Overview

Brief Summary

Melanerpes erythrocephalus

A medium-sized (8 ½ - 9 ½ inches) woodpecker, the Red-headed Woodpecker is most easily identified by its solid black upperparts, white wing patches, white belly, and all-red head. Among woodpeckers in its range, this is the only species with a completely red head, although several, particularly the Red-bellied Woodpecker (Melanerpes carolinus), have smaller amounts of red on the head. Unlike most woodpeckers, male and female Red-headed Woodpeckers are similar to one another in all seasons. The Red-headed Woodpecker is widely distributed as a breeding bird across the eastern United States and southern Canada. Northern populations move south in winter, vacating the upper Great Plains, northern Great Lakes, and most of New England while moving into southern Louisiana and Texas. This species is absent from higher elevations in the Appalachian Mountains, coastal portions of the Mid-Atlantic region, and south Florida. Red-headed Woodpeckers inhabit a variety of deciduous woodland habitats, shifting to more open habitats on the Great Plains. This species is found less frequently in urban and suburban environments than its relatives due to its preference for large dead branches or snags for feeding. Red-headed Woodpeckers eat a variety of plant and animal foods, including insects, berries, nuts, and seeds. In appropriate habitat, this species may be seen climbing trees and branches head-first while foraging for food. When moving from tree to tree, this species undertakes short, undulating flights through the canopy. Unlike other species of woodpecker, Red-headed Woodpeckers often catch insects in the air while in flight. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDING: Southern Alberta and southern Saskatchewan to southern New Brunswick (formerly), south to central Texas, Gulf Coast, and Florida, west to central Montana, eastern Wyoming, eastern Colorado, and central New Mexico (AOU 1998). NON-BREEDING: regularly through the southern two-thirds of the breeding range, rarely to the northern limits of the breeding range (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Melanerpes erythrocephalus is found in central and eastern USA, from Montana to the Atlantic coast and south to the Gulf of Mexico, and in extreme southern Canada(del Hoyo et al. 2002). The northern populations are migratory (Smith et al. 2000, del Hoyo et al. 2002), and historically its movements were influenced by nut crops from the now non-existent northern beech (Fagus) forests (Smith et al. 2000). It has experienced a steady decline of 2.5% annually since 1966 (J. Wells and K. Rosenberg in litt. 2003), with the most severe declines in Florida and the Great Lakes Plain (del Hoyo et al. 2002).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Red-headed woodpeckers are widely distributed throughout most of North America. They range east to west from the Rocky Mountains to the Atlantic Ocean, and north to south from Lake Winnipeg (Manitoba) and southern Ontario, to Texas, the Gulf of Mexico, and Florida. This bird was once common, but is now found only in patches throughout its range.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

E North America from s Canada to Gulf of Mexico and Florida.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

States or Provinces

(key to state/province abbreviations)
UNITED STATES
AL AR CO DE FL GA IL IN IA KS
KY LA MD MA MI MN MS MO MT NE
NJ NM NY NC ND OH OK PA SC SD
TN TX VA WV WI WY DC

CANADA
MB ON

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

BLM PHYSIOGRAPHIC REGIONS [8]:

13 Rocky Mountain Piedmont

14 Great Plains

16 Upper Missouri Basin and Broken Lands
  • 8. Bernard, Stephen R.; Brown, Kenneth F. 1977. Distribution of mammals, reptiles, and amphibians by BLM physiographic regions and A.W. Kuchler's associations for the eleven western states. Tech. Note 301. Denver, CO: U.S. Department of the Interior, Bureau of Land Management. 169 p. [434]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The range of the red-headed woodpecker extends from extreme southern Quebec and Ontario south to Florida and west to the Rocky Mountains. Occasional vagrants may travel outside this range [6,65].
  • 6. Bent, Arthur Cleveland. 1939. Life histories of North American woodpeckers. U.S. Natural History Bulletin No. 174. 334 p. [62579]
  • 65. National Geographic Society. 1999. Field guide to the birds of North America. 3rd ed. Washington, DC: The National Geographic Society. 480 p. [60563]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Red-headed woodpeckers are widely distributed throughout most of North America. They range east to west from the Rocky Mountains to the Atlantic Ocean, and north to south from Lake Winnipeg (Manitoba) and southern Ontario, to Texas, the Gulf of Mexico, and Florida. Once a common bird, this species is now found sporadically throughout its range.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Red-headed woodpeckers are sexually monomorphic. This means that males and females look exactly the same. They have bright red heads, necks, throats and shoulders. Their wings and tail are bluish-black. They have a white belly and a large square area of white on their rump. Their bills are long and chisel shaped, which is important for drilling into trees. Young red-headed woodpeckers look similar to adults, but their heads and necks are buffy-brown instead of red.

Red-headed woodpeckers are small compared to other woodpeckers. They are 21 to 25 cm long and have a wingspan of 33 to 37 cm. They weigh about 70 grams.

Average mass: 70 g.

Range length: 21 to 25 cm.

Range wingspan: 33 to 37 cm.

Sexual Dimorphism: sexes alike

Average mass: 75 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Male and female red-headed woodpeckers look alike. The entire head, neck, throat and upper breast are bright red. The wings and tail are bluish-black, and there are large square areas of white on the rear part of their wings and upper rump. The white on the wings makes them especially noticeable during flight. Immature birds also possess the white patches on their wings. However, immature red-headed woodpeckers have a buffy-brown head and neck, which becomes red after the first molt.

This woodpecker is relatively small compared to others in its family. Red-headed woodpeckers can range from 21 to 25 cm in length and have a wingspan of 33 to 37 cm. The bill is long and chisel shaped, which is important for drilling into trees. The average red-headed woodpecker weighs approximately 70 grams.

Average mass: 70 g.

Range length: 21 to 25 cm.

Range wingspan: 33 to 37 cm.

Sexual Dimorphism: sexes alike

Average mass: 75 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 24 cm

Weight: 72 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Open woodland, especially with beech or oak, open situations with scattered trees, parks, cultivated areas and gardens (AOU 1983). Nests in hole excavated 2-25 meters above ground by both sexes in live tree, dead stub, utility pole, or fencepost. Sometimes uses existing holes in poles or posts. Individuals typically nest in the same tree or cavity in successive years (Ingold 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It inhabits mature lowland forest with dead trees for nesting, open areas for fly-catching and a relatively open understorey. It is strongly aggressive, particularly when defending food storage sites, and is interspecifically territorial against the Red-bellied Woodpecker M. carolinus (Reller 1972). It is omnivorous, eating a high proportion of animal matter in spring, but seeds predominate in winter. It breeds from April to September.


