Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Brief Summary

The Tropical Kingbird (Tyrannus melancholicus) is a large tyrant flycatcher with a relatively large bill and long, slightly notched tail. The overall length is 18.4-23.0 cm (7.2-9 in) and mass is 32-43 g. The top and sides of the head are gray with dusky auriculars and lores. They have a concealed reddish-orange crown- patch (smaller in female). The back and rump is grayish olive. The wings are dull brown or blackish, coverts edged gray and secondaries edged whitish. In males, the inner webs of the outer primaries are distinctly notched (females slightly so). The tail and uppertail-coverts are brownish black and slightly notched. Throat is grayish white, shading to pale gray on foreneck. The remaining underparts are yellow; chest tinged olive; bill and feet black. The sexes are similar except where noted above, and there is almost no seasonal change in plumage. Immatures closely resemble adults, but may be distinguished primarily by red feathers in crown reduced or lacking, and notches on all or most outer primaries lacking.

Breeds in southeastern Arizona (uncommon and local), south through portions of Mexico and Central America south to central Peru, Guianas, and central Argentina. Northern Winter: Sonora and northeastern Mexico south through breeding range, very rarely to Pacific Coast.

Their voice is twittering trills. This species is one of a group of Mexican birds that make a post-breeding reverse migration in the late summer and fall northward along the Pacific Coast (ENature 2003). It is as aggressive against intruders like the great kiskadee and will chase after big birds like the yellow-headed caracara. Adults have been taken by Aplomado Falcons in Mexico. Swallow-tailed Kites and Chestnut-mandibled Toucans depredate eggs and nestlings.

  • Arizona Game and Fish Department. 2003. Tyrannus melancholicus. Unpublished abstract compiled and edited by the Heritage Data Management System, Arizona Game and Fish Department, Phoenix, AZ
Public Domain

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

from wikipedia

tropical kingbird

From Wikipedia, the free encyclopedia Tropical Kingbird Tyrannus-melancholicus-001.jpg Conservation status
Least Concern (IUCN 3.1)[1] Scientific classification Kingdom: Animalia Phylum: Chordata Class: Aves Order: Passeriformes Family: Tyrannidae Genus: Tyrannus Species: T. melancholicus Binomial name Tyrannus melancholicus
(Vieillot, 1819) Dstonek 17035.jpg

The Tropical Kingbird (Tyrannus melancholicus) is a large tyrant flycatcher. This bird breeds from southern Arizona and the lower Rio Grande Valley of Texas in the USA through Central America, South America as far as south as central Argentina and western Peru, and on Trinidad and Tobago. Birds from the northernmost and southern breeding areas migrate to warmer parts of the range after breeding.

Description and ecology

An adult Tropical Kingbird is 22 cm (8.7 in) long and weighs 39 g (1.4 oz). The head is pale grey, with a darker eye mask, an orange crown stripe, and a heavy grey bill. The back is greyish-green, and the wing and forked tail are brown. The throat is pale grey, becoming olive on the breast, with the rest of the underparts being yellow. The sexes are similar, but young birds have pale buff edges on the wing coverts.

The call is a high-pitched twittering trill, tree-e-e-e-e-e-e, with a more complex version sung by the male at dawn.

Their breeding habitat is semi-open areas with trees and shrubs, including gardens and roadsides. Tropical Kingbirds like to observe their surroundings from a prominent open perch, usually high in a tree, undertaking long sally flights to acrobatically catch insects in mid-air, sometimes hovering to pick food off vegetation.[2][3] They also eat some fruit from such diverse species as Tamanqueiro (Alchornea glandulosa), the Annonaceae, Cymbopetalum mayanum and Gumbo-limbo (Bursera simaruba);[3][4] foraging for these even in disturbed habitat. As they keep mainly to the upper levels of trees, they find little profit in following mixed-species feeding flocks in the understory.[5]

These birds aggressively defend their territory against intruders, even much larger birds such as Magnificent Frigatebirds, toucans, caracaras or hawks. In a study in Parque Nacional de La Macarena of Colombia, parasitism by microfilariae and trypanosomas (presumably T. everetti) was infrequently recorded in Tropical Kindbirds.[6]

They make a flimsy cup nest in a tree. The female incubates the typical clutch of two or three cream-colored eggs, which are marked with reddish-brown, for 16 days, with about 18–19 further days to fledging.

