka[21] east to Indonesia and New Guinea. Increasing numbers are wintering in Australia. It hybridises with H. r. tytleri in the Amur River area. It is thought that the two eastern Asia forms were once geographically separate, but the nest sites provided by expanding human habitation allowed the ranges to overlap.[2] H. r. gutturalis is a vagrant to Alaska and Washington,[22] but is easily distinguished from the North American breeding subspecies, H. r. erythrogaster, by the latter's reddish underparts.[2]
H. r. erythrogaster in Washington State, USA
  • The North American subspecies H. r. erythrogaster, described by Pieter Boddaert in 1783,[12] differs from the European subspecies in having redder underparts and a narrower, often incomplete, blue breast band. It breeds throughout North America, from Alaska to southern Mexico, and migrates to the Lesser Antilles, Costa Rica, Panama and South America to winter.[7] A few may winter in the southernmost parts of the breeding range. This subspecies funnels through Central America on a narrow front and is therefore abundant on passage in the lowlands of both coasts.[23]

Unexpectedly, DNA analyses show that Barn Swallows from North America colonised the Baikal region of Siberia, a dispersal direction opposite to that for most changes in distribution between North America and Eurasia.[24]

Behaviour[edit]

Habitat and range[edit]

In flight as seen from below

The preferred habitat of the Barn Swallow is open country with low vegetation, such as pasture, meadows and farmland, preferably with nearby water. This swallow avoids heavily wooded or precipitous areas and densely built-up locations. The presence of accessible open structures such as barns, stables, or culverts to provide nesting sites, and exposed locations such as wires, roof ridges or bare branches for perching, are also important in the bird's selection of its breeding range.[4]

It breeds in the Northern Hemisphere from sea level to typically 2,700 metres (8,900 feet),[25] but to 3,000 metres (9,800 feet) in the Caucasus[4] and North America,[26] and it is absent only from deserts and the cold northernmost parts of the continents. Over much of its range, it avoids towns, and in Europe is replaced in urban areas by the House Martin. However, in Honshū, the Barn Swallow is a more urban bird, with the Red-rumped Swallow (Cecropis daurica) replacing it as the rural species.[2]

In winter, the Barn Swallow is cosmopolitan in its choice of habitat, avoiding only dense forests and deserts.[27] It is most common in open, low vegetation habitats, such as savanna and ranch land, and in Venezuela, South Africa and Trinidad and Tobago it is described as being particularly attracted to burnt or harvested sugarcane fields and the waste from the cane.[7][28][29] In the absence of suitable roost sites, they may sometimes roost on wires where they are more exposed to predators.[30] Individual birds tend to return to the same wintering locality each year[31] and congregate from a large area to roost in reed beds.[28] These roosts can be extremely large, one in Nigeria had an estimated 1.5 million birds.[32] These roosts are thought to be a protection from predators, and the arrival of roosting birds is synchronised in order to overwhelm predators like African Hobbies. The Barn Swallow has been recorded as breeding in the more temperate parts of its winter range, such as the mountains of Thailand and in central Argentina.[2][33]

Migration of Barn Swallows between Britain and South Africa was first established on 23 December 1912 when a bird that had been ringed by James Masefield at a nest in Staffordshire, was found in Natal.[34] As would be expected for a long-distance migrant, this bird has occurred as a vagrant to such distant areas as Hawaii, Bermuda, Greenland, Tristan da Cunha and the Falkland Islands.[2]

Feeding[edit]

Flying low over water in Spain

The Barn Swallow is similar in its habits to other aerial insectivores, including other swallow species and the unrelated swifts. It is not a particularly fast flier, with a speed estimated at about 11 m/s, up to 20 m/s and a wing beat rate of approximately 5, up to 7–9 times each second,[35][36] but it has the manoeuvrability necessary to feed on flying insects while airborne. It is often seen flying relatively low in open or semi-open areas.