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-headed woodpeckers like open woodlands and the edges and clearings near forests. They are often found in woodlands, along rivers, in orchards, parks, open country, savannas and grasslands with scattered trees. In general, they like habitats that have tall, old trees.

In winter, red-headed woodpeckers also live in forests that have large, old trees. Red-headed woodpeckers are found in different areas each winter. They chose to spend the winter wherever there are a lot of acorns and other foods.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Other Habitat Features: agricultural ; riparian

  • Smith, K., J. Withgott, P. Rodewald. 2000. Red-headed woodpecker (Melanerpes erythrocephalus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 518. Philadelphia: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, natural, snag, tree

Red-headed woodpeckers are cavity nesters. The most preferred nest sites are old snags or tree limbs that have been dead for several years, have little or no bark, few large limbs remaining, low canopy cover, and low ground cover [6,20,42,48,49,53,69,75,94]. Nests are most commonly found in dead longleaf pine, loblolly pine, slash pine (P. elliottii), pond pine (P. serotina), plains cottonwood, oaks, maples, birches (Betula spp.), and elms (Ulmus spp.) [5,7,33,35,36,42,48,54,94]. Utility poles and fence posts are used if other nesting sites are limited [43,44,63]. Red-headed woodpeckers typically nest in the largest trees [75] and show a strong preference for medium- to large-diameter nest cavities [15].

In Iowa, 88% of red-headed woodpecker nesting cavities was in snags [83]. Snags with <34% of the total branches remaining were highly favored for nesting. Snags with >66 % of branches remaining were used least [83]. This preference may be related to the softness of the wood due to decay [83,94]. In Wyoming, red-headed woodpeckers nested in limb cavities 80.6% of the time and in boles 19.4% of the time (P<0.001) [36]. Red-headed woodpeckers nested in significantly (P=0.02) more snags (72.2%) than nonsnags (27.8%) [36].

The table below summarizes mean red-headed woodpecker nest site characteristics:

State Habitat type Tree height (m) Tree DBH (cm) Cavity height (m) Diameter of trunk/limb at nest (cm)
Arkansas shortleaf pine-post oak (Q. stellata) 14.8 33.4 11.0 .... [80]
Colorado mature plains cottonwood 15.4 56.9-66.8 8.3-8.4 18.4 [7,75]
Florida longleaf pine-turkey oak (Q. laevis) savanna 13.8 30.6 9.3 .... [94]
Iowa mixed riparian habitats 14.6 .... 9.6 25.7 [84]
Kansas American elm (U. americana)-eastern cottonwood-willow 10.9 .... 7.0 21.8 [48]
Minnesota/Wisconsin closed-canopy mature oak forest 18 54 .... .... [33]
Ohio mixed agricultural and forested habitat or oak-hickory (Carya spp.) stands bordering golf courses 18.3 56.9-58.8 10.2-14.1 20.7 [46,71]
Wyoming mixed cottonwood-willow floodplain, irrigated cropland, and pastureland .... 59.2 10.0 21.2 [36]
Virginia mature oak woodlot 29.5 95.0 17.5 38.0 [14]

Nest cavities in an Illinois study were 23 to 66 feet (7-20 m) in height and always in the bole of a snag [69]. All nest trees in Minnesota and Wisconsin had branch stubs and most had old cavities, <25% bark remaining, and at least one "significant dead portion" [33]. Nest trees in Minnesota and Wisconsin had significantly greater diameters (P<0.001) and were significantly taller (P<0.001) than adjacent trees [33].

Red-headed woodpeckers have strong nest site and nest tree fidelity [5,44]. Cavities may be reused from year to year [5,44,94]. In Ohio, 57.7% of nest cavities had been freshly excavated, while 42.3% were old excavations [46]. No natural cavities were used for nesting in Ohio [46]. In Colorado, both limbs and trunks were utilized nearly equally for nesting, as were old and new cavities [7]. Additionally, nest cavities previously excavated by other species, such as the red-cockaded woodpecker (Picoides borealis) and southern flying squirrel (Glaucomys volans), may be reused by red-headed woodpeckers in subsequent years [20]. Red-headed woodpecker pairs occasionally take over cavities that were occupied by other species earlier in the same breeding season [20]. Rarely, red-headed woodpeckers complete excavation of cavities that were abandoned by other species [43].

Roost trees of nonbreeding individuals in a Florida study were located in longleaf pine and turkey oak snags and in a dead limb of a live turkey oak tree [5]. Juveniles showed a preference for roosting in turkey oaks while adults preferred roosting in longleaf pine snags [5].

