Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Breeding range extends from the Yukon River valley in Alaska and central Yukon Territory and southwestern Alberta south through southern Alaska, British Columbia, southwestern Saskatchewan, Montana, southwestern South Dakota, and northwestern Nebraska to southern Baja California and the northern mainland of Mexico, and through Colorado and western Texas (Bent 1942, Brown et al. 1992, Sinclair et al. 2003). Recent range extensions have been reported in the northeastern part of range (e.g., Saskatchewan, Canada; Wright 1992, Houston 1999). During the nonbreeding season, the range extends from central coastal and southern California and Mexico south regularly to Honduras, casually or accidentally to western Panama and Costa Rica (Terres 1980, AOU 1983, Stiles and Skutch 1989, Brown et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 13 cm

Weight: 14 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Open coniferous, deciduous or mixed forest and woodland, primarily in highlands (frequently at low elevations in north); in migration and winter also meadows, fields and watercourses, more commonly in highland regions (AOU 1983). May nest in cliff crevice, natural tree cavity, woodpecker hole, crevice in building, or bird box; also reported to use old nest of cliff or bank swallow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates northward from wintering areas February-April (Terres 1980). Arrvies in northern breeding areas in April, depart in July in north, August-September farther south (Turner and Rose 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Feeds on flying insects (e.g., flies, leafhoppers, ants, wasps, bees, beetles, moths). Forages over ponds, fields, and wooded areas catching insects in flight. Occasionally may forage on ground on accumulations of insects such as midges or mayflies.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Global population estimate is 11,000,000 birds (Rich et al. 2004). North American Breeding Bird Survey (BBS) data estimate a relative abundance of 4.2 birds/survey route (n = 669) throughout the North American survey area between 1966 and 2005 (Sauer et al. 2005); 3.96 birds/route (n = 592) were reported for the same period in the United States and 5.78 birds/route (n = 77) for Canada (Sauer et al. 2005). The BBS recorded 550 nests in Canada, all located in British Columbia (Erskine 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

2.5-15 breeding pairs per 40 ha in northern Arizona; up to 50 pairs per 40 ha in thinned forest with added nest boxes (Brawn and Balda 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 6.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg dates: May-early July in south, beginning in late May in north. Clutch size typically is 4-5, sometimes 6, in north; smaller in south. Incubation, by female, lasts 13-15 days. Altricial nestlings are tended by both parents, leave nest in 23-25 days. Usually 1 brood per season, though 2 per season reported for Oregon. May nest in loose colonies if nest sites are abundant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tachycineta thalassina

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATCAACCGATGATTATTCTCAACAAACCATAAAGATATCGGCACCCTATACCTAATCTTCGGCGCATGAGCAGGCATAGTAGGAACTGCCCTCAGCCTCCTCATTCGAGCAGAATTAGGTCAACCAGGCGCTCTACTCGGAGACGACCAAATCTACAACGTAATTGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATAGTCATGCCAATCATGATCGGAGGGTTCGGAAACTGACTGGTTCCCCTAATAATTGGCGCCCCAGACATAGCATTTCCTCGAATAAACAATATAAGCTTCTGACTCCTTCCCCCATCCTTCTTGCTGCTCCTAGCCTCATCCACAGTAGAATCTGGCGCAGGAACCGGCTGAACCGTATACCCACCTCTAGCTGGAAACCTAGCCCACGCTGGCGCCTCCGTAGACCTAGCCATCTTCTCCCTCCACCTAGCGGGAATCTCCTCAATCCTAGGAGCAATCAACTTTATCACCACAGCAATCAATATAAAACCTCCTGCCCTGTCACAATACCAAACCCCCTTATTTGTTTGATCCGTACTAATCACCGCAGTACTCCTCCTCCTCTCACTTCCAGTATTAGCCGCTGGCATCACCATACTACTAACAGACCGTAACCTTAACACCACTTTCTTTGACCCAGCCGGAGGAGGAGACCCAGTACTGTACCAACACCTGTTCTGATTTTTTGGACATCCAGAAGTCTACATTCTAATCCTCCCAGGATTTGGCATCATCTCACACGTCGTCGCCTACTACGCTGGAAAAAAAGAACCCTTCGGCTACATAGGCATGGTCTGAGCTATGCTGTCCATCGGCTTCCTGGGGTTCATCGTATGAGCCCACCATATGTTCACAGTAGGAATAGACGTAGACACCCGAGCCTACTTCACATCAGCCACAATAATCATTGCCATCCCAACTGGCATCAAAGTGTTCAGCTGATTGGCAACCTTACACGGCGGAACTATAAAATGAGAACCACCCATACTATGAGCACTAGGATTCATCTTCCTGTTTACCATCGGAGGACTAACCGGAATCGTCCTAGCAAACTCCTCCCTAGACATCGCCCTACACGATACCTACTACGTAGTAGCCCACTTCCACTACGTGCTATCCATAGGAGCAGTATTCGCCATCCTAGCAGGCTTTACCCACTGATTCCCTCTATTCACAGGATACACACTCCACTCCACATGAGCCAAAATCCACTTCGGAGTAATGTTCGTTGGGGTCAACCTCACCTTCTTCCCCCAACACTTCCTAGGACTAGCAGGCATGCCCCGCCGATACTCAGACTACCCAGATGCCTACACCCTATGAAATACCATCTCTTCAGTGGGATCACTAATCTCAATAACAGCCGTAATCATGCTAATCTTCATTATCTGAGAAGCCTTTGCATCTAAACGCAAAGCCTTCCAACCAGAACTAACAAGCACTAACATCGAATGAATCCACGGTTGCCCTCCCCCATTCCACACCTTCGAAGAACCAGCATTTGTACAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tachycineta thalassina

