Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Brief Summary

Tachycineta bicolor

A medium-sized (5-6 inches) swallow, the Tree Swallow is most easily identified by its iridescent blue-green back and head, white breast, and notched tail. Adult Tree Swallows may be distinguished from adult Violet-green Swallows (Tachycineta thalassina) by that species’ greener back and white face; immature Tree Swallows, which are brown above and pale below, may be confused with other dark-backed New World swallows, such as the Northern Rough-winged Swallow (Stelgidopteryx serripennis) and Bank Swallow (Riparia riparia). Male and female Tree Swallows are similar to one another in all seasons. The Tree Swallow breeds across much of North America, occurring from Alaska and northern Canada south to the south-central United States. Gaps in this species’ breeding range occur where habitat is incompatible with breeding in portions of the interior west and on the Great Plains. During the winter, this species may be found from the southeastern U.S.and California south to Central America. Tree Swallows breed in a variety of open areas near water, particularly in areas where tree cavities (or, more recently, artificial nest boxes) are available for nesting. This species utilizes similar kinds of habitat in winter as it does during the summer, although nest site availability is not a concern at that time of the year. Although Tree Swallows mainly eat small flying insects, this species is unusual for a swallow in that it also eats berries, particularly those of wax myrtles (genus Myrica), during winter when insects are unavailable. In appropriate habitat, Tree Swallows may be observed flying over water or open country while catching insects in flight. During the breeding season, a stakeout at a tree cavity or nest box may reward the patient birdwatcher with views of adult Tree Swallows bringing food to young birds. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Breeds Alaska to s US; >n South America.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tree swallows breed throughout central and northern North America. The northernmost limit of the tree swallow breeding range coincides approximately with the tree line. Tree swallows winter in southern North America, primarily in Florida, and along the Caribbean coast of Central America.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Robertson, R., B. Stutchbury, R. Cohen. 1992. Tree Swallow (Tachycineta bicolor). Pp. 1-28 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 11. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tree swallows breed throughout central and northern North America. The northernmost limit of the tree swallow breeding range coincides approximately with the tree line. Tree swallows winter in southern North America, primarily in Florida, and along the Caribbean coast of Central America.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Robertson, R., B. Stutchbury, R. Cohen. 1992. Tree Swallow (Tachycineta bicolor). Pp. 1-28 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 11. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: BREEDS: western Alaska to Newfoundland, south to southern California, Nevada, Arizona, New Mexico, northeastern Louisiana, western Mississippi, Tennessee and North Carolina, casually to southern states. Range has expanded in southeastern U.S. in recent decades, perhaps facilitated by land clearing, impoundments, beaver reintroduction, and use of bluebird nest boxes (Lee 1993). WINTERS: primarily from southern California and extreme southern U.S. through Mexico to Honduras, Nicaragua and Costa Rica, sporatically to Panama; Bahamas and Greater Antilles (Puerto Rico: rare), rarely to northern South America (Ridgely and Tudor 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Color of External Features

Tree Swallows provide an excellent example of countershading (strong dark coloration dorsally and highly contrasted white shading ventrally). Countershading allows for birds to reduce the contrast between their shape and the surrounding environment, therefore aiding in concealment. Generally, greater contrast in coloration of a bird reflects a greater illumination from above (Thayer, 1909).

Tree Swallows are unique in that first year females display delayed plumage maturation, appearing a dull brown dorsally although they are sexually mature. By contrast, first year males do not display delayed plumage maturation and appear blue-green dorsally in their first year. They, too are sexually mature although evidence suggests that they are not as successful as returning males at securing a mate (Thompson, 1991). Although there is no delay in male plumage maturation, it is believed that as males mature, their plumage becomes brighter to optimally reflect light at a shorter wave-length (blue). Additionally, evidence suggests that males who appear more green may express lower nest fidelity and/or a lower survival rate than do their blue counterparts. Therefore both brightness and hue may be reflective of male quality in Tree Swallows (Bitton and Dawson, 2008).