The Barn Swallow typically feeds 7–8 metres (23–26 ft) above shallow water or the ground, often following animals, humans or farm machinery to catch disturbed insects, but it will occasionally pick prey items from the water surface, walls and plants. In the breeding areas, large flies make up around 70% of the diet, with aphids also a significant component. However, in Europe, the Barn Swallow consumes fewer aphids than the House or Sand Martins.[4] On the wintering grounds, Hymenoptera, especially flying ants, are important food items. When egg-laying, Barn Swallows hunt in pairs, but will form often large flocks otherwise.[2]

Isotope studies have shown that wintering populations may utilise different feeding habitats, with British breeders feeding mostly over grassland, whereas Swiss birds utilised woodland more.[37] Another study showed that a single population breeding in Denmark actually wintered in two separate and different areas.[38]

The Barn Swallow drinks by skimming low over lakes or rivers and scooping up water with its open mouth.[26] This bird bathes in a similar fashion, dipping into the water for an instant while in flight.[31]

Swallows gather in communal roosts after breeding, sometimes thousands strong. Reed beds are regularly favoured, with the birds swirling en masse before swooping low over the reeds.[6] Reed beds are an important source of food prior to and whilst on migration; although the Barn Swallow is a diurnal migrant which can feed on the wing whilst it travels low over ground or water, the reed beds enable fat deposits to be established or replenished.[39]

Breeding[edit]

CríasHirundorustica.JPG
Juvenile in England

The male Barn Swallow returns to the breeding grounds before the females and selects a nest site, which is then advertised to females with a circling flight and song. The breeding success of the male is related to the length of the tail streamers, with longer streamers being more attractive to the female.[4][40] Males with longer tail feathers are generally longer-lived and more disease resistant, females thus gaining an indirect fitness benefit from this form of selection, since longer tail feathers indicate a genetically stronger individual which will produce offspring with enhanced vitality.[41] Males in northern Europe have longer tails than those further south; whereas in Spain the male's tail streamers are only 5% longer than the female's, in Finland the difference is 20%. In Denmark, the average male tail length increased by 9% between 1984 and 2004, but it is possible that climatic changes may lead in the future to shorter tails if summers become hot and dry.[42]

Males with long streamers also have larger white tail spots, and since feather-eating bird lice prefer white feathers, large white tail spots without parasite damage again demonstrate breeding quality; there is a positive association between spot size and the number of offspring produced each season.[43]

Both sexes defend the nest, but the male is particularly aggressive and territorial.[2] Once established, pairs stay together to breed for life, but extra-pair copulation is common, making this species genetically polygamous, despite being socially monogamous.[44] Males guard females actively to avoid being cuckolded.[45] Males may use deceptive alarm calls to disrupt extrapair copulation attempts toward their mates.[46]

As its name implies, the Barn Swallow typically nests inside accessible buildings such as barns and stables, or under bridges and wharves. The neat cup-shaped nest is placed on a beam or against a suitable vertical projection. It is constructed by both sexes, although more often by the female, with mud pellets collected in their beaks and lined with grasses, feathers, algae[47] or other soft materials.[2] Barn Swallows may nest colonially where sufficient high-quality nest sites are available, and within a colony, each pair defends a territory around the nest which, for the European subspecies, is four to eight square metres (45 to 90 square feet) in size. Colony size tends to be larger in North America.[26]

In North America at least, Barn Swallows frequently engage in a mutualist relationship with Ospreys. Barn Swallows will build their nest below an Osprey nest, receiving protection from other birds of prey which are repelled by the exclusively fish-eating Ospreys. The Ospreys are alerted to the presence of these predators by the alarm calls of the swallows.[26]

Before man-made sites became common, the Barn Swallow nested on cliff faces or in caves, but this is now rare. The female lays two to seven, but typically four or five, reddish-spotted white eggs. The eggs are 20 x 14 millimetres (0.6 x 0.8 in) in size, and weigh 1.9 grammes (0.07 oz), of which 5 percent is shell. In Europe, the female does almost all the incubation, but in North America the male may incubate up to 25% of the time. The incubation period is normally 14–19 days, with another 18–23 days before the altricial chicks fledge. The fledged young stay with, and are fed by, the parents for about a week after leaving the nest. Occasionally, first-year birds from the first brood will assist in feeding the second brood.[2]

The Barn Swallow will mob intruders such as cats or accipiters that venture too close to their nest, often flying very close to the threat.[41] Adult Barn Swallows have few predators, but some are taken by accipiters, falcons, and owls. Brood parasitism by cowbirds in North America or cuckoos in Eurasia is rare.[4][26]

There are normally two broods, with the original nest being reused for the second brood and being repaired and reused in subsequent years. Hatching success is 90% and the fledging survival rate is 70–90%. Average mortality is 70–80% in the first year and 40–70% for the adult. Although the record age is more than 11 years, most survive less than four years.[2] Barn Swallow nestlings have prominent red gapes, a feature shown to induce feeding by parent birds. An experiment in manipulating brood size and immune system showed the vividness of the gape was positively correlated with T-cell–mediated immunocompetence, and that larger brood size and injection with an antigen led to a less vivid gape.[48]

