Articles on this page are available in 3 other languages: Chinese (Simplified) (10), Spanish (8), Dutch (1) (learn more)

Overview

Brief Summary

Sand martins live off of insects which they catch in flight. They build tunnels in bare steep sandy walls, which serve as their nest. Sand martins breed in colonies, so that you often see multiple holes in the wall. Breeding in a steep sandy wall is not without risks: there is great danger of collapsing. The Lauwersmeer is an important breeding area for sand martins.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Riparia riparia

A small (4 ½ to 5 ½ inches) swallow, the Bank Swallow is most easily identified by its brown upperparts, white belly white throat, and dusty brown chest stripe separating the throat from the belly. This species may be separated from the similarly-patterned Northern Rough-winged Swallow (Stelgidopteryx serripennis) by that species’ larger size and brown chin. The Bank Swallow occurs across much of the world. In the Americas, this species breeds from Alaska and central Canada south locally to the Mid-Atlantic region in the east and northern Mexico in the West, wintering on the Pacific coast of Mexico and further south to central South America. In the Old World (where it is known as the Sand Martin), this species breeds across Eurasia from Siberia south to North Africa and the Indian subcontinent, wintering across tropical Africa and South Asia. Historically, Bank Swallows bred in a variety of habitats near water, frequently building their nests on cliffs along the banks of rivers. Today, this species often nests on man-made structures such as buildings and bridges. In winter, this species is likewise found in habitats near water, including lakes, rivers, marshes, and reservoirs. Bank Swallows exclusively eat flying insects. As is the case with most swallow species, it is possible to observe Bank Swallows feeding on insects while in flight. Birdwatchers in this species’ breeding range may want to pay special attention to bridges or the eaves of buildings, as a careful search of these structures may reveal a nesting colony. Bank Swallows are primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range in North America extends from western and central Alaska eastward across Canada to the southern Hudson Bay region, Labrador, and Newfoundland, and south to central California, Nevada, Utah, New Mexico, Oklahoma, Arkansas, Tennessee, northern Alabama, and North Carolina, and disjunctly to southern Texas and adjacent northeastern Mexico (northern Veracruz, northeastern San Luis Potosí, and extreme northern Coahuila) (Howell and Webb 1995, AOU 1998, Garrison 1999). In Eurasia, breeding extends from the Hebrides, Orkneys, northern Scandinavia, northern Russia, and Siberia south to the Mediterranean, Palestine, Iran, Afghanistan, northern India, southeastern China, and Japan (AOU 1998, Garrison 1999). Irregular breeding occurs south of these areas.

During the northern winter, the range in the Americas is mainly from eastern Panama southward, east of the Andes, to northern Argentina, Paraguay, and northern Chile, casually north to souithern California; also along Pacific slope of southern Mexico and in Puerto Rico and the Virgin Islands; and in the Old World from the Mediterranean, Near East, northern India, and eastern China south to eastern Africa, Madagascar, Arabia, southern India, Southeast Asia, Borneo, and the Philippines (AOU 1998, Garrison 1999). See Turner and Rose (1989) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Bank swallows, or sand martins as they are known in Europe and Asia, are one of the few small Passeriformes birds that are found throughout most of the world. They migrate between breeding and wintering ranges. In the summer, breeding season they are found where suitable nesting areas are (see Habitat). In the Americas, bank swallows breed throughout much of Alaska and Canada to the maritime provinces and south to the mid-Atlantic United States, throughout much of the Appalachian chain, along the Ohio River Valley to Missouri, west throughout much of Kansas, along the Rocky Mountain Chain into New Mexico, and in the mountainous regions of Utah, Nevada, and northeastern California. They also breed along the Rio Grande river in Texas and northern Mexico. In winter, American populations migrate to South America and along the western coastal slopes of Mexico. In Europe and Asia they winter in the north from the British Isles east to Siberia and south to north Africa, the Middle East, and southeastern China. They winter in the Arabian Peninsula and throughout Africa and Madagascar.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); oceanic islands (Native )

Other Geographic Terms: holarctic ; cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

全世界(除澳大利亚)。欧亚大陆的鸟冬季南迁至东南亚及菲律宾
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© 湖南教育出版社

Supplier: EOL China Regional Center

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Bank swallows, or sand martins as they are known in Europe and Asia, are one of the few small passerine birds that have an almost cosmopolitan distribution. They migrate between discrete breeding and wintering ranges. Bank swallow distribution in the breeding range is most limited by suitable nesting habitat. Winter distribution is influenced by appropriate foraging areas.