  • 5. Belson, Michael Shane. 1998. Red-headed woodpecker (Melanerpes erythrocephalus) use of habitat at Wekiwa Springs State Park, Florida. Orlando, FL: University of Central Florida. 65 p. Thesis. [65156]
  • 6. Bent, Arthur Cleveland. 1939. Life histories of North American woodpeckers. U.S. Natural History Bulletin No. 174. 334 p. [62579]
  • 7. Bergstrom, John T. 1977. Ecology and behavior of woodpeckers in the South Platte River floodplain. Greeley, CO: University of Northern Colorado. 110 p. Dissertation. [65319]
  • 14. Conner, Richard N. 1976. Nesting habitat for red-headed woodpeckers in southwestern Virginia. Bird-Banding. 47(1): 40-43. [61966]
  • 15. Conner, Richard N.; Adkisson, Curtis S. 1977. Principal component analysis of woodpecker nesting habitat. The Wilson Bulletin. 89(1): 122-129. [61962]
  • 20. Dennis, John V. 1971. Species using red-cockaded woodpecker holes in northeastern South Carolina. Journal of Ornithological Investigation. 42(2): 79-87. [26097]
  • 33. Giese, Collette L. Adkins; Cuthbert, Francesca J. 2005. Woodpecker nest tree characteristics in upper midwestern oak forests. The Canadian-Field Naturalist. 119(3): 367-376. [65353]
  • 35. Graber, Jean W.; Graber, Richard R.; Kirk, Ethelyn L. 1977. Illinois birds: Picidae. Biological Notes No. 102. Urbana, IL: State of Illinois, Department of Registration and Education, Natural History Survey Division. 73 p. [64983]
  • 36. Gutzwiller, Kevin J.; Anderson, Stanley H. 1987. Multiscale associations between cavity-nesting birds and features of Wyoming streamside woodlands. The Condor. 89(3): 534-548. [65355]
  • 42. Ingold, Danny J. 1989. Nesting phenology and competition for sites among red-headed and red-bellied woodpeckers and European starlings. The Auk. 106: 209-217. [61938]
  • 43. Ingold, Danny J. 1990. Simultaneous use of nest trees by breeding red-headed and red-bellied woodpeckers and European starlings. The Condor. 92(1): 252-253. [61936]
  • 44. Ingold, Danny J. 1991. Nest-site fidelity in red-headed and red-bellied woodpeckers. The Wilson Bulletin. 103(1): 118-122. [61934]
  • 46. Ingold, Danny J. 1994. Nest-site characteristics of red-bellied and red-headed woodpeckers and northern flickers in East-Central Ohio. Ohio Journal of Science. 94(1): 2-7. [62016]
  • 48. Jackson, Jerome A. 1976. A comparison of some aspects of the breeding ecology of red-headed and red-bellied woodpeckers in Kansas. The Condor. 78(1): 67-76. [61965]
  • 49. Kilham, Lawrence. 1983. Red-headed woodpecker. In: Paynter, Raymond A., Jr., ed. Life history studies of woodpeckers of eastern North America. Publications of the Nuttall Ornithological Club, No. 20. Cambridge, MA: Nuttall Ornithological Club: 113-128. [65711]
  • 53. Kurta, Allen; Kath, Joseph; Smith, Eric L.; Foster, Rodney; Orick, Michael W.; Ross, Ronald. 1993. A maternity roost of the endangered Indiana bat (Myotis sodalis) in an unshaded, hollow, sycamore tree (Platanus occidentalis). The American Midland Naturalist. 130(2): 405-407. [53799]
  • 54. Lohr, Steven M.; Gauthreaux, Sidney A.; Kilgo, John C. 2002. Importance of coarse woody debris to avian communities in loblolly pine forests. Conservation Biology. 16(3): 767-777. [60758]
  • 63. Mumford, Russell E.; Keller, Charles E. 1984. The birds of Indiana. Bloomington, IN: Indiana University Press. 376 p. [60761]
  • 69. Reller, Ann Willbern. 1972. Aspects of behavioral ecology of red-headed and red-bellied woodpeckers. The American Midland Naturalist. 88(2): 270-290. [61970]
  • 71. Rodewald, Paul G.; Santiago, Melissa J.; Rodewald, Amanda D. 2005. Habitat use of breeding red-headed woodpeckers on golf courses in Ohio. Wildlife Society Bulletin. 33(2): 448-453. [61908]
  • 75. Sedgwick, James A.; Knopf, Fritz L. 1990. Habitat relationships and nest site characteristics of cavity-nesting birds in cottonwood floodplains. Journal of Wildlife Management. 54(1): 112-124. [11105]
  • 80. Smith, Kimberly G.; Withgott, James H.; Rodewald, Paul G. 2000. Red-headed woodpecker--Melanerpes erythrocephalus. In: Poole, A.; Gill, F., eds. The birds of North America. No. 518. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union: 1-27. [61928]
  • 83. Stauffer, Dean F.; Best, Louis B. 1980. Habitat selection by birds of riparian communities: evaluation effects of habitat alterations. Journal of Wildlife Management. 44(1): 1-15. [8118]
  • 84. Stauffer, Dean F.; Best, Louis B. 1982. Nest-site selection by cavity-nesting birds of riparian habitats in Iowa. The Wilson Bulletin. 94(3): 329-337. [62017]
  • 94. Venables, Ann,; Collopy, Michael W. 1989. Seasonal foraging and habitat requirements of red-headed woodpeckers in north-central Florida. Tallahassee, FL: Florida Game and Fresh Water Fish Commission, Nongame Wildlife Program. 49 p. [61978]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: association, basal area, cover, density, forb, hardwood, mast, snag, swamp, tree

Primary habitats used by red-headed woodpeckers include oak (Quercus spp.) savanna and mature open bottomland forest [10,15,35,63,69,83]. Red-headed woodpeckers are also found in upland forests, woodlots, shelterbelts along agricultural fields, residential areas, golf courses, and other habitats containing mature open hardwoods with snags or trees with dead limbs [14,35,38,58,63,69,71,83]. The use of herbaceous habitats or stands with high canopy cover or a dense mid-story is infrequent [38,83]. During periods of cold and deep snow cover, red-headed woodpeckers may move from the bottomlands to the uplands [34].

Red-headed woodpeckers show a preference for mature open canopy forests with large trees, a high basal area, and little understory [14,15]. In a Texas study, 79% of red-headed woodpeckers were observed in a bottomland hardwood forest that had high crown closure in the overstory and low understory and mid-story growth. Hardwood-dominated ridges adjacent to the bottomland forest housed nearly 17% of the red-headed woodpeckers observed. Mixed pine (Pinus spp.)-hardwood forests and pine uplands were occupied by approximately 2% of the observed red-headed woodpeckers each [18]. Red-headed woodpeckers frequent savannas and forest edges during the breeding season, and mostly avoid the interior of forest patches >30 acres unless fire, wind damage, or some other event creates gaps in the forest interior [35]. In Illinois, red-headed woodpeckers preferred the forest edge from late summer to early winter and the interior forest during the rest of the year [91]. Red-headed woodpecker nests in Ohio were associated with low ground cover within a mosaic of agricultural and forested habitats [46]. Oak woodlots with an abundance of "overmature" trees with dead branches and cavities support red-headed woodpeckers during years of high acorn mast [63]. In South Dakota, red-headed woodpeckers were observed in riparian habitat adjacent to black-tailed prairie dog (Cynomys ludovicianus) colonies [77].

Mean habitat characteristics of a plains cottonwood-peachleaf willow (Populus deltoides ssp. monilifera-Salix amygdaloides) riparian stand in Colorado and 2 eastern cottonwood/Rocky Mountain juniper (P. deltoides/Juniperus scopulorum) stands in North Dakota inhabited by red-headed woodpeckers were:

Location Basal area
(m²/ha)
Canopy cover
(%)
Mean canopy height
(m)
Large tree density
(trees/ha)
Medium tree density
(trees/ha)
Small tree density
(trees/ha)
North Dakota 15.3-18.5 70.0-85.0 20.0-21.0 7.7-14.8 95.8-103.7 79.0-82.0 [41]
Colorado 11.3 26.6 .... 8.1 75.0 54.8 [75]

Red-headed woodpecker habitat in a bottomland hardwood forest in Texas had an average of 4.3 trees greater than 15 inches (38 cm) DBH/0.04 ha and a dominant vegetation height of 108.9 feet (33.2 m) [16]. In Illinois, there was a positive relationship between the number of red-headed woodpeckers and the number of oaks greater than 10 inches (25 cm) DBH (r=0.909, P<0.05 in year 1; r=0.961, P<0.01 in year 2) [35]. More than half of all plains cottonwoods in a Colorado stand had an average DBH of 9 to 20 inches (24-52 cm) [74]. Optimal stand structure for red-headed woodpeckers in longleaf pine-loblolly pine (Pinus palustris-P. taeda) stands in South Carolina would likely be DBH of 16 to 24 inches (40-61 cm) for cavity trees [39]. Red-headed woodpeckers in Iowa responded negatively (R²=0.113, P≤0.01) to tree density but positively (R²=0.113, P≤0.01) to snag density. Red-headed woodpeckers also responded positively (R²=0.113, P≤0.01) to tree size and forb species richness. Snags with an average DBH of 20 to 30 inches (51-75 cm) were highly favored (R²=0.113, P≤0.01) [83].

