Overview

Distribution

Range

Africa s of the Sahara, Madagascar, Aldabra and Comoro Islands.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

it inhabitats open country with villages and towns nearby.

Creative Commons Attribution 3.0 (CC BY 3.0)

© петя спасова

Supplier: петя спасова

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Corvus albus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Barcode data: Corvus albus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACTCTGTACCTTATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTTATCCGAGCAGAACTAGGCCAACCAGGTGCTCTGCTAGGAGAC---GACCAAATCTACAATGTAATCGTTACAGCTCATGCTTTCGTCATAATCTTCTTCATAGTAATACCAATCATAATCGGGGGATTTGGAAACTGACTAGTTCCTCTAATGATTGGTGCCCCAGATATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTCCCACCTTCATTCCTCCTCCTCCTAGCCTCTTCCACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTATACCCACCACTGGCCGGTAACCTAGCCCACGCTGGAGCCTCAGTCGACCTGGCCATCTTCTCACTACACCTAGCAGGTATTTCATCCATCCTAGGAGCAATTAACTTCATTACCACAGCAATCAACATAAAACCTCCAGCCCTATCACAATACCAAACCCCCCTATTCGTGTGATCCGTACTAATTACCGCAGTACTACTCCTTCTCTCCCTACCCGTACTTGCTGCTGGAATCACTATGCTTCTAACAGACCGAAACCTCAATACCACATTCTTTGACCCAGCAGGTGGAGGAGATCCAGTACTATACCAACATCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as common and locally abundant, although closely associated with human habitation (Madge and Burn 1993).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pied crow

The pied crow (Corvus albus) is a widely distributed African bird species in the crow genus.

Structurally, the pied crow is better thought of as a small crow-sized Raven, especially as it can hybridise with the Somali crow (Dwarf Raven) where their ranges meet in the Horn of Africa. Its behaviour, though, is more typical of the Eurasian carrion crows, and it may be a modern link (along with the Somali crow) between the Eurasian crows and the common raven.

Description[edit]

It is approximately the size of the European carrion crow or a little larger (46–50 cm in length) but has a proportionately larger bill, slightly longer tail and wings, and longer legs. As its name suggests, its glossy black head and neck are interrupted by a large area of white feathering from the shoulders down to the lower breast. The tail, bill and wings are black too. The eyes are dark brown. The white plumage of immature birds is often mixed with black. It resembles the White-necked and thick-billed ravens but has a much smaller bill.[2]

Measurements[edit]

  • Length 46 – 52 cm [3]
  • Wing 328 to 388 mm (17 unsexed birds)[3]
  • Weight 520g [3]

Identification[edit]

In southern Africa the range overlaps with the white-necked raven. The pied crow is slightly smaller and has a white chest and belly with a black, more delicate beak compared to the black chest and belly of the larger white-necked raven which also has a white tipped and weightier beak.[4] It is larger than the black crow.

Voice[edit]

The voice is described as a harsh "ar-ar-ar-ar" or "karh-karh-karh".[5]

Taxonomy[edit]

The pied crow was first described in 1776 by Statius Muller. Its specific name is the Latin adjective albus, meaning "white".

Distribution and habitat[edit]

This species, Africa's most widespread member of the genus Corvus, occurs from Sub-Saharan Africa, specifically Senegal, Sudan, Somalia and Eritrea down to the Cape of Good Hope and on the large island of Madagascar, the Comoros islands, Aldabra group islands, Zanzibar, Pemba and Fernando Po. It inhabits mainly open country with villages and towns nearby. It does not occur in the equatorial rainforest region. It is rarely seen very far from human habitation, though it is not as tied to the urban way of life as the house crow (Corvus splendens) of Asia, and may be encountered far from human habitation in Eritrea.[2]

Pied Crow (Corvus albus) closeup from front.jpg

Behaviour[edit]

In flight

Pied crows are generally encountered in pairs or small groups, although an abundant source of food may bring large numbers of birds. The species behaves in a similar manner to the hooded and carrion crows.[6] In Dakar, birds have been observed mobbing passing ospreys and snake eagles but avoiding black kites.

Diet[edit]

All of its food is obtained from the ground such as insects and other small invertebrates, small reptiles, small mammals, young birds and eggs, grain, peanuts, carrion and any scraps of human food and fruit.[7] It has been recorded killing and eating roosting fruit bats and is frequently seen (sometimes in huge numbers) scavenging around slaughterhouses.

Reproduction[edit]

The nest is usually built in tall, isolated trees, though sometimes smaller specimens are used, depending on availability. The cross supports of telephone poles are also frequently used, and both sexes build the nest. A clutch of 3–6 eggs is laid from September to November (depending on latitude) and are pale green spotted with various shades of brown. The eggs are normally covered when the incubating female leaves the nest. Incubation is 18–19 days and the young are usually fledged by around 45 days. Both sexes rear the young.[6]

References[edit]

  1. ^ BirdLife International (2013). "Corvus albus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Goodwin, p. 132
  3. ^ a b c Roberts' Birds of Southern Africa. The John Voelker Bird Book Fund. p. 474. ISBN 0-620-17583-4. 
  4. ^ Roberts' Birds of Southern Africa. The John Voelker Bird Book Fund. pp. 474–477. ISBN 0-620-17583-4. 
  5. ^ Goodwin, p. 134
  6. ^ a b Goodwin, p. 133
  7. ^ Goodwin, pp. 132-33

Cited text[edit]

  • Goodwin D. (1983). Crows of the World. Queensland University Press, St Lucia, Qld. ISBN 0-7022-1015-3. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!