Articles on this page are available in 1 other language: Spanish (9) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tyrannus savana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTATATTTAATTTTTGGTGCCTGAGCCGGTATAATTGGTACCGCCCTAAGCCTTCTTATCCGAGCAGAACTAGGACAACCAGGAACCCTCTTAGGAGACGACCAAATCTATAATGTAATCGTTACTGCTCACGCTTTCGTAATAATCTTTTTCATAGTAATACCTATTATAATTGGGGGATTTGGCAACTGACTAGTCCCCTTAATAATTGGCGCCCCAGACATAGCATTCCCACGCATGAACAATATAAGTTTCTGACTACTTCCCCCATCATTCCTTCTCCTTCTAGCTTCATCTACAGTAGAAGCCGGAGTCGGAACCGGATGAACTGTCTACCCACCATTAGCTGGCAATCTAGCACATGCCGGAGCTTCAGTAGACCTAGCTATCTTCTCACTTCACCTTGCAGGTGTTTCTTCAATTCTAGGTGCAATCAACTTTATTACCACTGCAATCAACATAAAACCACCAGCCCTATCACAGTATCAAACACCTCTATTTGTATGATCTGTCCTAATCACTGCAGTTCTTCTTCTCCTCTCTCTCCCAGTCCTCGCTGCCGGCATCACCATACTATTAACAGACCGTAACCTTAACACTACATTCTTCGACCCCGCAGGAGGCGGAGATCCAGTCTTATACCAACACTTATTCTGATTCTTTGGCCACCCAGAAGTTTATATCCTCATCCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tyrannus savana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 5,000,000-50,000,000 individuals (A. Panjabi in litt. 2008).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Fork-tailed flycatcher

The fork-tailed flycatcher (Tyrannus savana) is a passerine bird of the tyrant flycatcher family, and is the member of a genus typically referred to as kingbirds.

Description and ecology[edit]

This bird occurs in a wide variety of habitats including pastures, riparian forests, and open residential areas with scattered trees. Its breeding range is from central Mexico to central Argentina. In most of this range it is usually found year-round, but in the southern parts of its range it retreats northward for the winter. This species is also known to wander widely. It occurs almost annually in the eastern United States seaboard and Canada.

This flycatcher builds a shallow cup nest 1–10 metres (3 ft 3 in–32 ft 10 in) high in a shrub or short tree. Females normally lay two or three eggs.

The fork-tailed flycatcher is white below, gray above, and has a black cap. Males sometimes show a yellow crown stripe. Males also have an extremely long forked tail, of even greater length than that of their cousin, the scissor-tailed flycatcher. Females have a somewhat shorter tail, while it is significantly shorter in juveniles. Males are 37–41 centimetres (15–16 in) in length; females, 28–30 centimetres (11–12 in), including tail. They weigh only 28–32 grams (0.99–1.13 oz), much less than closely related kingbirds, which are half the total length of this species. The fork-tailed flycatcher has the longest tail relative to body size of any bird on earth.[2] The tail in adult males is 2–3 times longer than the length of the bird from the bill to the base of the tail.

This species is primarily an insectivore, but will switch to berries and small fruits during winter if insects become scarce.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!