In late seral stage stands in South Dakota, little mid-story vegetation was present. Average vegetation characteristics of late seral and late-intermediate seral stands in the plains cottonwood/willow (Salix spp.) riparian habitats occupied by red-headed woodpeckers were [72]:

  Late intermediate seral stage Late seral stage
% cover of vegetation <1 m tall 54.6 79.9
Number of cottonwood seedlings/acre 123.5 2.5
Number of willow seedlings/ha 46.2 8.4
Number of cottonwood trees/ha 949.7 116.5
Number of small snags/ha 52.1 0.0
Number of large snags/ha 0.7 6.1
Basal area of cottonwoods (m²/ha) 332.6 766.0
DBH of cottonwoods (cm) 17.0 67.3
% overstory canopy cover 58.7 48.5

Snags are essential habitat components that are utilized for nesting, roosting, and foraging [35,38,69]. American beaver (Castor canadensis) ponds, open wooded swamps, rivers bordered by hardwoods, and other riparian or wetland areas where snags are plentiful provide valuable habitat [69,97]. Similarly, trees killed by flooding as well as those bordering lakes, marshes, and other frequently flooded areas support red-headed woodpecker populations [63]. In addition, red-headed woodpeckers are highly attracted to forested areas that have been treated with herbicides and contain numerous standing snags [38]. Snag densities averaged 0.66/ha in a plains cottonwood-dominated stand in Colorado [74]. An average of 2.7 snags was present within 0.04-ha plots in a Texas bottomland hardwood forest. Average snag DBH was 9.5 inches (24.1 cm) [16].

Red-headed woodpeckers utilize live and dead trees for foraging [16]. Foraging activities most often occurred in association with live trees (48.5%) followed by nest snags (29.5%) and other snags (22.1%) in Florida [94]. Mean foraging height for the red-headed woodpecker depends on the condition of the trees used. In a Texas study, mean foraging height in live trees was 43 feet (13 m); in dead snags red-headed woodpeckers foraged at 39 feet (12 m) on average; and mean forage height was 41 feet (12.5 m) in live trees with dead limbs [16]. Red-headed woodpecker activity was strongly restricted to the canopy, between 24.9 feet (7.6 m) above ground level to the canopy top, in a Louisiana bottomland hardwood forest [22].

Territory size/density: Small forest tracts are utilized if the habitat provides adequate nesting sites, roosting sites, and food. Red-headed woodpeckers in a South Carolina bottomland hardwood forest were most commonly detected in 0.5-ha gaps and least common in 0.06-ha gaps. Differences were not significant (P=0.26) [60]. In Arkansas and Oklahoma, no red-headed woodpeckers were observed in forest gaps ranging 0.54 to 2.62 acres in size. However, red-headed woodpeckers were detected at an average density of 0.3 bird/acre in clearcuts 35 to 40 acres in size [88]. In Virginia, red-headed woodpeckers nested in oak woodlots as small as 2 ha, while oak woodlots as small as 3 ha supported 2 breeding pairs [14].

Red-headed woodpeckers were observed at a rate of 0.59 bird/ha in late-seral cottonwood forests in South Dakota and at 0.05 bird/ha in late intermediate-seral forests during the breeding season [72]. The difference was significant (P≤0.15) [72]. No red-headed woodpeckers were detected in the early and early intermediate-seral stages in South Dakota [72].

Red-headed woodpecker densities and territory sizes vary greatly depending on location, habitat, and season. Densities during the breeding season are reported in the following table:

Location Habitat type Average number of individuals Average number of breeding pairs Area
Colorado mature plains cottonwood bottomland forest 9-16 .... 100 ha [74,76]
plains cottonwood floodplain 20.0 .... 40 ha [7]
Illinois urban and suburban residential 0-25 .... 100 acres
oak-maple (Acer spp.) forest 3-6.0 .... 100 acres
grazed bottomland woods 4 .... 100 acres
mature bottomland forest 3.4 .... 100 acres
mature upland forest 0.4 .... 100 acres
second-growth hardwood forest 5.9-27 .... 100 acres
savanna 18 .... 100 acres
orchards 0-4.4 .... 100 acres
shrublands 0-28 .... 100 acres
swamp prairie 14.3 .... 100 acres
pasture 0-5.9 .... 100 acres
oak-maple forest edge 13.7 .... 1 mile of edge [35]
Iowa tallgrass prairie, mowed edge 1.15 .... 1,000 m of edge
tallgrass prairie, burned edge 0.80 .... 1,000 m of edge
tallgrass prairie, untreated edge 0.36 .... 1,000 m of edge [93]
Louisiana water oak (Q. nigra)-loblolly pine-spruce pine (P. glabra) 11.0 .... 100 acres [61]
North Dakota eastern cottonwood/Rocky Mountain juniper floodplain .... 4.3 40 ha [41]
Oklahoma shortleaf pine (P. echinata)-mixed oak upland forest .... 6.6 100 acres [11]
South Carolina longleaf pine-loblolly pine .... 2.3 100 acres [39]

Breeding territories in Florida ranged from 3.1 to 8.5 ha [94]. Average territory size in Illinois was 5.5 to 11.0 ha [91].

Red-headed woodpecker densities during winter are reported in the following table:

Location

Habitat type

Average number of individuals Area
Illinois urban residential 0-0.5 100 acres
oak-maple forest 12.5 100 acres [35]
mature bottomland forest 33.7-34.2 100 acres
mature upland forest 8.2-8.4 100 acres [34,35]
grazed bottomland forest 1.3 100 acres
shrubby field 0-7 100 acres
oak-maple forest edge 6.8 1 mile of edge [35]
Maryland pin oak-ash-black locust (Q. palustris-Fraxinus spp.-Robinia pseudoacacia) 12 1.25 ha [49]

Actual red-headed woodpecker population densities across all winter habitats in Illinois ranged from 0 to 89 individuals/100 acres [35].