Widespread, common and adapatable, the Tropical Kingbird is not considered a threatened species by the IUCN.[1]

References

  1. BirdLife International (2012). "Tyrannus melancholicus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013.
  2. de A. Gabriel, Vagner & Pizo, Marco A. (2005): Foraging behavior of tyrant flycatchers (Aves, Tyrannidae) in Brazil. Revista Brasileira de Zoologia 22 (4): 1072–1077 [English with Portuguese abstract]. doi:10.1590/S0101-81752005000400036 PDF fulltext
  3. Pascotto, Márcia Cristina (2006): Avifauna dispersora de sementes de Alchornea glandulosa (Euphorbiaceae) em uma área de mata ciliar no estado de São Paulo [Seed dispersal of Alchornea glandulosa (Euphorbiaceae) by birds in a gallery forest in São Paulo, southeastern Brazil.]. Revista Brasileira de Ornitologia 14 (3): 291–296 [Portuguese with English abstract]. PDF fulltext
  4. Foster, Mercedes S. (2007): The potential of fruiting trees to enhance converted habitats for migrating birds in southern Mexico. Bird Conservation International 17 (1): 45–61. doi:10.1017/S0959270906000554
  5. Machado, C. G. (1999): A composição dos bandos mistos de aves na Mata Atlântica da Serra de Paranapiacaba, no sudeste brasileiro [Mixed flocks of birds in Atlantic Rain Forest in Serra de Paranapiacaba, southeastern Brazil]. Revista Brasileira de Biologia 59 (1): 75–85 [Portuguese with English abstract]. doi:10.1590/S0034-71081999000100010 PDF fulltext
  6. Basto, Natalia; Rodríguez, Oscar A.; Marinkelle, Cornelis J.; Gutierrez, Rafael & Matta, Nubia Estela (2006): Haematozoa in birds from la Macarena National Natural Park (Colombia). Caldasia 28 (2): 371–377 [English with Spanish abstract]. PDF fulltext

External links

Wikimedia Commons has media related to Tyrannus melancholicus. Wikispecies has information related to: Tyrannus melancholicus

Creative Commons Attribution 3.0 (CC BY 3.0)

© wikipedia

Supplier: петя спасова

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDS: southeastern Arizona (uncommon and local), south through portions of Mexico and Central America south to central Peru, Guianas, and central Argentina. NORTHERN WINTER: Sonora and northeastern Mexico south through breeding range (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Tyrannus melancholicus breeds from southeastern Arizona (Nearctic Region) to South America (Neotropical Region). Its winters are spent in Mexico (Nearctic Region) to South America (Neotropical Region).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Tyrannus melancholicus has a long, dark forked tail and a fairly large bill. It weighs 32 to 43 g, is 18 to 23 cm long and has a wingspan of about 12 cm. Its head is a pale gray with contrasting darker cheeks and a patch of reddish orange on its crown. It has grayish-olive upperparts, a pale throat, a darker upper breast and a bright yellow lower breast. The plumage is not greatly affected by seasonal change. The sexes are similar except for the size of the reddish-orange crown-patch and the difference in shape of the outer primaries (males' primaries are more distinctly notched). Females tend to weigh slightly more than males. Although juvenile tropical kingbirds are physically similar to adults, they have browner upperparts and pale edges to their wings.

Tropical kingbirds are most similar to Couch's kingbirds (Tyrannus couchii) but can be distinguished by their call. Additionally, tropical kingbirds, although slightly smaller, have a longer bill than Couch's kingbirds.

The subspecies Tyrannus melancholicus satrapa is paler in color and smaller than T. melancholicus. 

Range mass: 32 to 43 g.

Range length: 18 to 23 cm.

Average wingspan: 12 cm.