The Barn Swallow has been recorded as hybridising with the Cliff Swallow (Petrochelidon pyrrhonota) and the Cave Swallow (P. fulva) in North America, and the House Martin (Delichon urbicum) in Eurasia, the cross with the latter being one of the most common passerine hybrids.[41]

Parasites and predators[edit]

A feeding trace of Brueelia lice on the tail feather of a Barn Swallow

Barn Swallows (and other small passerines) often have characteristic feather holes on their wing and tail feathers. These holes were suggested as being caused by avian lice such as Machaerilaemus malleus and Myrsidea rustica, although other studies suggest that they are mainly caused by species of Brueelia. Several other species of lice have been described from Barn Swallow hosts, including Brueelia domestica and Philopterus microsomaticus.[49][50] In Texas, the swallow bug (Oeciacus vicarius) which is common on species such as the Cliff Swallow is also known to infest Barn Swallows.[51]

Predatory bats such as the Greater False Vampire Bat are known to prey on Barn Swallows.[52] Swallows at their communal roosts attract predators and several falcon species make use of these opportunities. Falcon species confirmed as predators include the Peregrine Falcon[53] and the African Hobby.[32]

Status[edit]

The Barn Swallow has an enormous range, with an estimated global extent of 51.7 million square kilometres (19.96 million square miles) and a population of 190 million individuals. Although global population trends have not been quantified, the species is not believed to approach the thresholds for the population decline criterion of the IUCN Red List (that is, declining more than 30 percent in ten years or three generations). For these reasons, the species is evaluated as "least concern" on the 2007 IUCN Red List,[1] and has no special status under the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES), which regulates international trade in specimens of wild animals and plants.[26]

This is a species which has greatly benefited historically from forest clearance, which has created the open habitats it prefers, and from human habitation, which have given it an abundance of safe man-made nest sites. There have been local declines due to the use of DDT in Israel in the 1950s, competition for nest sites with House Sparrows in the US in the 19th century, and an ongoing gradual decline in numbers in parts of Europe and Asia due to agricultural intensification, reducing the availability of insect food. However, there has been an increase in the population in North America during the 20th century with the greater availability of nesting sites and subsequent range expansion, including the colonisation of northern Alberta.[2]

A specific threat to wintering birds from the European populations is the transformation by the South African government of a light aircraft runway near Durban into an international airport for the 2010 FIFA World Cup. The roughly 250 metres (270 yards) square Mount Moreland reed bed is a night roost for more than three million Barn Swallows, which represent one percent of the global population and eight percent of the European breeding population. The reed bed lies on the flight path of aircraft using the proposed La Mercy airport, and there were fears that it would be cleared because the birds could threaten aircraft safety.[54][55] However, following detailed evaluation, advanced radar technology will be installed to enable planes using the airport to be warned of bird movements and, if necessary, take appropriate measures to avoid the flocks.[28]

Climate change may affect the Barn Swallow; drought causes weight loss and slow feather regrowth, and the expansion of the Sahara will make it a more formidable obstacle for migrating European birds. Hot dry summers will reduce the availability of insect food for chicks. Conversely, warmer springs may lengthen the breeding season and result in more chicks, and the opportunity to use nest sites outside buildings in the north of the range might also lead to more offspring.[42]

Relationship with humans[edit]

A male

The Barn Swallow is an attractive bird which feeds on flying insects and has therefore been tolerated by humans when it shares their buildings for nesting. As one of the earlier migrants, this conspicuous species is also seen as an early sign of summer's approach.[56]

In the Old World, the Barn Swallow appears to have used man-made structures and bridges since time immemorial. An early reference is in Virgil's Georgics (29 BC) ...garrula quam tignis nidum suspendat hirundo (...the twittering swallow hangs its nest from the rafters).[57]

It is believed that the Barn Swallow began attaching its nest to Native American habitations in the early 19th century, and the subsequent spread of settlement across North America is thought to have resulted in a dramatic population expansion of the species across the continent.[24]

Many cattle farmers believed that swallows spread Salmonella infections, however a study in Sweden showed no evidence of the birds being reservoirs of the bacteria.[58]

In literature[edit]