Winter territories in an Ohio beech (Fagus spp.) grove averaged 0.05 ha for adults and 0.03 ha for juveniles [23]. In Florida, winter territories averaged 1.00 ha for adults and 0.95 ha for juveniles in palmetto (Sabal spp.) scrub and oak scrub habitats [62]. In Louisiana, winter territories averaged 0.8 to 1.2 ha [57].

  • 7. Bergstrom, John T. 1977. Ecology and behavior of woodpeckers in the South Platte River floodplain. Greeley, CO: University of Northern Colorado. 110 p. Dissertation. [65319]
  • 10. Brawn, Jeffrey D.; Robinson, Scott K.; Thompson, Frank R. 2001. The role of disturbance in the ecology and conservation of birds. Annual Review of Ecology and Systematics. 32: 251-276. [55773]
  • 11. Carter, William A. 1967. Ecology of the nesting birds of the McCurtain Game Preserve, Oklahoma. The Wilson Bulletin. 79(3): 259-272. [65476]
  • 14. Conner, Richard N. 1976. Nesting habitat for red-headed woodpeckers in southwestern Virginia. Bird-Banding. 47(1): 40-43. [61966]
  • 15. Conner, Richard N.; Adkisson, Curtis S. 1977. Principal component analysis of woodpecker nesting habitat. The Wilson Bulletin. 89(1): 122-129. [61962]
  • 16. Conner, Richard N.; Jones, Stanley D.; Jones, Gretchen D. 1994. Snag condition and woodpecker foraging ecology in a bottomland hardwood forest. The Wilson Bulletin. 106(2): 242-257. [24214]
  • 18. Daniel, Ryan S.; Fleet, Robert R. 1999. Bird and small mammal communities of four similar-aged forest types of the Caddo Lake area in east Texas. Texas Journal of Science. 51(1): 65-80. [35975]
  • 22. Dickson, James G.; Noble, Robert E. 1978. Vertical distribution of birds in a Louisiana bottomland hardwood forest. The Wilson Bulletin. 90(1): 19-30. [60732]
  • 23. Doherty, Paul F., Jr.; Grubb, Thomas C., Jr.; Bronson, C. L. 1996. Territories and caching-related behavior of red-headed woodpeckers wintering in a beech grove. The Wilson Bulletin. 108(4): 740-747. [61930]
  • 34. Graber, Jean W.; Graber, Richard R. 1979. Severe winter weather and bird populations in southern Illinois. The Wilson Bulletin. 91(1): 88-103. [65135]
  • 35. Graber, Jean W.; Graber, Richard R.; Kirk, Ethelyn L. 1977. Illinois birds: Picidae. Biological Notes No. 102. Urbana, IL: State of Illinois, Department of Registration and Education, Natural History Survey Division. 73 p. [64983]
  • 38. Hardin, Kimberly I.; Evans, Keith E. 1977. Cavity nesting bird habitat in the oak-hickory forests--a review. Gen. Tech. Rep. NC-30. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 23 p. [13859]
  • 39. Harlow, Richard F.; Guynn, David C., Jr. 1983. Snag densities in managed stands of the South Carolina coastal plain. Southern Journal of Applied Forestry. 7(4): 224-229. [12571]
  • 41. Hopkins, Rick B.; Cassel, J. Frank; Bjugstad, Ardell J. 1986. Relationships between breeding birds and vegetation in four woodland types of the Little Missouri National Grasslands. Res. Pap. RM-270. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 12 p. [2758]
  • 46. Ingold, Danny J. 1994. Nest-site characteristics of red-bellied and red-headed woodpeckers and northern flickers in East-Central Ohio. Ohio Journal of Science. 94(1): 2-7. [62016]
  • 49. Kilham, Lawrence. 1983. Red-headed woodpecker. In: Paynter, Raymond A., Jr., ed. Life history studies of woodpeckers of eastern North America. Publications of the Nuttall Ornithological Club, No. 20. Cambridge, MA: Nuttall Ornithological Club: 113-128. [65711]
  • 57. MacRoberts, Michael H. 1975. Food storage and winter territory in red-headed woodpeckers in northwestern Louisiana. The Auk. 92(2): 382-385. [61967]
  • 58. Martin, Thomas E. 1980. Diversity and abundance of spring migratory birds using habitat islands on the Great Plains. The Condor. 82(4): 430-439. [61992]
  • 60. Moorman, Christopher E.; Guynn, David C., Jr. 2001. Effects of group-selection opening size on breeding bird habitat use in a bottomland forest. Ecological Applications. 11(6): 1680-1691. [43241]
  • 61. Morse, Douglas A. 1970. Ecological aspects of some mixed-species foraging flocks of birds. Ecological Monographs. 40(1): 119-168. [65352]
  • 63. Mumford, Russell E.; Keller, Charles E. 1984. The birds of Indiana. Bloomington, IN: Indiana University Press. 376 p. [60761]
  • 69. Reller, Ann Willbern. 1972. Aspects of behavioral ecology of red-headed and red-bellied woodpeckers. The American Midland Naturalist. 88(2): 270-290. [61970]
  • 71. Rodewald, Paul G.; Santiago, Melissa J.; Rodewald, Amanda D. 2005. Habitat use of breeding red-headed woodpeckers on golf courses in Ohio. Wildlife Society Bulletin. 33(2): 448-453. [61908]
  • 72. Rumble, Mark A.; Gobeille, John E. 2004. Avian use of successional cottonwood (Populus deltoides) woodlands along the middle Missouri River. The American Midland Naturalist. 152: 165-177. [1217]
  • 74. Sedgwick, James A.; Knopf, Fritz L. 1986. Cavity-nesting birds and the cavity-tree resource in plains cottonwood bottomlands. Journal of Wildlife Management. 50(2): 247-252. [19447]
  • 75. Sedgwick, James A.; Knopf, Fritz L. 1990. Habitat relationships and nest site characteristics of cavity-nesting birds in cottonwood floodplains. Journal of Wildlife Management. 54(1): 112-124. [11105]
  • 76. Sedgwick, James A.; Knopf, Fritz L. 1992. Cavity turnover and equilibrium cavity densities in a cottonwood bottomland. Journal of Wildlife Management. 56(3): 477-484. [19280]
  • 77. Sharps, Jon C.; Uresk, Daniel W. 1990. Ecological review of black-tailed prairie dogs and associated species in western South Dakota. The Great Basin Naturalist. 50(4): 339-344. [14895]
  • 83. Stauffer, Dean F.; Best, Louis B. 1980. Habitat selection by birds of riparian communities: evaluation effects of habitat alterations. Journal of Wildlife Management. 44(1): 1-15. [8118]
  • 91. Twomey, Arthur C. 1945. The bird population of an elm-maple forest with special reference to aspection, territorialism, and coactions. Ecological Monographs. 15(2): 173-205. [65511]
  • 93. Van Dyke, Fred; Van Kley, Sarah E.; Page, Christy E.; Van Beek, Jodi G. 2004. Restoration efforts for plant and bird communities in tallgrass prairies using prescribed burning and mowing. Restoration Ecology. 12(4): 575-585. [54784]
  • 94. Venables, Ann,; Collopy, Michael W. 1989. Seasonal foraging and habitat requirements of red-headed woodpeckers in north-central Florida. Tallahassee, FL: Florida Game and Fresh Water Fish Commission, Nongame Wildlife Program. 49 p. [61978]
  • 97. Willson, Mary F. 1970. Foraging behavior of some winter birds of deciduous woods. The Condor. 72(2): 169-174. [61918]
  • 62. Moskovits, Debra. 1978. Winter territorial and Foraging behavior of red-headed woodpeckers in Florida. Wilson Bulletin. 90(4): 521-535. [61957]
  • 88. Tappe, Philip A.; Thill, Ronald E.; Peitz, David G.; Perry, Roger W. 2004. Early succession bird communities of group-selection openings and clearcuts in the Ouachita Mountains, Arkansas and Oklahoma. In: Guldin, James M., tech. comp. Ouachita and Ozark Mountains symposium: ecosystem management research; [Dates & location unknown] Gen. Tech. Rep. SRS-74. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southern Research Station: 42-54. [55740]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the terms: cover, hardwood

