Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Hairy Woodpeckers (Picoides villosus) occur from Alaska and most of Canada south to the Gulf Coast. In the southwestern United States and from Mexico to Panama they are found in mountain forests (mainly pines, but also in cloud forest in Middle America). They are found in a range of habitats that include large trees, including both open and dense forests.

In its range, the Hairy Woodpecker closely resembles the Downy Woodpecker (Picoides pubescens), but the Downy is much smaller, with a bill that is noticeably proportionately smaller relative to the head (i.e., the bill has a more "stubby" appearance), and the outer tail feathers have black barring that is lacking on the Hairy's tail (these outer feathers instead being entirely white on the Hairy Woodpecker). In both species, the male has a red hindcrown spot that is not present in the female. Hairy and Downy Woodpeckers are often found together, but the Hairy requires larger trees and is usually less common, especially in the eastern portion of its range, and less frequent in suburban settings and parks.

Hairy Woodpeckers eat mainly insects, especially larvae of wood-boring beetles, but also some berries, seeds, and nuts. They sometimes feed on sap at damaged trees (or where their woodpecker cousins the sapsuckers have been at work) and will come to bird feeders for suet. In the course of feeding, the Hairy Woodpecker does more pounding and excavating in trees than do most smaller woodpeckers, consuming large numbers of wood-boring insects.

The male and female maintain separate territories in early winter and pair up in mid-winter, often with their mate from the previous year. The female's winter territory becomes the focus of the nesting territory. Courtship includes the male and female drumming in a duet.. The nest site is a cavity excavated by both male and female, usually around 1 to 18 m above the ground. In the eastern part of the range, mainly deciduous trees are used while in the western part of the range nest cavities tend to be in aspens or dead conifers. The 4 white eggs (sometimes 3, 5, or 6) are incubated by both sexes for around 14 days (the male incubating at night and mainly the female during the day). The nestlings are fed by both parents. Males may forage farther from the nest, making fewer feeding trips with more food per trip. Young leave the nest 28 to 30 days after hatching, but the parents continue to feed them for some time. There is one brood per year.

Hairy Woodpeckers are generally year-round residents. At the northern end of the range, some birds may move south in the winter; in the western part of the range, some birds in the mountains may move to lower elevations in winter.

(Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Dunn, J.L. and J. Alderfer. 2011. National Geographic Field Guide to the Birds of North America. National Geographic Society, Washington, D.C.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

This woodpecker ranges from Alaska to Newfoundland south from northern Mexico to Florida (Palmer and Fowler 1975). Some northern residents migrate south during the winter (Farrand, Jr. 1988), being found in Guatamala, Costa Rica, and Panama (Winkler et al. 1995).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDS: western and central Alaska to northern Saskatchewan and Newfoundland, south to northern Baja California, highlands of Middle America, Gulf Coast, southern Florida, and Bahamas. WINTERS: generally throughout breeding range, with more northern populations partially migratory.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

This bird is approximately 16.5 to 26.7 cm. long. It has a wingspan of 44.5 cm., a tail length of 10.2 cm. and a bill length of 3.4 cm. Black and white streakings or checkerings are evident on the wings. Outer tail feathers are white and do not have black markings. On the male, there is a red patch on the back of the head, black crown, and black eye mask and nape of the neck. The female lacks the red patch. There is also white on the chest, abdomen, back, and rump. (Peterson 1967, Palmer and Fowler 1975, Winkler et al. 1995). Young birds may have red on their crown (Farrand, Jr. 1988).