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large breeding range in North America; large and relatively stable population size; no major threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: BBS data for North America indicate a relatively stable range-wide population during the period 1966-2005 (Sauer et al. 2005).

Global Long Term Trend: Increase of 10-25% to decline of 30%

Comments: As a whole, the population is apparently stable but increased in the northern plains states in the late 1980s and declined locally in Mexico over the past few decades (Turner and Rose 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: On a range-wide scale, no major threats are known. Locally, threats may include introduced nest-site competitors, nesting habitat loss, and extreme weather conditions. Introduced secondary cavity nesters, including the house sparrow and European starling, threaten nesting success by competing for suitable nesting cavities; these species often begin nesting prior to the violet-green swallow, so they have an advantage in site selection (Bent 1942, Erskine 1979, Brown et al. 1992). Removal of snags may have a strong negative impact on the species. In northern Arizona's ponderosa pine forests, this species was exclusively reliant on snags for nest-site locations (Cunningham et al. 1980, Brawn and Balda 1988). Clearing of forest for settlement and agriculture removes natural nest sites, as do forest harvest strategies that remove snags (Erskine 1979, Brawn and Balda 1988). This species is sensitive to extremely cold weather and accompanying low insect activity; large numbers of individuals have been found dead in emaciated condition after spring storms along migration routes (Bent 1942).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Restoration Potential: See Mitchell (1988) for specifications for the construction and placement of nest boxes.

Biological Research Needs: Breeding biology and behavior need study. Research is needed on the degree of competition with introduced species such as the house sparrow and long-term impacts of competition on population abundance and distribution. Research is also needed on the extent of ecological overlap with the tree swallow, which shares breeding habitat (ADFG 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in national parks, other protected areas, or remote locations that provide effective protection.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Violet-green swallow

The violet-green swallow (Tachycineta thalassina) is a small North American swallow.

Their breeding habitat is semi-open areas in western North America from Alaska to Mexico. They nest in cavities in a tree or rock crevice, sometimes forming small colonies.

They migrate in flocks to Central and northern South America.

These birds often forage in flocks, usually flying relatively high but sometimes flying low over water. They eat insects including mosquitoes, butterflies, mayflies and moths.

Looks[edit]

Adults are velvet green on their upperparts with white underparts and a forked tail; they have white patches on the side of the rump. The head is usually more coppery or brownish than the back, and the rump is a glossy violet color. In adult males, the white throat area extends behind and above the eyes; adult females are duller. Immature birds are brown on the upperparts.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species was originally named Hirundo thalassinus. Three subspecies are recognized: Tachycineta thalassina lepida breeds from Alaska and southwest Alberta to central Baja California and southern New Mexico, T. t. thalassina breeds on the Mexican plateau from southern Chihuahua to Oaxaca and Veracruz (but not on the east coast) and T. t. brachyptera breeds in Baja California and the coastal plain of southern Sonora (Brown et al. 1992). The distinction between lepida and thalassina is questionable (Brown et al. 1992). See Sheldon and Winkler (1993) for information on intergeneric phylogenetic relationships of Hirundinidae based on DNA.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!