In the Americas, bank swallows breed throughout much of Alaska and Canada to the maritime provinces and south to the mid-Atlantic United States, throughout much of the Appalachian chain, along the Ohio River Valley to Missouri, west throughout much of Kansas, along the Rocky Mountain Chain into New Mexico, and in the mountainous regions of Utah, Nevada, and northeastern California. They also breed along the Rio Grande river in Texas and northern Mexico. In winter, American populations migrate to throughout South America and along the western coastal slopes of Mexico. They are rare visitors to some Antillean islands in winter.

In the Old World, bank swallows (or sand martins) breed throughout northern Eurasia, from the British Isles, across Scandinavia, northern Russia, and Siberia, and as far south as the Mediterranean, Middle East, the Nile River valley, northern, coastal Africa, northwestern Africa, Iran, Afghanistan, India, and Pakistan to as far east as southeastern China and Japan. They winter throughout the Arab Peninsula and Africa, including Madagascar. They can also be found throughout much of southern and southeastern Asia in winter, including the Philippine Islands.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); oceanic islands (Native )

Other Geographic Terms: holarctic ; cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Bank swallows are smallish swallows with grayish-brown plumage on the head, back, wings, and tail. The flight feathers of the wings and tail have a slightly darker plumage color and there is a brown band that stretches across the breast. The chin, throat, belly, and undertail coverts are white. Juveniles may have buffy or whitish upperparts and a pink wash to the throat. Their tails are slightly notched.

Bank swallows can be confused with other, small brownish swallows. In North America this includes Stelgidopteryx serripennis, which lack the breast band, and juvenile Tachycineta bicolor, which are larger and differ in some plumage characteristics. Bank swallows may also be distinguished by their voice and their flight pattern: they hold their wings at a sharp angle in flight and use quick, flicking wing beats.

Range mass: 10.2 to 18.8 g.

Average length: 12 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Bank swallow populations worldwide vary slightly in plumage color and size, but variation seems to be clinal. Their ability to disperse over very large distances suggests that gene flow can occur at continental levels at least. At one point 8 subspecies were recognized, but currently only 3 subspecies worldwide are recognized: R. r. riparia, a cosmopolitan subspecies, R. r. diluta a subspecies found throughout northern and central Asia, and R. r. shelleyi, found from Egypt to northeastern Africa.

Bank swallows are smallish swallows with grayish-brown plumage on the head, back, wings, and tail. The flight feathers of the wings and tail have a slightly darker plumage color and there is a brown band that stretches across the breast. The chin, throat, belly, and undertail coverts are white. Juveniles may have buffy or whitish upperparts and a pink wash to the throat. Their tails are slightly notched.

Bank swallows can be confused with other, small brownish swallows. In North America this includes northern rough-winged swallows (Stelgidopteryx serripennis), which lacks the breast band, and juvenile tree swallows (Tachycineta bicolor), which are larger and differ in some plumage characteristics. In South America they may be confused with brown-chested martins (Progne tapera), which are much larger (30-40 g). Bank swallows may also be distinguished by their voice and their flight pattern: they hold their wings at a sharp angle in flight and use quick, flicking wing beats.

Average daily metabolic rates for bank swallows have been measured at 8.99 to 11.55 cm3 CO2/g/hr.

Range mass: 10.2 to 18.8 g.

Average length: 12 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 13 cm

Weight: 15 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Comments: Habitat includes open and partly open situations, frequently near flowing water (AOU 1983). Nests are in steep sand, dirt, or gravel banks, in burrows dug near the top of the bank, along the edge of inland water, or along the coast, or in gravel pits, road embankments, etc. Both sexes construct the nest burrow. Pairs usually dig a new burrow each year, but sometimes they use old bank swallow burrows or abandoned cavities of the belted kingfisher. Individuals tends to return to same nesting area in successive years, though they may move several kilometers away, especially if nesting was unsuccessful the previous year; yearlings often return to the natal area or nearby (Turner and Rose 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Their scientific name, Riparia_riparia, means "river bank river bank" and refers to the preferred breeding habitat of bank swallows. They nest in small to large colonies in soft banks or bluffs along rivers, streams, and coastal areas. They prefer the eroding banks of slow, winding rivers and streams. They also use sandy coastal bluffs or cliffs. Man-made habitats are now also used, including gravel pits, quarries, and road cuts. They are found from sea level to 2100 meters elevation, but most are found in lowland river valleys and coastal areas. Important foraging habitats include wetlands, large bodies of water, grasslands, agricultural areas, and open woodlands. Bank swallows mainly migrate along large bodies of open water, such as marshes, coastal areas, estuaries, and large rivers. In winter they are seen mainly in open habitats with large bodies of water and grasslands, savannas, or agricultural areas.