Many literary references are based on the Barn Swallow's northward migration as a symbol of spring or summer. The proverb about the necessity for more than one piece of evidence goes back at least to Aristotle's Nicomachean Ethics: "For as one swallow or one day does not make a spring, so one day or a short time does not make a fortunate or happy man."[56]

The Barn Swallow symbolizes the coming of spring and thus love in the Pervigilium Veneris, a late Latin poem. In "The Waste Land", T. S. Eliot quoted the line "Quando fiam uti chelidon [ut tacere desinam]?" ("When will I be like the swallow, so that I can stop being silent?") This refers to a version of the myth of Philomela in which she turns into a Nightingale and her sister Procne into a Swallow; in less familiar versions, the two species are reversed.[59] On the other hand, an image of the assembly of Swallows for their southward migration concludes John Keats's ode "To Autumn".

There are mentions of the Barn Swallow in the Bible, although it seems likely that it is confused with the swifts in many translations,[60] or possibly other hirundine species which breed in Israel.[6] However, "Yea, the sparrow hath found her a house, And the swallow a nest for herself, where she may lay her young" from Psalms 84:3 likely applies to the Barn Swallow.[60]

The swallow is also notably cited in several of William Shakespeare's plays for the swiftness of its flight; for example: "True hope is swift, and flies with swallow's wings ..." from Act 5 of Richard III, and "I have horse will follow where the game Makes way, and run like swallows o'er the plain." from the second act of Titus Andronicus. Shakespeare also references the annual migration of the species poetically in The Winter's Tale, Act 4: "Daffodils, That come before the swallow dares, and take The winds of March with beauty; violets dim, ...".

In culture[edit]

Gilbert White studied the Barn Swallow in detail in his pioneering work The Natural History of Selborne, but even this careful observer was uncertain whether it migrated or hibernated in winter.[11] Elsewhere, its long journeys have been well observed, and a swallow tattoo is popular amongst nautical men as a symbol of a safe return; the tradition was that a mariner had a tattoo of this fellow wanderer after sailing 5,000 nautical miles (9,260 km, 5,755 statute miles). A second swallow would be added after 10,000 nautical miles (18,520 km, 11,510 statute miles) at sea.[61] In the past, the tolerance for this beneficial insectivore was reinforced by superstitions regarding damage to the Barn Swallow's nest. Such an act might lead to cows giving bloody milk, or no milk at all, or to hens ceasing to lay.[5] This may be a factor in the longevity of swallows' nests. Survival, with suitable annual refurbishment, for 10–15 years is regular, and one nest was reported to have been occupied for 48 years.[5]

It is depicted as the Martlet, Merlette or Merlot in heraldry, where it represents younger sons who have no lands. It is also represented as lacking feet as this was a common belief at the time.[62] As a result of a campaign by ornithologists, the Barn Swallow has been the national bird of Estonia since 23 June 1960.[63][64]

See also[edit]

References[edit]

