Overview

Distribution

Range

Rocks, cliffs and hills of e and se Africa.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Corvus albicollis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACTCTGTACCTGATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGCCTCCTTATCCGAGCAGAACTAGGTCAACCGGGTGCTCTACTAGGAGAT---GACCAAATCTACAATGTAATCGTTACAGCTCATGCCTTCGTCATAATCTTCTTCATAGTAATACCAATCATAATCGGGGGATTTGGAAACTGACTAGTTCCTCTAATGATCGGTGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCCTCATTCCTTCTCCTCCTAGCCTCTTCCACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTGTATCCACCACTGGCTGGTAATCTAGCCCATGCTGGAGCCTCAGTCGACCTAGCTATCTTCTCACTACACCTAGCAGGTATTTCCTCCATCCTAGGAGCAATTAACTTCATTACCACAGCAATCAACATAAAACCTCCAGCCCTATCACAATACCAAACCCCTCTATTCGTATGATCCGTACTAATTACCGCAGTACTACTCCTTCTCTCCCTACCCGTACTTGCTGCCGGAATTACTATGCTTCTAACAGACCGAAACCTTAATACCACATTCTTCGACCCAGCAGGTGGAGGAGACCCAGTACTATACCAACATCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Corvus albicollis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as generally uncommon or locally common (Madge and Burn 1993).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White-necked raven

For the bird formerly known as the American white-necked raven, see Chihuahuan raven.

The white-necked raven (Corvus albicollis) is somewhat smaller (50–54 cm in length) than the common raven or indeed its nearest relative, the thick-billed raven C. crassirostris.

Description[edit]

Profile of head - taken at the Cincinnati Zoo

The white-necked raven has a much shorter tail than the common raven, as well as a deeper bill with a white tip that is almost as strongly arched as that of the thick-billed raven. Though predominantly black, the throat, breast and neck show a faint purple gloss. There is a large patch of white feathers on the back of the lower neck.

Soars well with shallower wingbeats than other Corvidae.[2]

Measurements[edit]

  • Length 50 – 54 cm [3]
  • Wing 376 – 430 mm (17 unsexed birds)[3]
  • Weight 762 - 865g [3]

Voice[edit]

Often described as a raven with a sore throat, it has very similar calls to the common raven, but with a more husky note. It has a croak like the raven but with a more whispering note added.

Distribution and habitat[edit]

It occurs in eastern and southern Africa in open, mountainous country. It is quite commonly found in small towns and villages as long as there are mountains or hills for roosting and nesting relatively nearby.

Behaviour[edit]

Most of this bird's food is obtained from the ground, but it will take food from trees as well. It has been seen to drop a tortoise from a height on to hard ground, preferably on rocks, and then swoop down to eat it, or even pick it up again if not sufficiently broken. White-necked ravens will also readily take carrion from road kills. Fruit, grain, insects, small reptiles, peanuts and human food are also readily taken and the bird forages in back yards and gardens quite openly.

It is often found in the company of other scavengers such as kites or vultures.

Nests are a bowl of sticks lined with grass hair and wool found mainly on a cliff ledge but will occasionally nest in a tree. There are usually 3-5 eggs laid.

References[edit]

  1. ^ BirdLife International (2012). "Corvus albicollis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Roberts' Birds of Southern Africa. ISBN 0-620-17583-4. 
  3. ^ a b c Roberts' Birds of Southern Africa. The John Voelker Bird Book Fund. p. 477. ISBN 0-620-17583-4. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!