Range elevation: 0 to 2100 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; scrub forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: agricultural ; riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Their scientific name (Riparia riparia) refers to the preferred breeding habitat of bank swallows. They nest in small to large colonies in soft banks or bluffs along rivers, streams, and coastal areas. They prefer the eroding banks of low-gradient, meandering rivers and streams. They also use sandy coastal bluffs or cliffs. Man-made habitats are now also used, including gravel pits, quarries, and road cuts. They are found from sea level to 2100 meters elevation, but most populations occur in lowland river valleys and coastal areas. Important foraging habitats include wetlands, large bodies of water, grasslands, agricultural areas, and open woodlands. Bank swallows mainly migrate along large bodies of open water, such as marshes, coastal areas, estuaries, and large rivers. In winter they are seen mainly in open habitats with large bodies of water and grasslands, savannas, or agricultural areas.

Range elevation: 0 to 2100 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; scrub forest

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh

Other Habitat Features: agricultural ; riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 10 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

This species migrates in large flocks northward through the United States mostly in April (Terres 1980). In Puerto Rico, it is fairly common in spring, uncommon in fall (Raffaele 1983). It migrates abundantly through Costa Rica from late August or early September to early November and early March to mid-May (Stiles and Skutch 1989).

Most foraging flights are within 0.8 kilometers of colony (Stoner and Stoner 1941).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Diet is mainly flying insects (e.g., beetles, mosquitoes, winged ants, flies, moths). Insects are caught in the air over fields, wetlands, water, etc. If necessary, individuals may forage up to several kilometers from the nesting area, but usually closer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Bank swallows eat almost exclusively insects that they catch in flight. They forage from dawn to dusk over bodies of water or large areas of short-growing vegetation, such as meadows, agricultural fields, or wetlands. They sometimes forage over forest canopies. Bank swallows drink in flight as well, by skimming the water surface with their lower bill. In one study of stomach contents, bank swallows ate 99.8% insects, with approximately 33.5% Hymenoptera, 26.6% Diptera, 17.9% Coleoptera, 10.5% Ephemeroptera, 8% Hemiptera, 2.1% Odonata, and 1.2% moths and Lepidoptera.

Animal Foods: insects

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Bank swallows eat almost exclusively insects that they catch in flight. Insect prey are generally flying insects, although occasionally they take terrestrial or aquatic insects or insect larvae. Most foraging occurs over bodies of water or large areas of short-growing vegetation, such as meadows, agricultural fields, or wetlands. They sometimes forage over forest canopies. Bank swallows drink in flight as well, by skimming the water surface with their lower mandible. The size of colonies may impact whether individuals can get information on the location of prey from other individuals. In North America, swallows in relatively small colonies (5-55 pairs) did not transmit information on foraging to others. In Hungary, however, swallows in a large colony (2100 pairs) foraged synchronously and seemed to transmit information on foraging to other colony members. Breeding adults generally forage within 200 m of their nest, although they may have to forage farther away. If foraging distances are higher, parents return to nests with larger food boluses.

Bank swallows forage from dawn to dusk. One study of stomach contents suggested 99.8% of bank swallow diet is insects, with approximately 33.5% ants, bees, and wasps (Hymenoptera), 26.6% flies (Diptera), 17.9% beetles (Coleoptera), 10.5% mayflies (Ephemeroptera), 8% bugs (Hemiptera), 2.1% dragonflies (Odonata), and 1.2% moths and butterflies (Lepidoptera). Other studies yielded similar results, although proportions of prey varied by region and season.

Animal Foods: insects

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Bank swallows are important predators of flying insects, especially where they concentrate around breeding colonies. Sturnus vulgaris and Passer domesticus may take over their burrows. Other sand and bank burrowing birds, such as Alcedinidae, Tyto alba, Stelgidopteryx serripennis, and Petrochelidon pyrrhonota are tolerated by bank swallows.

Bank swallows that live in larger colonies suffer higher rates of flea infestation and nestlings with fleas had lower body masses than nestlings without fleas.