Sexual Dimorphism: female larger; sexes colored or patterned differently

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 24 cm

Weight: 40 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Situations with scattered trees, savanna, open woodland, forest edge, plantations, residential areas and agricultural lands (Tropical to Temperate zones) (AOU 1983). Occurs in lowlands near water in Arizona. In Arizona, often nests in cottonwoods. Usually nests on a horizontal branch of a tree, 2-12 m (usually below 4.5 m) above ground (Terres 1980), also in shrubs, sometimes low above water (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tropical kingbirds are found in open woodlands, (particularly cottonwoods) that are near ponds or flowing streams. They can be found up to 2000 m in elevation. They inhabit open or semi-open country, avoiding densely forested areas, and can be found in temperate and tropical climates. Tropical kingbirds may also live in parks and suburbs.

Range elevation: 2000 (high) m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: suburban ; riparian

  • Stouffer, P., R. Chesser. 1998. Tropical Kingbird (Tyrannus melancholicus). A Poole, F Gill, eds. The Birds of North America, Vol. 358. The Academy of Natural Sciences, Philadelphia, and The American Ornithologist's Union, Washington, D.C.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeding populations in U.S. and northern Mexico are migratory. Southernmost populations are partially migratory (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Catches flying insects in the air; also picks insects off low vegetation or on the ground. Frequently eats berries, plucked while perched or in flight.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Tyrannus melancholicus is primarily an insectivore; it also occasionally feeds on fruit. It feeds mostly on flying insects, including Coleoptera (beetles), Hymenoptera (particularly bees and wasps), Isoptera (termites), Lepidoptera (butterflies and moths), Odonata (dragonflies), and Orthoptera (grasshoppers). Its fruit diet consists of seeded fruits and berries.

Animal Foods: insects

Plant Foods: fruit

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Tyrannus melancholicus acts as a host for various species of cowbirds. This means that the cowbirds will lay their eggs in a tropical kingbird's nest, and the tropical kingbird will raise the cowbird young as if it were its own. It is also host to many species of parasites. These include parasites that live in the bird's blood, body cavity, and on its skin. Nasal mites have also been found living in T. melancholicus. 

Tyrannus melancholicus also plays an important role in seed dispersal, and as an insectivore it serves as an important predator for insects.

Ecosystem Impact: disperses seeds

  • Wutherich, D., A. Azocar, C. Garcia-Nunez, J. Silva. 2001. Seed dispersal in Palicourea rigida, a common treelet species from neotropical savannas. Journal of Tropical Ecology, 17: 449-458.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Aplomado falcons (Falco femoralis) have been known to prey on adult tropical kingbirds, while eggs and young have been attacked by swallow-tailed kites (Elanoides forficatus) and chestnut-mandibled toucans (Ramphastos swainsonii). Tyrannus melancholicus will aggressively harass a flying predator by dipping and dodging toward it from behind. It will also mob perched predators, attacking either individually, in pairs or in small groups.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Tyrannus melancholicus preys on:
Insecta

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Tyrannus melancholicus is prey of:
Elanoides forficatus
Falco femoralis
Ramphastos swainsonii

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

As a songbird, Tyrannus melancholicus communicates primarily through vocalizations. It will call when greeting another tropical kingbird and when chasing a predator. A male will also call when it is courting and following its mate.

The common call, which varies depending on the context, sounds like a "tere-ee-ee, tril-il-il-iil-l," or "tre-e-e-e-eip."

Tropical kingbird's songs are given throughout the day, even in the middle of the day when most other birds are silent. They also sing a song known as the Dawn Song, which they begin before sunrise, before most of the other birds begin to sing. Tyrannus melancholicus will stop singing the Dawn Song by sunrise and will not repeat it until the dawn of the next morning.

When courting, a perched male will flap its wings, sometimes lifting off from its perched position.

Tyrannus melancholicus may show aggressive behavior when defending its territory; chases often occur during the breeding season. Such aggressive behavior may include ruffling of crown feathers and a harsh series of vocalized twitters.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Predators are the main cause of mortality among T. melancholicus. Nest failure, which may occur from overheating, strong winds, and precipitation, is also a threat to T. melancholicus.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Egg dates: March-July in Costa Rica, April-July in Mexico; May-June in Arizona (Terres 1980). Clutch size usually is 2-3 or 3-4. Incubation, by female, lasts 15-16 days. Young leave nest 18-19 days after hatching (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tyrannus melancholicus is monogamous. The male will advertise his potential nesting site by calling. Calling is an important aspect of pair-bond formation; the pair bonds can last throughout the year or for just one mating season.