SRM (RANGELAND) COVER TYPES [78]:

731 Cross timbers-Oklahoma

732 Cross timbers-Texas (little bluestem-post oak)

801 Savanna

802 Missouri prairie

803 Missouri glades

804 Tall fescue

805 Riparian

808 Sand pine scrub

809 Mixed hardwood and pine

810 Longleaf pine-turkey oak hills

811 South Florida flatwoods

812 North Florida flatwoods

814 Cabbage palm flatwoods

815 Upland hardwood hammocks

816 Cabbage palm hammocks

817 Oak hammocks
  • 78. Shiflet, Thomas N., ed. 1994. Rangeland cover types of the United States. Denver, CO: Society for Range Management. 152 p. [23362]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

More info for the terms: cover, swamp

SAF COVER TYPES [30]:

14 Northern pin oak

20 White pine-northern red oak-red maple

25 Sugar maple-beech-yellow birch

26 Sugar maple-basswood

27 Sugar maple

28 Black cherry-maple

31 Red spruce-sugar maple-beech

39 Black ash-American elm-red maple

40 Post oak-blackjack oak

42 Bur oak

43 Bear oak

44 Chestnut oak

51 White pine-chestnut oak

52 White oak-black oak-northern red oak

53 White oak

55 Northern red oak

57 Yellow-poplar

58 Yellow-poplar-eastern hemlock

59 Yellow-poplar-white oak-northern red oak

60 Beech-sugar maple

62 Silver maple-American elm

63 Cottonwood

65 Pin oak-sweetgum

69 Sand pine

70 Longleaf pine

71 Longleaf pine-scrub oak

72 Southern scrub oak

73 Southern redcedar

74 Cabbage palmetto

75 Shortleaf pine

76 Shortleaf pine-oak

78 Virginia pine-oak

80 Loblolly pine-shortleaf pine

81 Loblolly pine

82 Loblolly pine-hardwood

83 Longleaf pine-slash pine

84 Slash pine

85 Slash pine-hardwood

87 Sweetgum-yellow-poplar

88 Willow oak-water oak-diamondleaf (laurel) oak

89 Live oak

91 Swamp chestnut oak-cherrybark oak

92 Sweetgum-willow oak

93 Sugarberry-American elm-green ash

94 Sycamore-sweetgum-American elm

95 Black willow

96 Overcup oak-water hickory

98 Pond pine

108 Red maple

110 Black oak

111 South Florida slash pine

235 Cottonwood-willow

236 Bur oak
  • 30. Eyre, F. H., ed. 1980. Forest cover types of the United States and Canada. Washington, DC: Society of American Foresters. 148 p. [905]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

KUCHLER [52] PLANT ASSOCIATIONS:

K081 Oak savanna

K082 Mosaic of K074 and K100

K083 Cedar glades

K084 Cross Timbers

K089 Black Belt

K090 Live oak-sea oats

K098 Northern floodplain forest

K099 Maple-basswood forest

K100 Oak-hickory forest

K101 Elm-ash forest

K102 Beech-maple forest

K103 Mixed mesophytic forest

K104 Appalachian oak forest

K106 Northern hardwoods

K107 Northern hardwoods-fir forest

K108 Northern hardwoods-spruce forest

K109 Transition between K104 and K106

K110 Northeastern oak-pine forest

K111 Oak-hickory-pine

K112 Southern mixed forest

K113 Southern floodplain forest

K114 Pocosin

K115 Sand pine scrub

K116 Subtropical pine forest
  • 52. Kuchler, A. W. 1964. United States [Potential natural vegetation of the conterminous United States]. Special Publication No. 36. New York: American Geographical Society. 1:3,168,000; colored. [3455]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

ECOSYSTEMS [32]:

FRES10 White-red-jack pine

FRES11 Spruce-fir

FRES12 Longleaf-slash pine

FRES13 Loblolly-shortleaf pine

FRES14 Oak-pine

FRES15 Oak-hickory

FRES16 Oak-gum-cypress

FRES17 Elm-ash-cottonwood

FRES18 Maple-beech-birch

FRES30 Desert shrub

FRES32 Texas savanna

FRES33 Southwestern shrubsteppe

FRES35 Pinyon-juniper

FRES38 Plains grasslands

FRES39 Prairie

FRES40 Desert grasslands
  • 32. Garrison, George A.; Bjugstad, Ardell J.; Duncan, Don A.; Lewis, Mont E.; Smith, Dixie R. 1977. Vegetation and environmental features of forest and range ecosystems. Agric. Handb. 475. Washington, DC: U.S. Department of Agriculture, Forest Service. 68 p. [998]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

See lists above.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-headed woodpeckers prefer open woodlands and forest edges and clearings. They are often found in deciduous woodlands, river bottoms, open woods, orchards, parks, open country, savannas and grasslands with scattered trees. They generally prefer habitat with few tall, large-diameter trees.