Mutualist Species:

  • European starlings (Sturnus_vulgaris)
  • house sparrows (Passer_domesticus)
  • kingfishers (Alcedinidae)
  • barn owls (Tyto_alba)
  • northern rough-winged swallows (Stelgidopteryx_serripennis)
  • cliff swallows (Petrochelidon_pyrrhonota)

Commensal/Parasitic Species:

  • fleas (Ceratophyllus_styx)
  • fleas (Ceratophyllus_riparius)
  • fleas (Celsus_celsus)
  • blowflies (Protocalliphora_splendida)
  • blowflies (Protocalliphora_braueri)
  • blowflies (Protocalliphora_hirundo)
  • blowflies (Protocalliphora_metallica)
  • blowflies (Protocalliphora_sialia)
  • blowflies (Protocalliphora_chrysorrhoea)
  • mites (Liponyssus_sylviarum)
  • mites (Atricholaelaps_glasgowi)
  • lice (Myrsidea_dissimilis)
  • feather lice (Mallophaga)
  • nematodes (Acuaria_attenuata)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Bank swallows that live in larger colonies are better at detecting and defending against predators. They cooperate to mob predators that threaten their colony. Most predation is on nestlings and eggs in burrows. Snakes are important predators of nestlings, including gopher snakes (Pituophis_melanoleucus) and black rat snakes (Elaphe_obsoleta). American kestrels (Falco_sparverius) attempt to take flying adults and fledglings. Bank swallows have been observed deterring predation by blue jays (Cyanocitta_cristata) when they mob them.

Known Predators:

  • Eurasian badgers (Meles_meles)
  • gopher snakes (Pituophis_melanoleucus)
  • black rat snakes (Elaphe_obsoleta)
  • American kestrels (Falco_sparverius)
  • hobbies (Falco_subbuteo)
  • blue jays (Cyanocitta_cristata)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / ectoparasite
imago of Crataerina hirundinis ectoparasitises Riparia riparia
Other: minor host/prey

Animal / associate
larva of Fannia hirundinis is associated with nest of Riparia riparia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Bank swallows that live in larger colonies suffer higher rates of flea infestation and nestlings with fleas had lower body masses than nestlings without fleas. Flea species include Ceratophyllus styx, Celsus celsus, and Ceratophyllus riparius. Larval blowflies parasitize bank swallows as well, including Protocalliphora splendida, Protocalliphora braueri, Protocalliphora hirundo, Protocalliphora metallica, Protocalliphora sialia, and Protocalliphora chrysorrhoea. This last species seems to be restricted to the nests of bank swallows throughout the Holarctic. Mites (Liponyssus sylviarum, Atricholaelaps glasgowi), lice (Myrsidea dissimilis), feather lice (Mallophaga), and nematodes (Acuaria attenuata) are also found in bank swallows.

Bank swallows are important predators of flying insects, especially where they concentrate around breeding colonies. European starlings and house sparrows may take over their burrows. Other sand and bank burrowing birds, such as kingfishers, barn owls, northern rough-winged swallows, and cliff swallows are tolerated by bank swallows.

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Bank swallows that live in larger colonies are better able to detect and defend against avian predators. They cooperate to mob predators that threaten their colony. Most predation is on nestlings and eggs in burrows. Eurasian badgers (Meles meles) have been observed excavating burrows and it is likely that other terrestrial mammals attempt to take advantage of bank swallow colonies. Snakes are important predators of nestlings, including gopher snakes (Pituophis melanoleucus) and black rat snakes (Pantherophis obsoletus) in North America. American kestrels (Falco sparverius), hobbies (Falco subbuteo), and other bird-specialist raptors will attempt to take flying adults and inexperienced fledglings. Bank swallows are often unsuccessful in deterring predators via mobbing. They have been observed deterring predation by blue jays (Cyanocitta cristata), however.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 1,000,000. Rich et al. (2004) estimated population size at 46,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Bank swallows may form flocks of 100s or 1000s prior to fall migration.

Inclement weather and resulting scarcity of food may be important factors in nestling mortality in some years; erosion of nest sites and predators also sometimes destroy nests (Turner and Rose 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Young bank swallows use a food-begging call and a signature call to their parents at the nest. Parents recognize the calls of their own offspring. Parents respond with a feeding call when they return to the nest to feed their young, the feeding call is described as a set of sweet notes. Contact calls are the most commonly used and are described as a raspy "tschr." Males also sing to advertise territories and attract females for mating. Males can sing at the nest and in flight. Songs sound like "cher-che-che-che," repeating until it sounds as if they are chattering. Bank swallows also use warning and alarm calls when they observe predators. Warning calls are given to colony-mates while alarm calls are directed at predators when they are being mobbed.