This is further supported by the knowledge that iridescence in color is a function of both the number and quality of feather barbules while hue is a function of the thickness of the feather cortex (Doucet et al., 2006, Prum, 2006). Condition in both the feather cortex and barbules may be influenced by genetic quality or physiological stress during the development period both of which may determine quality at an individual level.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Eliza Smith

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Physical Description

Tree swallows are small birds (14 cm total length) with long wings and small legs and feet. They are irridescent greenish-blue above and white below on the chin, breast and belly. Tree swallows have a short black beak and dark reddish-brown or brownish-gray feet.

Juvenile tree swallows are similar in appearance to adults, but are brownish rather than greenish blue. They also have a dusky wash across their white chests. One-year-old females look very similar to adults, but have a mixture of brown and irridescent greenish-blue above.

Average length: 14 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 19 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Physical Description

Tree swallows are small birds (about 14 cm long) with long wings and small legs and feet. They are irridescent greenish-blue on their head, shoulders and back, and white their chin, breast and belly. Tree swallows have a short black beak and dark brownish feet.

Young tree swallows look similar to adults, but they are brownish above instead of greenish blue.

Average length: 14 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 19 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 15 cm

Weight: 20 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Tree swallows live in open areas near water, such as fields, marshes, meadows, shorelines, beaver ponds, and wooded swamps. Tree swallows need habitats with cavities for nesting. They can find these cavities in dead trees, in live trees where sapsuckers have made holes, under the eaves of buildings,and in artificial nest boxes.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp ; bog

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tree swallows live in open areas near water, such as fields, marshes, meadows, shorelines, beaver ponds, and wooded swamps. Because tree swallows are cavity nesters, an important habitat requirement is cavities in which to nest. These can be provided by standing dead trees, sapsucker-excavated holes in live trees, under the eaves of buildings,and in artificial nest boxes.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: marsh ; swamp ; bog

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Open situations near water, including streams, lakes, ponds, marshes and coastal regions (AOU 1983); savanna, pastures, etc. Nests usually near water in a natural tree cavity or abandoned woodpecker hole, less frequently in open woodland away from water. Also nests in bird boxes or in a crevice in a building. Territoriality may limit use of suitable nest sites. Tends to return to same nest site in subsequent years if reproduction successful; first-year breeders return to nest usually within 100 km or less of natal site (Turner and Rose 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Main migration routes include U.S. east coast, Mississippi Basin, along Rockies (see Turner and Rose 1989). Migrates northward early, February-March in most of U.S. (Terres 1980). Large numbers of south-bound migrants pass through Florida in late fall, beginning in late September or October (Smith and Smith 1990). Irregularly rare to locally common migrant in Costa Rica, early September-late October and March-April (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Tree swallows mostly eat flying insects, though they also eat plant materials (about 20% of their diet). They feed in flight, searching for food in open areas above water or ground. They sometimes feed in flocks when there are a lot of insects around. Tree swallows can also catch insects on the surface of water or on other surfaces.

Swallows feed from dawn until dusk, mainly on Diptera, Coleoptera and Formicidae. However, Plecoptera, Ephemeroptera, Trichoptera, Araneae and Orthoptera are also common prey. When weather conditions are bad, tree swallows feed on vegetation, including bulrushes, bayberries, and other plants' seeds.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Tree swallows primarily eat flying insects, though they also eat plant materials (about 20% of their diet). They forage in flight, in open areas above water or ground. They sometimes forage in flocks when insects are abundant. They can also glean insects from the surface of water or vertical surfaces. Swallows feed from dawn until dusk, mainly on flies, beetles and ants, though stoneflies, mayflies, caddisflies, spiders and grasshoppers are also common prey. When weather conditions are bad, tree swallows feed on vegetation, including bulrushes, bayberries, and other plants' seeds.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Foraging Patterns