When courting, a perched male will flap its wings, sometimes lifting off from its perched position.

Tyrannus melancholicus may show aggressive behavior when defending its territory; chases often occur during the breeding season. Such aggressive behavior may include ruffling of crown feathers and a harsh series of vocalized twitters.

Mating System: monogamous

Because tropical kingbirds have a broad breeding range, the timing of breeding varies from place to place. They have one brood per season, with a clutch of 2 to 4 eggs. The egg-laying interval is between 1 and 2 days, and incubation lasts 15 to 16 days. Like many other birds, the nest is an open-cup that is usually located mid-story or in the canopy. The chicks fledge in 18 to 19 days and are independent in 32 to 33 days.

Breeding interval: Tropical kingbirds have one brood per season.

Breeding season: Breeding season varies throughout the range.

Range eggs per season: 2 to 4.

Range time to hatching: 15 to 16 days.

Range fledging age: 18 to 19 days.

Range time to independence: 32 to 33 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Both the incubating and the brooding is done by the female only; nestlings are brooded until they are 10 days old. During this time, the female may leave the nest to forage for food, but she makes sure to forage near the nest. The male remains close to the nest to defend it, sometimes moving even closer if the female leaves the nest to forage for food. Both the female and male, however, take on the responsibility of feeding the nestlings insects and berries. It takes the nestlings approximately 18 to 19 days to fledge, and after fledging they are fed by their parents for at least another 2 weeks.

Parental Investment: no parental involvement; altricial ; pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female)

  • USGS, Northern Prairie Wildlife Research Center. 2003. "Tropical Kingbird, Tyrannus melancholicus" (On-line). Accessed March 31, 2004 at http://www.mbr-pwrc.usgs.gov/id/framlst/i4460id.html.
  • Stouffer, P., R. Chesser. 1998. Tropical Kingbird (Tyrannus melancholicus). A Poole, F Gill, eds. The Birds of North America, Vol. 358. The Academy of Natural Sciences, Philadelphia, and The American Ornithologist's Union, Washington, D.C.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tyrannus melancholicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGACTTTCATCAACCGATGATTATTCTCAACAAACCACAAAGACATTGGTACATTATATTTAATTTTTGGCGCCTGAGCCGGTATAATTGGTACCGCCCTAAGCCTTCTTATTCGAGCAGAACTAGGACAACCAGGAACCCTCTTAGGAGACGACCAGATCTATAATGTAATCGTTACTGCTCACGCTTTCGTAATAATCTTTTTCATAGTAATACCTATTATAATTGGAGGATTTGGCAACTGACTAGTCCCCCTAATAATTGGCGCCCCAGACATAGCATTCCCACGCATGAACAATATAAGTTTCTGACTACTACCCCCATCATTCCTTCTCCTTCTAGCTTCATCTACAGTAGAAGCCGGAGTCGGGACCGGATGAACTGTCTACCCACCATTAGCTGGCAATCTAGCACATGCCGGAGCTTCAGTAGACCTAGCTATCTTCTCACTTCACCTTGCAGGTGTTTCCTCAATTCTAGGTGCAATCAACTTTATTACCACTGCAATCAACATAAAACCACCAGCCCTATCACAGTATCAAACACCTCTATTTGTATGATCTGTCCTAATCACTGCAGTTCTTCTTCTCCTCTCTCTCCCAGTCCTCGCTGCCGGCATCACCATACTATTAACAGACCGTAATCTTAACACTACATTCTTCGACCCCGCAGGAGGCGGAGATCCAGTCTTATACCAACACTTATTCTGATTCTTTGGCCACCCAGAAGTCTACATCCTCATCCTACCAGGCTTCGGAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tyrannus melancholicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N3B - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tropical kingbirds are protected under the US Migratory Bird Treaty Act.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of Tyrannus melancholicus on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Tyrannus melancholicus is beneficial in agricultural areas because it feeds on insects that may be crop pests (for example, grasshoppers).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tropical kingbird

Dstonek 17035.jpg

The tropical kingbird (Tyrannus melancholicus) is a large tyrant flycatcher. This bird breeds from southern Arizona and the lower Rio Grande Valley of Texas in the United States through Central America, South America as far as south as central Argentina and western Peru, and on Trinidad and Tobago. Birds from the northernmost and southern breeding areas migrate to warmer parts of the range after breeding.