Males also perform display flights to attract females.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Young bank swallows use a food-begging call and a signature call to their parents at the nest. Parents recognize the calls of their own offspring. Parents respond with a feeding call when they return to the nest to feed their young, the feeding call is described as a set of sweet notes. Contact calls are the most commonly used call and are described as a raspy or strident "tschr." Males also sing to advertise territories and attract females for mating. Males can sing at the nest and in flight. The song sounds like a rapid repetition of the contact call, giving it a chattering quality. Bank swallows also use warning and alarm calls when they observe predators. Warning calls are given to colony-mates while alarm calls are directed at predators when they are being mobbed.

Males also perform display flights to attract females.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

About 60% of bank swallows may die each year, with higher death rates in young bank swallows. Two bank swallows lived to 9 years old in the wild.

Range lifespan

Status: wild:
9 (high) years.

  • Szep, T. 1994. Relationship between west African rainfall and the survival of central European Sand Martins Riparia riparia. Ibis, 137: 162 - 168.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

The yearly recruitment of bank swallows may be strongly influenced by conditions in the wintering habitat, which influence survival of juveniles. A study of a Hungarian population that winters in the Sahel region of Africa, suggested that winter, Sahelian rainfall was related to adult population size in the following year on the breeding range. Average annual mortality estimates for adults are approximately 60%, mortality in juveniles is higher. Two bank swallows lived to 9 years old in the wild.

Bank swallows are susceptible to the effects of unseasonably cold weather, which makes it difficult for them to find insect prey and meet their energy demands. Nestlings also die when burrows collapse.

Range lifespan

Status: wild:
9 (high) years.

  • Szep, T. 1994. Relationship between west African rainfall and the survival of central European Sand Martins Riparia riparia. Ibis, 137: 162 - 168.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10 years (wild) Observations: In the wild, most animals do not live more than 4 years (John Terres 1980).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Clutch size is 2-8 (usually 4-5). Incubation, by both sexes, lasts 12-16 days (Terres 1980). Young are tended by both sexes, leave nest when 18-22 days old, return to burrow for a few days after first flight, remain dependent on parents for about 5 days after fledging. Some birds have two broods per year in some areas (not in north). Most individuals live for only one or a few years.Colony size varies; largest colonies often are in artificial sites; colonies may reach at least several hundred pairs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bank swallows are monogamous and defend their nesting site together. Males begin to excavate burrows when they arrive on their breeding grounds. Once the nest burrow is about 30 cm long, they will begin to sit in the entrance and sing to attract females. They will also perform flight displays outside of the burrow entrance to attract females. The pair bond is formed as a female begins to sing in response to the male and perch near the burrow. Males and females will sleep together in the nest burrow. However, both sexes will occasionally try to mate with birds that are not their mates.

Mating System: monogamous

Once a mated pair is formed at a burrow, females begin building a nest in the burrow. Nests are lined with grass, feathers, and other fine materials. Females begin to lay eggs as early as April and into July. Most pairs attempt only 1 clutch per year, unless their first clutch is destroyed early in the nesting season. Females lay from 1 to 9, but usually 4 to 5, white eggs every day until the full clutch size is reached. Females begin incubating the clutch 1 to 2 days before all eggs are laid. Incubation takes 13 to 16 days and eggs hatch over the course of several days. Fledging occurs at around 20 days after hatching and parents continue to feed their young for 3 to 5 days after fledging. Once they become independent, young bank swallows gather in flocks of juveniles and adults. They are forced away from the burrow they were raised in by their parents, but often gather in small groups at other burrows to rest. Males and females can breed in their first year after hatching.

Breeding interval: Bank swallows generally have 1 clutch yearly.

Breeding season: Bank swallows breed during spring and summer in the Northern Hemisphere.

Range eggs per season: 1 to 9.

Average eggs per season: 4-5.

Range time to hatching: 13 to 16 days.

Average fledging age: 20 days.