Tree Swallows often return to their breeding grounds weeks before local insect abundances reach their peak (McCarty, 1995). To compensate for variations in local food abundance, they appear to selectively forage at ponds where densities of fish are lower, more nutrients and a greater insect emergence (McCarty, 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Eliza Smith

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Catches flying insects in the air over land or water. Also forages on the ground for beetles, bugs, beach "fleas", and spiders. Occasionally eats some seeds and fruits (e.g., Myrica fruits during inclement weather when insects unavailable, especially in fall in the eastern coastal U.S.) (Place and Stiles 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Tree swallows affect the populations of the animals they eat. They also provide food for their predators. They host a number of body parasites, including Protocalliphora sialia larvae.

Commensal/Parasitic Species:

  • Protocalliphora sialia larvae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Tree swallow eggs and nestlings are vulnerable to predation by Elaphe obsoleta, Procyon lotor, Ursus americanus, Falco sparverius, Quiscalus quiscula, Corvus brachyrhynchos, Colaptes auratus, Tamias, Mustela, Peromyscus maniculatus and feral Felis silvestris. Adults are taken in flight by Pica pica and raptors, including Accipiter striatus, Falco sparverius, Falco columbarius, Falco peregrinus and Bubo virginianus.

Tree swallows respond to predators by mobbing them. Large numbers of tree swallows swarm and dive-bomb the predator while giving alarm calls.

Known Predators:

  • rat snakes (Elaphe_obsoleta)
  • raccoons (Procyon_lotor)
  • black bears (Ursus_americanus)
  • American kestrels (Falco_sparverius)
  • common grackles (Quiscalus_quiscula)
  • American crows (Corvus_brachyrhynchos)
  • northern flickers (Colaptes_auratus)
  • chipmunks (Tamias)
  • weasels (Mustela)
  • deer mice (Peromyscus_maniculatus)
  • feral cats (Felis_silvestris)
  • black-billed magpies (Pica_pica)
  • sharp-shinned hawks (Accipiter_striatus)
  • great horned owls (Bubo_virginianus)
  • merlins (Falco_columbarius)
  • peregrine falcons (Falco_peregrinus)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Tree swallows affect the populations of the animals they eat. They also provide food for their predators. They host a number of body parasites, including blowfly larvae.

Commensal/Parasitic Species:

  • blowfly larvae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Tree swallow eggs and nestlings are vulnerable to predation by rat snakes, raccoons, black bears, American kestrels, common grackles, American crows, northern flickers, chipmunks, weasels, deer mice and feral cats. Adults are taken in flight by black-billed magpies and raptors, including sharp-shinned hawks, American kestrels, merlins, peregrine falcons and great horned owls.

Tree swallows respond to predators by mobbing them. Large numbers of tree swallows swarm and dive-bomb the predator while giving alarm calls.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Many may congregate where food abundant or in roosts when weather cold. When not breeding, flocks may contain 1000s of individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Tree swallows communicate using sounds and body signals. Only male tree swallows sing. They sing to let other males know where their territory is. Males and females both use calls to communicate. There are at least 14 different tree swallow calls. These are used to communicate many different messages, including distress, anxiety, pleasure and submission. They may also be used to beg for food and to attract a mate to copulate with. Body signals such as crouching and wing-fluttering are used to communicate many different messages, such as aggression or desire to copulate.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Tree swallows communicate primarily using sounds and physical displays. Only male tree swallows sing, apparently for the purpose of proclaiming their territory. Both sexes use calls to communicate. At least 14 different tree swallow calls have been identified. The apparent purposes of these calls range from signaling distress, anxiety, pleasure and submission to begging for food and soliciting copulation. Body signals such as crouching and wing-fluttering are used to communicate a variety of messages, including aggression and solicitation of copulation.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest known tree swallow lived at least 11 years. Most tree swallows probably live about 3 years.

Range lifespan

Status: wild:
8 to 11 years.

