Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Brief Summary

The spotted nutcracker is a distinctive, relatively large songbird that lives in the conifer forests of Europe and Asia and specializes on pine seeds and nuts. It has broad wings, a strong bill with short nasal tufts, a short tail, and striking white spots on a dark brown body. Wings and crown are blacker, and the lores and vent are white.

Some authors consider the nutcracker in the Himalayas to be a distinct species, the larger spotted nutcracker, Nucifraga multipunctata.

  • Madge, S., & Burn, H. (1994). Crows and jays: a guide to the crows, jays and magpies of the world. London, UK: A & C Black.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Cyndy Parr

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description of Nucifraga caryocatactes

De \'\'notenkraker\'\' (\'Nucifraga caryocatactes\') is een vogel, die behoort tot de kraaiachtigen (Corvidae). Deze vogel is in Nederland een invasiegast, maar broedt in België in beperkte mate.Lars Svensson & Peter J Grant, ANWB vogelgids van Europa, ANWB Media Boeken, 2005, ISBN 9018020923 pagina 332 De notenkraker komt algemeen voor in de Alpen, Scandinavië, de Balkan, de Karpaten en Noordoost-Europa. == Etymologie en taxonomie == Nucifraga is Latijn, samengesteld uit nux (=noot) en fraga (=breken). Caryocatactes is grieks en een samentrekking van karuon (= noot) en katagnunai (= breken).  Notekrakers 30 cm. Kop, boven- en onderdelen chocoladebruin met witte vlekken (behalve op kruin), vleugels en staart zwartachtig, witte staartrand. Onderstaart en anaalstreek wit. Lange, krachtige, zwarte snavel. Juveniel gelijk maar iets lichter gekleurd en minder gevlekt. Vlucht langzaam en zwaar. Gewone roep een hoog, raspend \'tsjerr\' en een gaaiachtig \'skraaawk\'. In broedtijd ook een scala van vloeiende, babbelende en klikkende geluiden. Plaatselijk een algemene standvogel.
Creative Commons Attribution 3.0 (CC BY 3.0)

Quest

Source: BioPedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 16.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nucifraga caryocatactes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTTCTCCAACCCACAAAGACATTGGCACCCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTTATCCGAGCAGAACTAGGCCAACCCGGTGCACTGCTAGGAGACGACCAAATCTACAACGTCATTGTTACAGCCCATGCTTTCGTCATAATCTTCTTTATAGTAATACCAATCATAATCGGGGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGTGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTTCTCCCTCCTTCATTCCTCCTCCTCCTAGCCTCCTCTACAGTAGAAGCAGGAGTAGGAACAGGATGAACTGTATACCCCCCACTAGCCGGCAACCTAGCCCATGCCGGAGCTTCAGTTGACCTGGCCATTTTCTCACTCCACCTAGCAGGTATCTCCTCCATCCTAGGGGCAATCAACTTCATCACCACAGCAATCAACATAAAACCTCCAGCCCTGTCACAATACCAAACACCCCTGTTCGTGTGATCCGTACTAATTACCGCAGTACTACTTCTTCTTTCCCTACCCGTTCTAGCTGCCGGAATTACTATGCTTCTAACAGACCGTAACCTTAACACTACATTCTTTGATCCTGCGGGAGGAGGAGACCCAGTGCTATACCAACATCTATTCTGATTCTTCGGTCACCCAGAAGTTTACATCCTAATTCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Nucifraga caryocatactes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 20
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 400,000-860,000 breeding pairs, equating to 1,200,000-2,580,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 2,450,000-10,300,000 individuals, although further validation of this estimate is needed. National population estimates include: c.10,000-100,000 breeding pairs in China; c.100-100,000 breeding pairs in Taiwan; c.100-10,000 breeding pairs in Korea; c.100-10,000 breeding pairs in Japan and c.10,000-100,000 breeding pairs in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Spotted nutcracker

The spotted nutcracker, Eurasian nutcracker, or just nutcracker, (Nucifraga caryocatactes) is a passerine bird slightly larger than the Eurasian jay. It has a much larger bill and a slimmer looking head without any crest. The feathering over its body is predominantly a chocolate brown with distinct white spots and streaks. The wings and upper tail are virtually black with a greenish-blue gloss. It is one of three species of nutcracker. The large-spotted nutcracker (Nucifraga multipunctata), was formerly considered a subspecies. The other, Clark's nutcracker (Nucifraga columbiana), occurs in western North America.

Taxonomy[edit]

The nutcracker was one of the many species originally described by Linnaeus in his 18th century work, Systema Naturae, and it still bears its original name of Nucifraga caryocatactes.[2] The scientific name is a reduplication, with Nucifraga based on Latin: nucis nut + frangere to shatter, and caryocatactes based on Greek: karuon nut + kataseio to shatter.[3] The common English name nutcracker first appears in 1738 in a translation of a German travel guide,[4] where it is a calque on the German name Nußknacker,[5] as the bird was not recorded in England until 1753.[6] Other Germanic languages have etymologically related names: Danish: nøddekrige; Dutch: notenkraker; Norwegian: nøttekråke; Swedish: nötkråka.

Subspecies[edit]

There are nine recognised subspecies[7][8][9][10]

  • nominate caryocatactes (Linnaeus, 1785) Scandinavia to n and e Europe; Caucasus and n Kazakhstan; winters to s Russia;
  • macrorhynchos (Brehm, 1823) n and ne Asia; irruptions to n Iran, Korea and n China; vagrant Turkey
  • rothschildi (Hartert, 1903) Tian Shan and Dzungarian Alatau mountains, Kazakhstan and China;
  • japonica (Hartert, 1897) central and s Kuril Islands, Hokkaido, Honshū and Hondo, Japan;
  • owstoni (Ingram, 1910) Taiwan;
  • interdicta (Kleinschmidt and Weigold, 1922) mountains of n China (Liaoning);
  • hemispila (Vigors, 1831) Himalayas (w Nepal to s Kashmir);
  • macella (Thayer and Bangs, 1909) e Himalayas to s Tibet, w Nepal, n Myanmar and sw China;
  • yunnanensis (Ingram 1910) se China (Yunnan).