The winter habitat of this species is similar to the breeding habitat; red-headed woodpeckers spend the winter in mature forests containing large, old trees. Their winter distribution within the range is thought to be primarily dependent on the abundance of food, particularly acorns.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Other Habitat Features: agricultural ; riparian

  • Smith, K., J. Withgott, P. Rodewald. 2000. Red-headed woodpecker (Melanerpes erythrocephalus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 518. Philadelphia: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Breeding populations in west and north move east and/or south for winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats insects and other invertebrates, berries and nuts, sap, young and eggs of birds. Flycatches, forages on ground and in trees (dead wood) and shrubs. Animal food about 50% of diet. Rarely drills into trees for insects (Terres 1980). Caches food items in crevices. Young are fed insects, worms, spiders, and berries.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Red-headed woodpeckers are omnivorous. They eat many different insects, spiders, earthworms, nuts, seeds, berries, fruit, bark and sometimes small mammals. They also eat eggs and chicks of Sialia, house sparrows < and Poecile.

Red-headed woodpeckers search for food in many different ways. They hunt for flying insects by perching on branches and watching for the insects, then chasing after them. They search for other foods on the ground, or in shrubs. Most woodpeckers drill into wood to find their food. Red-headed woodpeckers do drill into wood to look for food, but they spend more time hunting flying insects.

Red-headed woodpeckers stored food for winter in holes or cavities that they find. They do not drill out cavities to store food in. Instead, they look for cavities, and then break the food up so that it fits into the hole. Sometimes they plug up the hole with woodchips so that other animals don’t eat the food.

Animal Foods: birds; mammals; eggs; insects; terrestrial non-insect arthropods; terrestrial worms

Plant Foods: wood, bark, or stems; seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

More info for the terms: mast, natural

The red-headed woodpecker is omnivorous. Vegetative matter in the diet includes corn (Zea mays), dogwood (Cornus spp.) berries, huckleberries (Gaylussacia spp.), strawberries (Fragaria spp.), blackberries and raspberries (Rubus spp.), mulberries (Morus spp.), elderberries (Sambucus spp.), wild and cultivated black cherries (Prunus serotina), chokecherries (P. virginiana), grapes (Vitis spp.), apples (Malus spp.), pears (Pyrus spp.), pawpaw (Asimina spp.), Carolina lauralcherries (Prunus caroliniana), pecans (Carya illinoensis), acorns, beechnuts, and other seeds [6,35,63,94,96]. Animal foods include beetles (Coleoptera), ants and wasps (Hymenoptera), true bugs (Heteroptera), grasshoppers and crickets (Orthoptera), butterfly and moth larvae (Lepidoptera), spiders (Araneae), myriapods (Myriapoda), mice (Rodentia), small lizards (Iguania), and bird (primarily Passeriformes and Piciformes) eggs and nestlings [6,35,63,94,96]. In winter, red-headed woodpeckers may remain in their summer habitats if sufficient acorn or beechnut mast is available [6]. Maple seeds are an important winter food source for red-headed woodpeckers when other foods are not available [69].

Red-headed woodpeckers exhibit a myriad of behaviors for obtaining and storing food. Perhaps the most conspicuous behavior is flycatching for beetles and other insects [6,48,56,63,91]. Flycatching is less frequent during winter due to a decrease in flying insects during colder months [94]. Red-headed woodpeckers also glean insects, particularly adult beetles, from bark [16,48,94] and feed on insects on the ground [48,69]. Acorns are harvested both directly from trees and from the ground [17,82]. Red-headed woodpeckers may eat acorns immediately after harvesting, or carry them off to a cache [82].

Foods, including acorns and insects, are commonly cached in natural crevices and cavities, which are sealed with wet bark or wood to prevent pillaging by others [6,49]. Insects, such as June beetles (Phyllophaga spp.) and grasshoppers, are cached while still alive and wedged in cracks so they cannot escape [6,35]. Acorns and beechnuts are also stored in cracks and crevices for later use [6].

  • 6. Bent, Arthur Cleveland. 1939. Life histories of North American woodpeckers. U.S. Natural History Bulletin No. 174. 334 p. [62579]
  • 16. Conner, Richard N.; Jones, Stanley D.; Jones, Gretchen D. 1994. Snag condition and woodpecker foraging ecology in a bottomland hardwood forest. The Wilson Bulletin. 106(2): 242-257. [24214]
  • 17. Cypert, E.; Webster, B. S. 1948. Yield and use by wildlife of acorns of water and willow oaks. Journal of Wildlife Management. 12(3): 227-231. [18951]
  • 35. Graber, Jean W.; Graber, Richard R.; Kirk, Ethelyn L. 1977. Illinois birds: Picidae. Biological Notes No. 102. Urbana, IL: State of Illinois, Department of Registration and Education, Natural History Survey Division. 73 p. [64983]
  • 48. Jackson, Jerome A. 1976. A comparison of some aspects of the breeding ecology of red-headed and red-bellied woodpeckers in Kansas. The Condor. 78(1): 67-76. [61965]
  • 49. Kilham, Lawrence. 1983. Red-headed woodpecker. In: Paynter, Raymond A., Jr., ed. Life history studies of woodpeckers of eastern North America. Publications of the Nuttall Ornithological Club, No. 20. Cambridge, MA: Nuttall Ornithological Club: 113-128. [65711]
  • 56. MacRoberts, Michael H. 1970. Notes on the food habits and food defense of the acorn woodpecker. The Condor. 72: 196-204. [8117]
  • 63. Mumford, Russell E.; Keller, Charles E. 1984. The birds of Indiana. Bloomington, IN: Indiana University Press. 376 p. [60761]
  • 69. Reller, Ann Willbern. 1972. Aspects of behavioral ecology of red-headed and red-bellied woodpeckers. The American Midland Naturalist. 88(2): 270-290. [61970]
  • 82. Sork, Victoria L.; Stacey, Peter; Averett, John E. 1983. Utilization of red oak acorns in non-bumper crop year. Oecologia. 59: 49-53. [4593]
  • 91. Twomey, Arthur C. 1945. The bird population of an elm-maple forest with special reference to aspection, territorialism, and coactions. Ecological Monographs. 15(2): 173-205. [65511]
  • 94. Venables, Ann,; Collopy, Michael W. 1989. Seasonal foraging and habitat requirements of red-headed woodpeckers in north-central Florida. Tallahassee, FL: Florida Game and Fresh Water Fish Commission, Nongame Wildlife Program. 49 p. [61978]
  • 96. Wiebe, Karen L.; Koenig, Walter D.; Martin, Kathy. 2006. Evolution of clutch size in cavity-excavating birds: the nest site limitation hypothesis revisited. The American Naturalist. 167(3): 343-353. [61902]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Red-headed woodpeckers are one of the most omnivorous woodpecker species. Their diet includes a wide variety of insects, spiders, earthworms, nuts, seeds, berries, wild and cultivated fruit and occasionally small mammals. These woodpeckers are also known to eat young or eggs from the nests of bluebirds, house sparrows < and chickadees. Occasionally, they can also be seen eating bark.