Average lifespan

Status: wild:
2.7 years.

Average lifespan

Status: wild:
145 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Annual adult tree swallow survival is estimated at 40 to 60%. Estimated average life span of tree swallows is 2.7 years. However, the oldest known tree swallow lived at least 11 years.

Range lifespan

Status: wild:
8 to 11 years.

Average lifespan

Status: wild:
2.7 years.

Average lifespan

Status: wild:
145 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12.1 years (wild) Observations: A 25-year study in the wild found that reproductive performance first increased until about 3-5 years of age, possibly due to acquired skills, and then declined, perhaps caused by physiological ageing and influenced by previous reproductive efforts (Robertson and Rendell 2001).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Tree swallows are socially monogamous (one male forms a breeding pair with one females). Males and females form breeding pairs as soon as the females arrive at the breeding sites in the spring. However, tree swallows often copulate with other tree swallows that are not their mates. This means that it is common for the chicks in a nest to have different fathers.

Mating System: monogamous

Tree swallows breed between May and September. They raise one brood per year. Tree swallows usually nest solitarily. However, they may nest near other tree swallows if nest cavities are close together.

Tree swallows build their nests in late April or early May. Their nests are usually built in holes in dead or live trees or in hollow stumps. The female builds the nest using grasses, mosses, rootlets, and aquatic plants. She then lines it with feathers from other birds. Building the nest takes a few days to two weeks. The female lays 2 to 8 (usually 4 to 7) eggs, usually in early May. She incubates the eggs for 14 to 15 days. When the eggs hatch, the chicks are altricial (helpless). The female broods them for the first three days, and both parents feed them.

The chicks leave the nest (called fledging) at 15 to 25 days old (usually at 18 to 22 days). They are able to fly right away. The parents continue to feed the chicks for at least 3 days after they leave the nest. These chicks will be able to breed the next summer.

Breeding interval: Tree swallows breed once per year.

Breeding season: Tree swallows breed between May and September.

Range eggs per season: 2 to 8.

Range time to hatching: 11 to 19 days.

Average time to hatching: 14.5 days.

Range fledging age: 15 to 25 days.

Range time to independence: 3 (low) days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

Female tree swallows build the nest, incubate the eggs and brood the chicks. Both parents feed the chicks while they are in the nest and for at least three days after they fledge.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • Robertson, R., B. Stutchbury, R. Cohen. 1992. Tree Swallow (Tachycineta bicolor). Pp. 1-28 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 11. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tree swallows are primarily monogamous. However, polygyny has been documents at low rates in some populations. Breeding pairs form as soon as females arrive at breeding sites in the spring. Extra-pair copulations are common in this species; as many as 50% of nests in a given population may contain young that were not fathered by the resident male.

Mating System: monogamous

Tree swallows breed between May and September, and raise one brood per year. They usually nest solitarily, though they will nest near each other if existing cavities are close together. Nest building takes place in late April or early May. Nests are typically built in cavities in dead or live trees (excavated earlier by woodpeckers or other species) or in hollow stumps over water. However, they can also be found under the eaves of buildings, in steel drums, fire hydrants, holes in the ground or nest boxes. Nests are built almost entirely by the female. They are made of grasses, mosses, rootlets, and aquatic plants, and are lined with feathers from other species of birds. Construction takes from a few days to two weeks.

The female lays 2 to 8 (usually 4 to 7) eggs, at a rate of one per day. The female then incubates the eggs for 11 to 19 (usually 14 to 15) days. The female broods the altricial chicks for the first three days after hatching. Both parents share the responsibility of feeding and finding food for the chicks. Chicks fledge 15 to 25 days after hatching (usually 18 to 22 days), at which time they are good fliers. The parents continue to feed the chicks for at least 3 days after they leave the nest. These chicks will be able to breed the next summer if they are able to establish a nest site.

Breeding interval: Tree swallows breed once per year.