  1. ^ a b BirdLife International (2012). "Hirundo rustica". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b c d e f g h i j k l m n o p q r s t u Turner, Angela K; Rose, Chris (1989). Swallows & martins: an identification guide and handbook. Boston: Houghton Mifflin. ISBN 0-395-51174-7.  p164–169
  3. ^ a b See Gill, Frank, and Wright, Minturn, Birds of the World: Recommended English Names (Princeton 2006), ISBN 978-0-691-12827-6
  4. ^ a b c d e f g h Snow, David; Perrins, Christopher M (editors) (1998). The Birds of the Western Palearctic concise edition (2 volumes). Oxford: Oxford University Press. ISBN 0-19-854099-X.  p1061–1064
  5. ^ a b c Cocker, Mark; Mabey, Richard (2005). Birds Britannica. London: Chatto & Windus. ISBN 0-7011-6907-9. 
  6. ^ a b c d Mullarney, Killian; Svensson, Lars; Zetterstrom, Dan; Grant, Peter (1999). Collins Bird Guide. London: HarperCollins. ISBN 0-00-219728-6.  p242
  7. ^ a b c Hilty, Steven L (2003). Birds of Venezuela. London: Christopher Helm. ISBN 0-7136-6418-5.  p691
  8. ^ a b Barlow, Clive; Wacher, Tim; Disley, Tony (1997). A Field Guide to birds of The Gambia and Senegal. Robertsbridge: Pica Press. ISBN 1-873403-32-1.  p279
  9. ^ (Latin) Linnaeus, Carolus (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 191. 
  10. ^ Lewis, Charlton T (1888). A Latin dictionary for schools. Harper & Brothers. ISBN 0-19-910204-X. 
  11. ^ a b White, Gilbert (1789). The Natural History and Antiquities of Selborne. London: T. Bensley. pp. 167–68. ISBN 0-905418-96-4. 
  12. ^ a b c d e Dickinson, Edward C.; Eck, Siegfried; Christopher M. Milensky (2002). "Systematic notes on Asian birds. 31. Eastern races of the barn swallow Hirundo rustica Linnaeus, 1758". Zoologische Verhandelingen, Leiden 340: 201–203. ISSN 0024-1652. Retrieved 17 November 2007. 
  13. ^ a b Dickinson, Edward C.; René Dekker (2001). "Systematic notes on Asian birds. 13. A preliminary review of the Hirundinidae". Zoologische Verhandelingen, Leiden 335: 127–144. ISSN 0024-1652. Retrieved 17 November 2007. 
  14. ^ Stresemann, E (1940). "Welche Rasse von Hirundo rustica bretet in Sikkim?". Ornithologischen Monatsbericht (in German) 48 (3): 88–89. 
  15. ^ Vaurie, Charles (1951). "Notes on some Asiatic swallows". American Museum Novitates 1529: 1–47. 
  16. ^ "European Swallow Hirundo rustica". SAFRING results. Avian Demography Unit, Department of Statistical Sciences, University of Cape Town. Archived from the original on 11 December 2007. Retrieved 1 December 2007. 
  17. ^ "Bird ringing across the world". EURING Newsletter — Volume 1, November 1996. Euring. Archived from the original on 3 December 2007. Retrieved 1 December 2007. 
  18. ^ Dekker, René (2003). "Type specimens of birds. Part 2.". NNM Technical Bulletin 6: 20. Retrieved 24 November 2001. 
  19. ^ a b Rasmussen, Pamela C. & John C. Anderton (2005). Birds of South Asia: The Ripley Guide. Smithsonian Institution and Lynx Edicions. ISBN 84-87334-67-9. 
  20. ^ Whistler, H (1937). "The breeding Swallow of the Western Himalayas". Ibis 79 (2): 413–415. 
  21. ^ Whistler, H (1940). "The Common Swallow Hirundo rustica rustica in Ceylon". Ibis 82 (3): 539. 
  22. ^ Sibley, David (2000). The North American Bird Guide. Pica Press. ISBN 1-873403-98-4. 
  23. ^ Stiles, Gary; Skutch, Alexander (2003). A guide to the Birds of Costa Rica. Ithaca, New York: Cornell University Press. ISBN 0-8014-2287-6.  p343
  24. ^ a b Williams, Nigel (April 2006). "Swallows track human moves". Current Biology 16 (7): R231. doi:10.1016/j.cub.2006.03.031. PMID 16927457. 
  25. ^ "BirdLife International Species factsheet: Hirundo rustica". BirdLife International. Retrieved 6 December 2007. 
  26. ^ a b c d e f Dewey, Tanya; Roth, Chava (2002). "Hirundo rustica". Animal Diversity Web. University of Michigan Museum of Zoology. Archived from the original on 10 December 2007. Retrieved 19 November 2007. 
  27. ^ Sinclair, Ian; Hockey, Phil; Tarboton, Warwick (2002). SASOL Birds of Southern Africa. Cape Town: Struik. ISBN 1-86872-721-1.  p294