Description and ecology[edit]

An adult tropical kingbird is 22 cm (8.7 in) long and weighs 39 g (1.4 oz). The head is pale gray, with a darker eye mask, an orange crown stripe, and a heavy gray bill. The back is grayish-green, and the wing and forked tail are brown. The throat is pale gray, becoming olive on the breast, with the rest of the underparts being yellow. The sexes are similar, but young birds have pale buff edges on the wing coverts.

The call is a high-pitched twittering trill, tree-e-e-e-e-e-e, with a more complex version sung by the male at dawn.

Their breeding habitat is semi-open areas with trees and shrubs, including gardens and roadsides. Tropical kingbirds like to observe their surroundings from a prominent open perch, usually high in a tree, undertaking long sally flights to acrobatically catch insects in mid-air (hawking), sometimes hovering to pick food off vegetation (gleaning).[2][3] They also eat some fruit from such diverse species as tamanqueiro (Alchornea glandulosa), the Annonaceae, Cymbopetalum mayanum and gumbo-limbo (Bursera simaruba);[3][4] foraging for these even in disturbed habitat. As they keep mainly to the upper levels of trees, they find little profit in following mixed-species feeding flocks in the understory.[5]

These birds aggressively defend their territory against intruders, even much larger birds such as magnificent frigatebirds, toucans, caracaras or hawks. In a study in Parque Nacional de La Macarena of Colombia, parasitism by microfilariae and trypanosomas (presumably T. everetti) was infrequently recorded in Tropical Kindbirds.[6]

They make a flimsy cup nest in a tree. The female incubates the typical clutch of two or three cream-colored eggs, which are marked with reddish-brown, for 16 days, with about 18–19 further days to fledging.

Widespread, common and adaptable, the tropical kingbird is not considered a threatened species by the IUCN.[1]

References[edit]

  1. ^ a b BirdLife International (2012). "Tyrannus melancholicus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ de A. Gabriel, Vagner & Pizo, Marco A. (2005): Foraging behavior of tyrant flycatchers (Aves, Tyrannidae) in Brazil. Revista Brasileira de Zoologia 22 (4): 1072–1077 [English with Portuguese abstract]. doi:10.1590/S0101-81752005000400036 PDF fulltext
  3. ^ a b Pascotto, Márcia Cristina (2006): Avifauna dispersora de sementes de Alchornea glandulosa (Euphorbiaceae) em uma área de mata ciliar no estado de São Paulo [Seed dispersal of Alchornea glandulosa (Euphorbiaceae) by birds in a gallery forest in São Paulo, southeastern Brazil.]. Revista Brasileira de Ornitologia 14 (3): 291–296 [Portuguese with English abstract]. PDF fulltext
  4. ^ Foster, Mercedes S. (2007): The potential of fruiting trees to enhance converted habitats for migrating birds in southern Mexico. Bird Conservation International 17 (1): 45–61. doi:10.1017/S0959270906000554
  5. ^ Machado, C. G. (1999): A composição dos bandos mistos de aves na Mata Atlântica da Serra de Paranapiacaba, no sudeste brasileiro [Mixed flocks of birds in Atlantic Rain Forest in Serra de Paranapiacaba, southeastern Brazil]. Revista Brasileira de Biologia 59 (1): 75–85 [Portuguese with English abstract]. doi:10.1590/S0034-71081999000100010 PDF fulltext
  6. ^ Basto, Natalia; Rodríguez, Oscar A.; Marinkelle, Cornelis J.; Gutierrez, Rafael & Matta, Nubia Estela (2006): Haematozoa in birds from la Macarena National Natural Park (Colombia). Caldasia 28 (2): 371–377 [English with Spanish abstract]. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Populations in Arizona and western Mexico sometimes have been treated as a separate species, T. OCCIDENTALIS [West Mexican Kingbird], but the latter is not distinguishable from the wide-ranging Middle American subspecies of T. MELANCHOLICUS (Sibley and Monroe 1990, AOU 1998). T. MELANCHOLICUS and T. COUCHII have been regarded as conspecific by some authors, but Traylor (1979, Auk 96:221-233) found them to be distinct species that are extensively sympatric.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!