Breeding season: Tree swallows breed between May and September.

Range eggs per season: 2 to 8.

Range time to hatching: 11 to 19 days.

Average time to hatching: 14.5 days.

Range fledging age: 15 to 25 days.

Range time to independence: 3 (low) days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

Female tree swallows build the nest, incubate the eggs and brood the chicks. Both parents feed the chicks while they are in the nest and for at least three days after they fledge.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • Robertson, R., B. Stutchbury, R. Cohen. 1992. Tree Swallow (Tachycineta bicolor). Pp. 1-28 in A Poole, P Stettenheim, F Gill, eds. The Birds of North America, Vol. 11. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg dates: late April-late June in south, early May to mid-June in north. Clutch size usually is 4-6. Incubation, typically by fenale, lasts 13-16 days. Altricial young are tended by both sexes, leave nest 16-24 days after hatching (Terres 1980), receive little care after that. Inclement weather and resulting scarcity of food may result in high nestling mortality in some years. In Ontario, productivity was reduced near experimentally acidified lakes (St. Louis and Barlow, 1993, Can. J. Zool. 71:1090-1097). Generally monogamous, but sometimes polygynous if food is superabundant. Nests alone or in loose colony.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Vision

All Hirundinids, including Tree Swallows have two distinct visual adaptations to their environments. To view distant objects they rely on forward directional binocular vision, while close objects are perceived through lateral monocular vision (Gill).

  • Gill, F.B. 2007. Ornithology. 3rd Edition. W.H. Freeman & Co. New York. 763 pp.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Eliza Smith

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tachycineta bicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATCAACCGATGATTATTTTCAACAAACCACAAAGATATCGGCACCCTATACCTGATCTTCGGCGCATGAGCAGGCATAGTAGGGACTGCCCTTAGCCTCCTCATTCGAGCAGAACTAGGCCAACCAGGAGCTCTACTTGGAGACGACCAGATCTACAACGTAATTGTCACCGCCCACGCCTTTGTAATAATTTTCTTCATAGTTATGCCAATCATGATCGGAGGATTCGGAAACTGACTAGTACCACTGATAATTGGTGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTTCCACCATCCTTCCTACTCCTCCTAGCCTCATCCACAATCGAAGCAGGTGCAGGAACTGGCTGAACCGTCTACCCACCCCTGGCCGGGAACCTAGCCCACGCTGGTGCCTCCGTAGACCTAGCCATCTTCTCCCTCCACCTAGCAGGTATTTCCTCAATCTTAGGAGCAATCAACTTTATCACTACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACCCCCCTATTCGTTTGATCTGTACTAATCACTGCAGTGCTTCTCCTCCTCTCACTCCCAGTTTTAGCCGCCGGCATCACTATGCTTCTAACAGACCGTAACCTCAATACCACTTTCTTCGACCCAGCAGGAGGAGGAGACCCAGTACTGTATCAACACCTGTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTCCCAGGATTCGGAATTATCTCACACGTCGTAGCCTACTACGCCGGAAAAAAAGAACCCTTCGGCTACATGGGCATGGTCTGAGCCATACTATCCATCGGGTTCTTAGGGTTCATCGTATGAGCCCACCACATGTTCACAGTAGGAATAGACGTAGACACCCGAGCCTACTTCACATCAGCTACAATAATCATTGCCATCCCAACCGGCATCAAAGTATTCAGCTGACTAGCAACCCTACACGGCGGAACTATAAAATGAGAACCACCCATACTATGAGCACTAGGCTTCATCTTCCTTTTCACCATCGGAGGACTAACCGGAATCGTCCTAGCAAACTCCTCCCTAGATATCGCCTTACACGACACCTACTACGTAGTAGCCCATTTCCACTACGTACTATCCATAGGAGCAGTATTTGCCATCCTAGCAGGCTTTACACACTGATTCCCCCTATTTACAGGATACACACTCCACTCCACATGAGCCAAAACCCACTTCGGAGTAATATTCGTTGGCGTCAACCTTACCTTCTTCCCCCAACACTTCTTAGGACTAGCAGGTATGCCCCGCCGATACTCGGACTACCCAGACGCCTACACCCTATGAAATACTATCTCCTCAGTGGGGTCACTAATCTCAATAACAGCCGTAATCATACTAATCTTCATCATCTGAGAAGCCTTCGCATCCAAACGCAAAGCCTTCCAACCAGAACTAACAAGCACTAACATCGAATGAATCCACGGTTGCCCTCCCCCATTCCACACCTTCGAAGAACCAGCATTCGTACAAGTACAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tachycineta bicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Tree swallows are a pretty common bird. They have become more common over the past 25 years. There are about 20,000,000 tree swallows in the world. Pollution and acid rain are two environmental problems that may hurt tree swallow populations in the future.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tree swallows are a relatively common birds. Global populations of tree swallows have increased over the last 25 years to an estimated 20,000,000. Tree swallows readily use nesting boxes, making them a good study species for studies of the effect of pollutant on birds. PCBs and DDE have been found to be present in high levels in adults, eggs, and nestlings. It has also been found that birds in more acidic wetlands produce fewer and smaller young. These observations may suggest a possible long-term problem for tree swallows. A more pressing consideration, however, is the maintenance of dead trees, which provide nest sites for tree swallows and other cavity-dwellers.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: See Mitchell (1988) for specifications for the construction and placement of nest boxes. See Lumsden (1989) for nest box preference in Ontario.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of tree swallows on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Tree swallows eat many kinds of insects that humans may consider to be pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of tree swallows on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Tree swallows eat many kinds of insects that humans may consider to be pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tree Swallow