Range mass: 84.5 to 85.5 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 24 cm

Weight: 70 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from the downy woodpecker in larger size (average length 24 cm vs. 17 cm), larger bill (about as long as head vs. obviously shorter than head), absence of black bars or spots on outer tail feathers (downy generally has spots), and sharper call note (peek! vs. pik). Differs from three-toed and black-backed woodpeckers in lacking dark barring on the sides (may be present on flanks of juveniles).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This woodpecker is found in forested areas, especially where dead trees are standing. Individual's range is a few acres (Palmer and Fowler 1975). In the northwestern to the western United States, Hairy Woodpeckers are found in douglas fir/western hemlock forests, open juniper woodland, and in riparian forests. In the eastern United States, the Hairy Woodpecker is found in all types of forests. In the tropics, this woodpecker is found in the mountains to a maximum of 3400 m in Panama (Winkler et al. 1995). This bird also frequents gardens and residential areas (Farrand, Jr. 1988)

Terrestrial Biomes: forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Forest, open woodland, swamps, well-wooded towns and parks, open situations with scattered trees. Most abundant in mature woods with large old trees suitable for cavity nesting; also common in medium-aged forests; prefers woods with a dense canopy (Bushman and Therres 1988). Uses tree cavities for roosting and winter cover; may excavate new cavities in fall to be used for roosting (Sousa 1987). Sleeps singly in holes usually carved by males (Stiles and Skutch 1989). In the eastern U.S., uses forest areas of 2-4 ha or larger, though a much larger area (maybe 12 ha) may be needed to support a viable breeding population; in Iowa the minimum width of riparian forest necessary to support a breeding population was 40 m (Sousa 1987). Overall, appears to be minimally impacted by forest fragmentation, though a few studies have reported a decline in numbers as forest patch size decreases; the presence of suitable cavity trees is a more important consideration (see Bushman and Therres 1988).

Nests in hole dug mostly by male in live or dead tree or stub, 1.5-18 m (average 9 m) above ground. In most areas, favors dead or dying parts of live trees, especially where fungal heart rot has softened the heartwood. Snag (25 cm or more in DBH) density of 5/ha assumed optimal for reproduction (but may not be adequate for foraging) (Sousa 1987). Nest tree DBH minimally 20 cm; averaged 27-28 cm in New England, 38 cm in Colorado, 41 cm in Virginia, 44 cm in California, and 92 cm in Oregon (Sousa 1987). See Sousa (1987) for fairly detailed summary of nesting habitat characteristics in different regions. Usually excavates new nest hole each year. May nest in utility pole or bird box.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Northernmost breeding populations partially migratory. May migrate between higher and lower elevations in mountainous regions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The majority of their foodstuffs is insects, especially hairy caterpillars and their chrysalids, particularly the gypsy moth. Other insects include ants, grasshoppers and wood-boring beetles, other beetles and their grubs, crickets, and flies. They also eat spiders. They will eat a little vegetable matter including nuts, seeds, and some fruits (Palmer and Fowler 1975, Winkler et al. 1995). Hairy Woodpeckers will feed on suet in backyards (Winkler et al. 1995).

Foraging occurs on trees, bushes, stumps, vines, bamboo, reeds, sugar cane, and rotting branches and other debris on the ground. To obtain an insect, the Hairy Woodpecker will tap, probe, and pry at the bark of a tree, sometimes excavating deep into the bark. In the western United States, when leaves are budding, the Hairy Woodpecker will peck and tear at the buds to get at the hidden insects, in contrast to the Downy Woodpecker that uses probing and soft tapping (Short 1982).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mainly insects (beetles, ants, caterpillars), especially boring larvae, obtained from bark or wood of trunks and branches of trees or from soft shrubs or old giant thistle stalks; also eats other invertebrates and some fruits and nuts (Terres 1980). May concentrate feeding in areas of insect outbreaks. Sometimes feeds on sap from wells drilled in trees by sapsuckers. Seeds may be important food in winter. Uses various foraging substrates, ranging from dead and live trees to downed wood and ground; see Sousa (1987) for details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Picoides villosus (hairy and downy woodpeckers) preys on:
Saperda
Dicera

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Female spends entire year on breeding territory, joined in late winter by male (Harrison 1979). Reported territory size 0.6-15 hectares; varies with habitat quality. In central Ontario, breeding territories averaged 2.8 hectares, range 2.4 to 3.2 hectares (Lawrence 1967).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
191 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 15.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Breeding occurs two to three months before nesting in February through June, depending on location within the Hairy Woodpecker's geographic range. In some locations, females maintain territories. They will advertise for a male by drumming. Once the pair-bond is formed, both male and female drum.