Range time to independence: 23 to 25 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Male and female bank swallows share in incubating young, although females do most incubation. Both parents sleep in the nest burrow at night. Young are naked and helpless at hatching and parents brood them for 7 to 10 days. Both parents feed the young and help to protect them from predators until they are 23 to 25 days old, a few days after they have left the nest burrow.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • Jones, G. 1986. Sexual chases in sand martins (Riparia riparia): cues for males to increase their reproductive success. Behavioral Ecology and Sociobiology, 19: 179-185.
  • Turner, A. 1982. Journal of Animal Ecology. Timing of laying by swallows (Hirundo rustica) and and sand martins (Riparia ripari), 51: 29-46.
  • Garrison, B. 1999. Riparia riparia. Birds of North America, 414: 1-20. Accessed March 30, 2009 at http://bna.birds.cornell.edu.proxy.lib.umich.edu/bna/species/414.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bank swallows are monogamous and defend their nesting site together. Males begin to excavate burrows when they arrive on their breeding grounds. Preferred burrow sites are in soft, but stable soils, most often higher on banks or slopes. Burrows are dug perpendicular to the bank face and average 58.8 cm in length when complete. Once the nest burrow is about 30 cm long, they will begin to sit in the entrance and sing to attract females. They will also perform flight displays outside of the burrow entrance to attract females. The pair bond is formed as a female begins to sing in response to the male and perch near the burrow. Males and females will sleep together in the nest burrow and most copulations occur there.

Both sexes, however, will attempt extra-pair copulations. Male bank swallows assess female mass via flight characteristics, such as speed of ascent, in order to determine which females are most likely to be in a pre-laying or laying condition. Females that are heaviest are also at their most fertile condition, making them the best targets for attempts at extra-pair copulations. However, both sexes also guard their mates so extra-pair copulations may not be terribly common.

Mating System: monogamous

Once a mated pair is formed at an excavated burrow, females will begin building a nest in the burrow, along with helping with any additional excavation. Nests are lined with grass, feathers, and other fine materials in the area. Females begin to lay eggs as early as April and into July in some areas. Most pairs attempt only 1 clutch per year, unless their first clutch is destroyed early in the nesting season. Females lay from 1 to 9, but usually 4 to 5, white eggs every day until the full clutch size is reached. Females begin incubating the clutch 1 to 2 days before all eggs are laid. Incubation takes 13 to 16 days and eggs hatch over the course of several days. Hatching in colonies is generally synchronous. Fledging occurs at around 20 days after hatching and parents continue to feed their young for 3 to 5 days after fledging. Once they become independent, young bank swallows gather in flocks of juveniles and adults. They are forced away from their natal burrow by their parents, but often gather in small groups at other burrows to rest. Males and females can breed in their first year after hatching.

Breeding interval: Bank swallows generally have 1 clutch yearly.

Breeding season: Bank swallows breed during spring and summer in the Northern Hemisphere.

Range eggs per season: 1 to 9.

Average eggs per season: 4-5.

Range time to hatching: 13 to 16 days.

Average fledging age: 20 days.

Range time to independence: 23 to 25 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Male and female bank swallows share in incubating young, which allows them to lay eggs earlier in the season, when the weather is colder, than other swallow species (Hirundinidae) in which females only incubate eggs (such as Hirundo rustica). However, females do most incubation. Both parents sleep in the nest burrow at night. Young are altricial at hatching and parents brood them for 7 to 10 days. Both parents feed the young and help to protect them from predators until they are 23 to 25 days old, a few days after they have left the nest burrow.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • Jones, G. 1986. Sexual chases in sand martins (Riparia riparia): cues for males to increase their reproductive success. Behavioral Ecology and Sociobiology, 19: 179-185.
  • Turner, A. 1982. Journal of Animal Ecology. Timing of laying by swallows (Hirundo rustica) and and sand martins (Riparia ripari), 51: 29-46.
  • Garrison, B. 1999. Riparia riparia. Birds of North America, 414: 1-20. Accessed March 30, 2009 at http://bna.birds.cornell.edu.proxy.lib.umich.edu/bna/species/414.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Riparia riparia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 18
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Riparia riparia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 18 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATTAACCGATGATTATTCTCAACAAACCATAAAGATATCGGCACCCTGTACCTGATCTTTGGTGCATGAGCAGGCATAGTAGGAACAGCCCTTAGTCTACTCATCCGAGCAGAACTAGGGCAACCCGGAGCTCTTCTCGGAGACGACCAAATCTACAACGTAGTCGTCACCGCCCACGCCTTCGTAATAATCTTCTTCATAGTTATGCCAATCATGATTGGGGGATTCGGAAACTGACTGGTCCCCCTAATAATCGGCGCCCCAGATATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTCCTACCCCCATCATTCTTACTTCTCCTAGCCTCTTCCACAGTAGAAGCCGGAGCAGGAACCGGCTGAACTGTATACCCTCCCCTAGCCGGTAATCTAGCCCACGCCGGAGCCTCTGTAGATCTTGCTATTTTCTCCCTTCACCTAGCAGGAATCTCCTCAATTCTAGGGGCAATCAACTTCATCACCACAGCAATCAACATAAAACCCCCTGCCCTGTCACAATATCAAACCCCCCTATTCGTCTGATCAGTATTAATCACTGCAGTACTCCTCCTCCTCTCACTTCCCGTGCTAGCTGCTGGCATCACCATGCTACTTACAGACCGAAACCTCAACACTACCTTCTTCGACCCAGCCGGAGGGGGAGACCCAGTACTCTACCAACACTTATTCTGATTCTTCGGACATCCAGAAGTCTATATTTTAATTCTTCCAGGCTTCGGAATTATCTCACACGTTGTAGCTTACTACGCTGGAAAAAAAGAACCCTTTGGCTATATGGGCATGGTTTGAGCCATACTATCCATCGGATTCCTAGGC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large nesting range in North America and Eurasia; large population size; many occurences; overall trend poorly known (BBS methods not well suited to this species), but this species does not appear to warrant significant range-wide conservation concern at this time.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bank swallows are widespread and population sizes are large. The IUCN considers them "least concern." However, local populations are impacted by loss of nesting habitat. In California they are listed as threatened, they are considered sensitive in Oregon, and a species of special concern in Kentucky. Bank swallows are fairly tolerant of human activities and will even nest in active quarries.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bank swallows are widespread and population sizes are large. The IUCN considers them "least concern." However, local populations are impacted by loss of nesting habitat. In California they are listed as threatened, they are considered sensitive in Oregon, and a species of special concern in Kentucky. Bank swallows are fairly tolerant of human activities and will even nest in active quarries.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Migrant breeder, regular passage visitor and winter visitor?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Unknown