Description[edit]

Spotted nutcracker, (Nucifraga caryocatactes)

The spotted nutcracker is a dark brown, broad-winged, short-tailed corvid. Body plumage is mid to dark chocolate brown, heavily spotted with white on face, neck, mantle and underparts. It has a large white loral spot, a white eye-ring, blackish brown cap extending onto the nape, dark blackish wings with a greenish-blue gloss, all white vent, and dark tail with white corners above and a white terminal band on the undertail. In flight, broad wings, white vent and short tail are noticeable; the flight undulating. The black bill is slender and rather long, sharply pointed, and varies in size amongst races. The iris, legs and feet are black.

Nutcrackers range from 32–38 cm in length (from tip of beak to tip of tail) and have a wingspan ranging from 49–53 cm.

The voice is similar to that of the Eurasian jay and is loud and harsh. It is described as kraak-kraak-kraak-kraak.

Behaviour[edit]

Feeding[edit]

in Western Uttarakhand, India.

The most important food resources for this species are the seeds (pine nuts) of various Pines (Pinus sp.), principally the cold-climate (far northern and high altitude) species of white pine (Pinus subgenus Strobus) with large seeds: P. armandii, P. cembra, P. koraiensis, P. parviflora, P. peuce, P. pumila, P. sibirica and P. wallichiana, and also the two lacebark pines in subgenus Ducampopinus, P. bungeana and P. gerardiana. In some regions, where none of these pines occur, the seeds of spruce (Picea sp.) and hazel nuts (Corylus sp.) form an important part of the diet too. The forms that take hazel nuts have thicker bills for cracking their hard shells, with a special ridge on the inside of the bill edge near the base. If the shell is too hard, it holds the nut between its feet and hacks at it with its bill like a chisel.

Surplus seed is always stored for later use and it is this species that is responsible for the sowing of new trees of their favoured pines, including the re-establishment of the Swiss pine (Pinus cembra) over large areas in the Alps of central Europe formerly cleared by man.

Various insects are also taken, and also small birds, their eggs and nestlings, small rodents and carrion such as roadkills. It digs out bumble bee and wasp nests avidly to get at the grubs.

Breeding[edit]

Egg of spotted nutcracker

Nutcracker couples stay together for life and their territory expands between 20 and 30 acres. Nesting is always early in this species across its whole range, so as to make the best use of pine nuts stored the previous autumn. The nest is usually built high in a conifer (sometimes broadleaved trees are used) and usually on the sunny side. There are normally 2-4 eggs laid and incubated for 18 days. Both sexes feed the young which are usually fledged by about 23 days and stay with their parents for many months, following them to learn the food storage techniques essential for survival in their harsh environment.

Distribution[edit]

The spotted nutcracker has an extensive range forming a broad swathe east-west from Scandinavia right across northern Europe, Siberia and to eastern Asia, including Japan, inhabiting the huge taiga conifer forests in the north.

Three further disjunct populations occur in mountain conifer forests further south, one centered on the mountains of central and southeast Europe (the Alps, the Carpathians and the Balkan Peninsula mountains); another in the western Himalaya; and the third in western China seaboard and separated from the northern population by a relatively small gap in the north centre of China. See subspecies list above for race distributions. Some of the populations can be separated on bill size.

This species has a large range, extending over 10,000,000 km² globally. It also has a large global population, with an estimate of between 800,000-1,700,000 individuals in Europe.[11]

Spotted nutcrackers are not migratory, but will erupt out of range when a cone crop failure leaves them short of a food supply, the thin-billed eastern race macrorhynchos being the more likely to do this.[8] Britain records about 8 vagrants per year, but in 1968 over 300 nutcrackers visited Britain as part of a larger irruption into western Europe, probably due to a spell of early cold weather in Siberia.[12]

References[edit]

  1. ^ BirdLife International (2012). "Nucifraga caryocatactes". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. (in Latin). Holmiae. (Laurentii Salvii). p. 105. 
  3. ^ "BTO Web: BirdFacts > crows > Nutcracker". 
  4. ^ John Ray. A Collection of Curious Travels and Voyages. 1738. Vol. II xi. 181.
  5. ^ See, for example, Brehms Thierleben. Allgemeine Kunde des Thierreichs, Fünfter Band, Zweite Abtheilung: Vögel, Zweiter Band: Raubvögel, Sperlingsvögel und Girrvögel. Leipzig: Verlag des Bibliographischen Instituts, 1882. S. 446-450.
  6. ^ "BTO Web: BirdFacts > crows > Nutcracker". 
  7. ^ "GlobalTwitcher.com: Eurasian Jackdaw Corvus monedula". 
  8. ^ a b Lars Svensson et al., Collins Bird Guide. London: HarperCollins, 1999.
  9. ^ "The OSME Region List of Birds – Passerines – Consultative Draft October 2007". 
  10. ^ 中国科学院动物研究所. 星鸦云南亚种. 《中国动物物种编目数据库》 (in Chinese). 中国科学院微生物研究所. Retrieved April 4, 2009. 
  11. ^ "Birdlife International. Data Zone. Species factsheet: Nucifraga caryocatactes. Downloaded 20/11/2008". 
  12. ^ "BTO Web: BirdFacts > crows > Nutcracker". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!