Excavation of the nest is accomplished for the most part by the male. Nest holes are made in dead branches or tree trunks, 4 to 60 m off the ground, in forests and orchards. Two to five white eggs are laid per clutch (Palmer and Fowler 1975, Short 1982, Winkler et al. 1995). The eggs average 23.8 by 18 mm in size (Bent 1992). Incubation is 14 days by both parents (Palmer and Fowler 1975, Short 1982, Winkler et al. 1995). The young leave the nest after 28 to 30 days (Winkler et al. 1995). Breeding occurs once annually (Palmer and Fowler 1975).

Average time to hatching: 14 days.

Average eggs per season: 4.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nests early April to mid-June in Maryland (see Bushman and Therres 1988). Clutch size is 3-6 (usually 4). Incubation lasts 11-12 days, by both sexes. Young leave nest at 28-30 days, then rely on parents for about 2 more weeks, may return to nest to roost.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Picoides villosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 15 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTCTCCACCAACCACAAAGACATTGGCACCCTATATCTCATCTTCGGCGCATGAGCCGGCATAATCGGCACCGCCCTTAGCCTCCTCATTCGAGCAGAACTAGGCCAACCCGGCACCCTCCTTGGTGAC---GACCAAATCTACAACGTCATCGTCACCGCCCATGCATTCGTAATAATCTTCTTTATAGTTATACCCATCATAATTGGGGGATTTGGAAACTGACTCGTACCGCTCATAATTGGAGCCCCCGACATGGCATTCCCACGAATAAACAACATAANCTTCTGACTCCTTCCCCCATCATTCCTTCTCCTCCTAGCGTCCTCCACAGTAGAAGCGGGGGCTGGAACAGGATGAACTGTCTACCCACCCCTTGCTGGCAACCTAGCCCATGCAGGAGCCTCAGTAGACCTAGCCATCTTCTCACTCCACCTAGCAGGCATCTCATCAATCCTAGGGGCAATCAACTTCATCACAACAGCCATTAACATGAAACCCCCAGCCATCTCACAATATCAAACTCCCCTATTCGTCTGATCCGTCCTTATTACCGCCGTCCTCCTGCTCCTCTCACTCCCTGTACTTGCCGCTGGCATTACAATACTCCTCACAGACCGCAACCTAAACACTACATTCTTTGACCCCGCTGGAGGAGGGGACCCCATCCTCTACCAACATCTCTTCTGATTCTTTGGCCACCCCGAAGTCTACATTCTTATTCTTCCAGGATTTGGCATTATCTCCCACGTAGTAGCATACTACGCTGGCAAAAAAGAACCATTCGGCTACATGGGCATAGTATGAGCCATACTTTCCATTGGATTCCTCGGCTTCATCGTATGAGCCCATCACATGTTCACTGTAGGAATAGACGTAGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Picoides villosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This is a widespread and abundant species. It is protected by the U.S. Migratory Bird Act.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range and common in many areas; no evidence of large-scale declines.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Reportedly declining (in the 1980s) in several parts of the range (Ehrlich et al. 1992), though these declines probably were only local.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Comments: Local declines may result from usurpation of nest cavities by house sparrows or starlings.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management Requirements: Any timber practices that remove all decayed trees are detrimental. Forest management should allow for the continued availability of cavity trees.