Comments: Breeding Bird Survey (BBS) data for 1966-2007 indicate a significant survey-wide decline averaging 2% per year; this amounts to a 56% decline over this time period. The rate of decline was higher (2.8% per year) in 1980-2007, but most of the decline occurred prior to the mid-1990s, after which the trend appears to be relatively stable. However, the BBS is not well suited to monitoring this species; BBS data may not accurately reflect actual population trends. Also, the dynamic nature of nesting habitat likely results in large annual variations in population size.

Global Long Term Trend: Unknown

Comments: Long-term trend (past 200 years) is unknown. Declines due to alteration of riverine and riparian habitats have been offset to some degree by human activities that create suitable nesting habitat. For example, road building and quarrying have increased available nest sites in some areas that formerly were unsuitable for breeding; distribution and abundance thus increased over previous circumstances (Turner and Rose 1989).

Recent declines have been noted in Europe (Turner and Rose 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is estimated to number > c.50,000,000 individuals (Rich et al. 2004), while national population estimates include: c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in China; c.100-10,000 breeding pairs and < c.50 wintering individuals in Japan and c.10,000-100,000 breeding pairs and c.1,000-10,000 individuals on migration in Russia and (for the subspecies diluta) c.100-10,000 breeding pairs and c.50-1,000 individuals on migration in China and c.100-10,000 breeding pairs in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: High

Comments: Nesting habitat is spatially and temporally dynamic, often depending on natural streamflow dynamics. Hence, streamflow regulation is a threat in many areas.

Habitat alteration by humans appears to be the only major known threat. In some areas, such as California, much nesting habitat has been eliminated by flood- and erosion-control projects (including riprapping) and streamflow regulation (see Garrison 1999). On the other hand, much suitable nesting habitat has been created by human activities such as sand and gravel mining and road construction. Some anthropogenic nesting habitats subsequently have been reduced or eliminated with closure of sand and gravel pits (see Garrison 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: In California, improvements of natural habitat and construction of artificial banks have been undertaken to mitigate for habitat loss to riprapping; however, it is doubtful that these techniques will provide a long-term solution (California Department of Fish and Game 1990). Quarry managers should be encouraged to create seasonally permanent sand piles from April until July (Byrd and Johnston 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in protected areas, and many are not.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of bank swallows on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Through their predation on flying insects, bank swallows can help to control populations of pest insects, such as mosquitoes and agricultural pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of bank swallows on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Through their predation on flying insects, bank swallows can help to control populations of pest insects, such as mosquitoes and agricultural pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sand Martin

The sand martin (Riparia riparia) is a migratory passerine bird in the swallow family. It has a wide range in summer, embracing practically the whole of Europe and the Mediterranean countries, part of northern Asia and also North America. It winters in eastern and southern Africa, South America and South Asia. It is known as bank swallow in North America, and as collared sand martin in South Asia, and sometimes as European sand martin.