  28. ^ a b c Froneman, Albert; Bortle, Jon; Merritt, Ron (April 2007). "Draft swallow monitoring and bird aircraft interaction" (pdf). Environmental Impact Assessment Report (Dube TradePort Environmental Impact Assessment Information Center). Archived from the original on 16 February 2008. Retrieved 29 November 2007. 
  29. ^ ffrench, Richard (1991). A Guide to the Birds of Trinidad and Tobago (2nd ed.). Ithaca, New York: Comstock Publishing. ISBN 0-8014-9792-2.  p315–6
  30. ^ George,PV (1965). "Swallows Hirundo rustica Linnaeus roosting on wires". J. Bombay Nat. Hist. Soc. 62 (1): 160. 
  31. ^ a b Burton, Robert (1985). Bird behaviour. London: Granada. ISBN 0-246-12440-7. 
  32. ^ a b Bijlsma R.G. & van den Brink B. (2005). "A Barn Swallow Hirundo rustica roost under attack: timing and risks in the presence of African Hobbies Falco cuvieri" (pdf). Ardea 93 (1): 37–48. 
  33. ^ Lekagul, Boonsong; Round, Philip (1991). A Guide to the Birds of Thailand. Bangkok: Saha Karn Baet. ISBN 9789748567365.  p234
  34. ^ Wernham, Chris (editor) (2002). The Migration Atlas: Movements of the Birds of Britain and Ireland. T & AD Poyser. p. 462. ISBN 0-7136-6514-9. 
  35. ^ Liechti, Felix; Bruderer, Lukas (15 August 2002). "Wingbeat frequency of barn swallows and house martins: a comparison between free flight and wind tunnel experiments". The Journal of Experimental Biology (The Company of Biologists) 205 (16): 2461–2467. PMID 12124369. 
  36. ^ Park, Kirsty; Rosén, Mikael; Hedenström, Anders (2001). "Kinematics of the barn swallow (Hirundo rustica) over a wide range of speeds in a wind tunnel". The Journal of Experimental Biology 204 (15): 2741–2750. ISSN 0022-0949. PMID 11533124. Archived from the original on 9 November 2007. Retrieved 1 December 2007. 
  37. ^ Evans, K. L.; Wadron, S.; Bradbury, R. B. (2003). "Segregation in the African wintering grounds of English and Swiss Barn Swallows Hirundo rustica: a stable isotope study". Bird Study 50 (3): 294–299. doi:10.1080/00063650309461322. 
  38. ^ Møller, AP; Hobson, K A (2004). "Heterogeneity in stable isotope profiles predicts coexistence of populations of barn swallows Hirundo rustica differing in morphology and reproductive performance". Proceedings of the Royal Society of London 271 (1546): 1355–1362. doi:10.1098/rspb.2003.2565. ISSN 0962-8452. PMC 1691733. PMID 15306333. 
  39. ^ Pilastro, Andrea (December 1998). "The EURING Swallow Project in Italy". Euring Newsletter, Volume 2. Archived from the original on 3 December 2007. Retrieved 1 December 2007. 
  40. ^ Saino, Nicola; Romano, Maria; Sacchi; Roberto; Ninni, Paola; Galeotti, Paolo; Møller, Anders Pape (September 2003). "Do male barn swallows (Hirundo rustica) experience a trade-off between the expression of multiple sexual signals?". Behavioral Ecology and Sociobiology 54 (5): 465–471. doi:10.1007/s00265-003-0642-z. 
  41. ^ a b c Møller, Anders Pape (1994). Sexual Selection and the Barn Swallow. Oxford: Oxford University Press. p. 245. ISBN 0-19-854028-0. 
  42. ^ a b Turner, Angela (January 2009). "Climate change: a Swallow's eye view". British Birds 102 (1): 3–16. 
  43. ^ Kose, Mati; Mänd, Raivo: Møller, Anders Pape (December 1999). "Sexual selection for white tail spots in the barn swallow in relation to habitat choice by feather lice". Animal Behaviour 58 (6): 1201–1205. doi:10.1006/anbe.1999.1249. ISSN 0003-3472. PMID 10600140. 
  44. ^ Møller, Anders Pape; Tegelstrom, Håkan (November 1997). "Extra-pair paternity and tail ornamentation in the barn swallow". Behavioral Ecology and Sociobiology 41 (5): 353–360. doi:10.1007/s002650050395. 
  45. ^ Møller, Anders Pape (October 1985). "Mixed reproductive strategy and mate guarding in a semi-colonial passerine, the swallow Hirundo rustica". Behavioral Ecology and Sociobiology 17 (4): 401–408. doi:10.1007/BF00293220. 
  46. ^ Møller, Anders Pape (1990). "Deceptive use of alarm calls by male swallows, Hirundo rustica: a new paternity guard". Behavioral Ecology 1 (1): 1–6. doi:10.1093/beheco/1.1.1. 
  47. ^ Duffin, K. (1973). "Barn Swallows use freshwater and marine algae in nest construction". Wilson Bull. 85: 237–238. 