See Mitchell (1988) for specifications for the construction and placement of nest boxes. Response to burning: more common on burned plots in breeding and non-breeding season in Arizona (Finch et al. 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

These birds are useful destroyers of insect pests, especially around orchards (Palmer and Fowler 1975).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hairy Woodpecker

The Hairy Woodpecker (Picoides villosus) is a medium-sized woodpecker, averaging approximately 250 mm (9.75 inches) in length with a 380 mm (15 inch) wingspan.[2] With an estimated population in 2003 of over nine million individuals, the Hairy Woodpecker is listed by the IUCN as a species of least concern in North America.[3]

Contents

Range

The Hairy Woodpecker inhabits mature deciduous forests[2][4] in the Bahamas, Canada, Costa Rica, El Salvador, Guatemala, Honduras, Mexico, Nicaragua, Panama, Puerto Rico, Saint Pierre and Miquelon, Turks and Caicos Islands, and the United States.[3] Mating pairs will excavate a hole in a tree, where they will tend to, on average, four white eggs.[4]

Description

Female of the Great Basin race, orius, which has less white on the wings than eastern races and has cream-colored underparts

Adults are mainly black on the upper parts and wings, with a white or pale back and white spotting on the wings; the throat and belly vary from white to sooty brown, depending on subspecies. There is a white bar above and one below the eye. They have a black tail with white outer feathers. Adult males have a red patch or two side-by-side patches on the back of the head; juvenile males have red or rarely orange-red on the crown.[5]

The Hairy Woodpecker measures from 18–26 cm (7.1–10 in) in length, 33–43 cm (13–17 in) in wingspan and 40–95 g (1.4–3.4 oz) in weight.[6][7] It is virtually identical in plumage to the much smaller Downy Woodpecker. The Downy has a shorter bill relative to the size of its head which is, other than size and voice, the best way to distinguish them in the field. These two species are not closely related, however, and are likely to be separated in different genera.[8][9] The best way to tell the two species apart other than the size is the lack of spots on its white tail feathers (which the Downy has). Their outward similarity is a spectacular example of convergent evolution. As to why this convergence has evolved, only tentative hypotheses have been advanced; in any case due to the considerable size difference, ecological competition between the two species is rather slight.

These birds are mostly permanent residents. Birds in the extreme north may migrate further south; birds in mountainous areas may move to lower elevations.

These birds forage on trees, often turning over bark or excavating to uncover insects. They mainly eat insects, also fruits, berries and nuts, sometimes tree sap. They are also known to peck at wooden window frames and wood sided homes that may house bugs.

See also

References

  1. ^ BirdLife International (2012). "Picoides villosus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/100600655. Retrieved 16 July 2012.
  2. ^ a b Sibley, David Allen (2003). The Sibley Field Guide to Birds of Eastern North America. Alfred A. Knopf, Inc. p. 249. ISBN 0-679-45120-X.
  3. ^ a b "Picoides villosus". International Union for Conservation of Nature and Natural Resources. http://www.iucnredlist.org/apps/redlist/details/full/141717/0. Retrieved 2009-03-24.
  4. ^ a b Bull, John; Farrand, Jr., John (August 1994) [1977]. National Audubon Society Field Guide to North American Birds:Eastern region (2nd ed.). Chanticleer Press. p. 573. ISBN 0-679-42852-6.
  5. ^ Jackson, Jerome A., Henri R. Ouellet, & Bette J. Jackson (2002): Hairy Woodpecker (Picoides villosus), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online 2009-3-20 doi:10.2173/bna.702 (registration required)
  6. ^ Hairy Woodpecker, All About Birds.
  7. ^ Hairy Woodpecker, Bird Fellow
  8. ^ Weibel, Amy C. & Moore, William S. (2005): Plumage convergence in Picoides woodpeckers based on a molecular phylogeny, with emphasis on convergence in downy and hairy woodpeckers. Condor 107(4): 797–809. doi:10.1650/7858.1 (HTML abstract)
  9. ^ Moore, William S.; Weibel, Amy C. & Agius, Andrea (2006): Mitochondrial DNA phylogeny of the woodpecker genus Veniliornis (Picidae, Picinae) and related genera implies convergent evolution of plumage patterns. Biol. J. Linn. Soc. 87: 611–624. PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!