Description, systematics, and taxonomy[edit]

Showing dark breast band
Adult at nest site, Dziwnówek (Poland)

The 12 cm long sand martin is brown above, white below with a narrow brown band on the breast; the bill is black, the legs brown. The young have rufous tips to the coverts and margins to the secondaries.

Its brown back, white throat, small size and quick jerky flight separate it at once from similar swallows, such as the house martin (Delichon urbicum), the cliff swallow (Petrochelidon pyrrhonota) or other species of Riparia. Only the banded martin (R. cincta) of sub-Saharan Africa is similar, but the sand martin only occurs there in winter.

The pale martin of northern India and southeastern China is now usually split as a separate species Riparia diluta. It has paler grey-brown upperparts and a less distinct breast band. It winters in Pakistan and southern India.[2]

The sand martin's twittering song is continuous when the birds are on the wing, and becomes a conversational undertone after they have settled in the roost. The harsh alarm is heard when a passing falcon, crow or other suspected predator requires combined action to drive it away.

This species was first described by Linnaeus in his Systema naturae in 1758, and originally named Hirundo riparia; the description consisted of the simple H[irundo] cinerea, gula abdomineque albis—"an ash-grey swallow, with white throat and belly"—and the type locality was simply given as "Europa". The specific name means "of the riverbank"; it is derived from the Latin ripa "riverbank".[3]

Ecology[edit]

Active breeding colony

Linnaeus already remarked on this species' breeding habits: Habitat in Europae collibus arenosis abruptis, foramine serpentino – "it lives in Europe, in winding holes in sheer sandy hills". It is generally found near larger bodies of water, such as rivers, lakes or even the ocean, throughout the year.[4]

The sand martin appears on its breeding grounds as the first of its family, starting towards the end of March, just in advance of the barn swallow. In northern Ohio, they arrive in numbers by mid-April, about 10 days earlier than they did 100 years ago.[5] At first, they flit over the larger bodies of water alone, in search of early flies. Later parties accompany other swallow species, but for a time, varying according to weather, the birds remain at these large waters and do not visit their nesting haunts. The sand martin departs early, at any rate from its more northerly haunts. In August, the gatherings at the nightly roost increase enormously, though the advent and departure of passage birds causes great irregularity in numbers. They are essentially gone from their breeding range by the end of September.

Nest with egg

The food consists of small insects, mostly gnats and other flies whose early stages are aquatic.

The sand martin is sociable in its nesting habits; from a dozen to many hundred pairs will nest close together, according to available space. The nests are at the end of tunnels of from a few inches to three or four feet in length, bored in sand or gravel. The actual nest is a litter of straw and feathers in a chamber at the end of the burrow; it soon becomes a hotbed of parasites. Four or five white eggs are laid about mid-late May, and a second brood is usual in all but the most northernly breeding sites.

This is not a rare bird, and it is classified as a species of Least Concern by the IUCN.[6] It does have some local protections, as certain populations have declined or face threats from habitat loss and fragmentation. They are considered threatened in California, where populations exist in the Sacramento Valley[7] and at two coastal sites, Ano Nuevo and Fort Funston[8]

Footnotes[edit]

  1. ^ BirdLife International (2012). "Riparia riparia". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Turner & Rose (1989)
  3. ^ Linnaeus (1758)
  4. ^ Linnaeus (1758), Accordi & Barcellos (2006)
  5. ^ Henninger (1906), OOS (2004)
  6. ^ BLI (2008)
  7. ^ Garrison, B. A. 1998. Bank Swallow (Riparia riparia). In The Riparian Bird Conservation Plan: a strategy for reversing the decline of riparian-associated birds in California. California Partners in Flight. http://www.prbo.org/calpif/htmldocs/riparian_v-2.html
  8. ^ http://www.parksconservancy.org/about/newsletters/park-e-ventures/2012/04-ggro.html

References[edit]

  • Linnaeus, Carl (1758): 101.4. Hirundo riparia. In: Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis (10th ed., vol. 1): 192. Laurentius Salvius, Holmius (= Stockholm). PDF fulltext
  • Turner, Angela & Rose, Chris (1989): Swallows and martins: an identification guide and handbook. Houghton Mifflin. ISBN 0-395-51174-7
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Sheldon and Winkler (1993) for information on intergeneric phylogenetic relationships of Hirundininae based on DNA-DNA hybridization.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!