  48. ^ Saino, Nicola; Ambrosini, Roberto; Martinelli, Roberta; Ninni, Paola;; Møller, Anders Pape, N. (2003). "Gape coloration reliably reflects immunocompetence of barn swallow (Hirundo rustica) nestlings". Behavioral Ecology 14 (1): 16–22. doi:10.1093/beheco/14.1.16. Retrieved 27 June 2010. 
  49. ^ Møller, A P (1991). "Parasites, sexual ornaments and mate choice in the Barn Swallow Hirundo rustica". In Loye, J E and Zuk, M. Bird-parasite interactions: Ecology, evolution, and behaviour. Oxford: Oxford University Press. pp. 328–343. 
  50. ^ Vas, Z; Csörgo, T; Møller, A P; Rózsa, L (2008). "The feather holes on the barn swallow Hirundo rustica and other small passerines are probably caused by Brueelia spp. lice" (pdf). Journal of Parasitology 94 (6): 1438–1440. doi:10.1645/GE-1542.1. ISSN 0022-3395. PMID 18576840. 
  51. ^ Kopachena J G, Cochran B L, Nichols T B (2007). "The incidence of American swallow bugs (Oeciacus vicarius) in barn swallow (Hirundo rustica) colonies in northeast Texas". J. Vector Ecol. 32 (2): 280–284. doi:10.3376/1081-1710(2007)32[280:TIOASB]2.0.CO;2. ISSN 1081-1710. PMID 18260518. 
  52. ^ Sugathan, R (1988). "Movement of the Eastern Swallow (Hirundo rustica gutturalis) ringed at Mootpuzha, Kerala". J. Bombay Nat. Hist. Soc. 85 (2): 428–429. 
  53. ^ Ezaki, Yasuo; Mizota, Hiromi (2006). "Wintering of a Peregrine Falcon on an electricity pylon and its food in a suburban area of western Japan". Ornithological Science 5 (2): 211–216. doi:10.2326/osj.5.211. 
  54. ^ "World Cup airport 'threatens swallow population'". The Guardian (UK). 16 November 2006. Archived from the original on 3 December 2007. Retrieved 27 November 2007. 
  55. ^ "'World Cup 2010' development threatens millions of roosting Barn Swallows." (Press release). BirdLife International. 16 November 2006. Archived from the original on 4 December 2007. Retrieved 27 November 2007. 
  56. ^ a b Welldon, James Edward Cowell (translator) (1987) [1897]. "Book 1, chapter 6". The Nicomachean Ethics of Aristotle. Buffalo: Prometheus. ISBN 0-87975-378-1. 
  57. ^ (Latin) Virgil, The Georgics Text Book IV line 307. Retrieved 28 November 2007
  58. ^ Haemig, Paul D.; Hernandez J., Waldenström J., Bonnedahl J. & Olsen B (2008). "Barn swallows (Hirundo rustica) test negative for Salmonella". Vector-Borne and Zoonotic Diseases 8 (4): 451–454. doi:10.1089/vbz.2007.0233. ISSN 1530-3667. PMID 18266565. 
  59. ^ Nims, John Frederick (1981). The Harper Anthology of Poetry. New York: Harper and Row. ISBN 0-06-044846-6. 
  60. ^ a b "Swallow". International Standard Bible Encyclopedia (Bible History Online). Archived from the original on 17 November 2007. Retrieved 18 November 2007. 
  61. ^ "Hardtack and marlinspikes – life and work aboard ship" (pdf). Sailors' tattoos post-visit activity, teachers' handout. Maritime Museum of British Columbia. Retrieved 2007-12-01. 
  62. ^ Cooper, JC (1992). Symbolic and Mythological Animals. London: Aquarian Press. pp. 218–19. ISBN 1-85538-118-4. 
  63. ^ "The State — Structure and Symbols". Estonia. Estonian Embassy in London. Archived from the original on 15 November 2007. Retrieved 27 November 2007. 
  64. ^ "National symbols of Estonia". The Estonia Institute. Archived from the original on 9 November 2007. Retrieved 27 November 2007. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Composed of two groups: ERYTHROGASTER (Barn Swallow) breeding in North America and RUSTICA (European Swallow) breeding in Eurasia (AOU 1998). Zink et al. (1995) found that populations on Asian and North American sides of Beringia exhibited a level of mtDNA differentiation intermediate between populations and species; however, sample sizes were small and no formal taxonomic change was recommended. See Sheldon and Winkler (1993) for information on intergeneric phylogenetic relationships of Hirundininae based on DNA-DNA hybridization. May form a superspecies with H. LUCIDA, H. AETHIOPICA, H. ANGOLENSIS, H. ALBIGULARIS, H. DUMICOLA, H. TAHITICA, and H. NEOXENA (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!