Flying in Central New York, USA

The Tree Swallow (Tachycineta bicolor), is a migratory passerine bird that breeds in North America and winters in Mexico, Central America and the Caribbean. It is a very rare vagrant to western Europe.

This swallow averages 13.5 cm (5 inches) long and weighs about 20 g. The bill is tiny. The adult Tree Swallow has iridescent blue-green upperparts, white underparts, and a very slightly forked tail. The female usually has duller colours than the male, often more greenish than the more bluish male. The juvenile plumage is dull grey-brown above and may have hint of a gray breast band.

Being highly social outside of the breeding season, tree swallows may form flocks of several thousand birds near roost sites.[2] Flocks near Vacherie, Louisiana were estimated to contain well over 1 million birds during December 2009.[3]

Breeding [edit]

Mating
Nesting

Tree Swallows nest in natural or artificial cavities near water and are often found in large flocks. They readily use nest boxes, including those built for bluebirds. Declines in cavity-builder populations are resulting in fewer natural nesting sites for Tree Swallows, although the swallow population remains healthy.

The Tree Swallow nest consists of multiple layers of grasses and thin twigs, and is lined with large feathers from other species. The female lays 4 to 7 white eggs and incubates them by herself. The eggs hatch in about 14 days and the hatchlings are altricial. The hatchlings typically fledge in 16–24 days. While there are young or eggs in the nest, adults frequently dive bomb intruders (including curious humans) and attempt to drive them from the area. Tree Swallows are known to "fight" over feathers in mid-air for reasons which are still under investigation. There is some speculation that this is a form of play.

Tree Swallows are typically single-brooded, although they may attempt a second nest if the first fails early in the season. There are records of parents raising two successful broods in a season.

They subsist primarily on a diet of insects, sometimes supplemented with small quantities of fruit. They are excellent fliers and take off from their perch and acrobatically catch insects in their bills in mid-air.

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Names and Taxonomy

Taxonomy

Comments: Sometimes placed in the genus IRIDOPROCNE (AOU 1983). See Sheldon and Winkler (1993) for information on intergeneric phylogenetic relationships of Hirundininae based on DNA-DNA hybridization.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!