Red-headed woodpeckers have many techniques for obtaining food. They perch on branches or utility poles watching for flying insects and then darting after them. They also spend time foraging on the ground or in shrubs. A common misconception is that all woodpeckers drill holes in trees to find the majority of their food. Although they occasionally drill dead trees for wood boring larvae, flying insects are more important in the diet of red-headed woodpeckers.

The majority of the food found by red-headed woodpeckers is stored in natural or anthropogenic crevices or holes that are not excavated by the woodpeckers themselves. If a piece of nut does not fit into the intended crevice, red-headed woodpeckers break the nut into pieces rather than modifying the crevice to fit the food. Some food stores are sealed with wood chips to protect the food from potential scavengers.

Animal Foods: birds; mammals; eggs; insects; terrestrial non-insect arthropods; terrestrial worms

Plant Foods: wood, bark, or stems; seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Red-headed woodpeckers affect the plant and animals they eat. For example, they may help to disperse the plants whose seeds they store and eat. Red-headed woodpeckers also creating nest cavities that other birds and mammals depend on. After the red-headed woodpeckers use a nest cavity, other birds and mammals may use it to nest.

Red-headed woodpeckers are food for their predators. They are also a habitat for several different parasites.

Ecosystem Impact: disperses seeds; creates habitat

Commensal/Parasitic Species:

  • Cavity nesting birds and mammals

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Red-headed woodpeckers adults are eaten by raptors, including Accipiter cooperii, and Falco peregrinus. Otus asio and Vulpes fulva also eat adult red-headed woodpeckers.

Snakes, such as Elaphe obsolete and mammals, including Procyon lotor and Glaucomys climb trees to hunt red-headed woodpecker chicks and eggs..

Adult red-headed woodpeckers scold predators by making a “churring” call.

Known Predators:

  • Cooper's hawks (Accipiter_cooperii)
  • peregrine falcons (Falco_peregrinus)
  • eastern screech-owls (Otus_asio)
  • red foxes (Vulpes_vulpes)
  • black rat snakes (Elaphe_obsoleta)
  • raccoons (Procyon_lotor)
  • flying squirrels (Glaucomys)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Snakes and mammals commonly predate red-headed woodpecker nests [20]. Northern raccoons (Procyon lotor), eastern racers (Coluber constrictor), and gray ratsnakes (Elaphe obsoleta spiloides) prey on eggs and nestlings [6,44,47]. Flying squirrels (Glaucomys spp.) will consume eggs of the red-headed woodpecker and then take over the nest cavity [3]. Eastern fox squirrels (Sciurus niger) may prey upon eggs and nestlings, although predation by this species has not been directly observed [7,23].

Cooper's hawks (Accipiter cooperi), northern harriers (Circus cyaneus), red-tailed hawks (Buteo jamaicensis), peregrine falcons (Falco peregrinus), eastern screech-owls (Megascops asio), and red foxes (Vulpes vulpes) also prey upon red-headed woodpeckers [27,28,29,35,89].

Nest parasitism by brown-headed cowbirds (Molothrus ater) is extremely rare [31].

  • 3. Bailey, Harold H. 1913. The birds of Virginia. Lynchburg, VA: J. P. Bell Co. 362 p. [65466]
  • 6. Bent, Arthur Cleveland. 1939. Life histories of North American woodpeckers. U.S. Natural History Bulletin No. 174. 334 p. [62579]
  • 7. Bergstrom, John T. 1977. Ecology and behavior of woodpeckers in the South Platte River floodplain. Greeley, CO: University of Northern Colorado. 110 p. Dissertation. [65319]
  • 20. Dennis, John V. 1971. Species using red-cockaded woodpecker holes in northeastern South Carolina. Journal of Ornithological Investigation. 42(2): 79-87. [26097]
  • 23. Doherty, Paul F., Jr.; Grubb, Thomas C., Jr.; Bronson, C. L. 1996. Territories and caching-related behavior of red-headed woodpeckers wintering in a beech grove. The Wilson Bulletin. 108(4): 740-747. [61930]
  • 27. Errington, Paul L. 1933. Food habits of southern Wisconsin raptors. Part II. Hawks. The Condor. 35(1): 19-29. [61995]
  • 28. Errington, Paul L. 1937. Food habits of Iowa red foxes during a drought summer. Ecology. 18(1): 53-61. [61985]
  • 29. Errington, Paul L.; Breckenridge, W. J. 1936. Food habits of marsh hawks in the glaciated prairie region of north-central United States. The American Midland Naturalist. 17(5): 831-848. [61986]
  • 31. Friedmann, Herbert. 1963. Hosts of the brown-headed cowbird. In: Host relations of the parasitic cowbirds. United States National Museum Bulletin No. 233. Washington, DC: United States National Museum: 41-172. [61104]
  • 35. Graber, Jean W.; Graber, Richard R.; Kirk, Ethelyn L. 1977. Illinois birds: Picidae. Biological Notes No. 102. Urbana, IL: State of Illinois, Department of Registration and Education, Natural History Survey Division. 73 p. [64983]
  • 44. Ingold, Danny J. 1991. Nest-site fidelity in red-headed and red-bellied woodpeckers. The Wilson Bulletin. 103(1): 118-122. [61934]
  • 47. Jackson, J. A. 1969. Observations at a nest of the red-headed woodpecker. Museum of Natural History, annual report, 1968-1969: 3-10. [65134]
  • 89. Toland, Brian R. 1990. Nesting ecology of red-tailed hawks in central Missouri. Transactions, Missouri Academy of Science. 24: 1-16. [22703]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Red-headed woodpeckers have an impact on the plant and animal species they eat. For example, they may aid in the dispersal of plants whose seeds they cache if the seeds are not later retrieved. Red-headed woodpeckers also play an important role in creating nest cavities for other cavity-nesting birds and mammals that do not excavate their own nest holes.

Red-headed woodpeckers provide food for their predators. They also host a number of internal and external parasites.

Ecosystem Impact: disperses seeds; creates habitat

Commensal/Parasitic Species:

  • Cavity nesting birds and mammals

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Red-headed woodpeckers adults are vulnerable to predation by raptors, including Cooper’s hawks, and peregrine falcons, eastern screech-owls and red foxes. Eggs and chicks are predated by snakes, including black rat snakes and mammals, including raccoons and flying squirrels.

Adult red-headed woodpeckers respond to approaching predators by scolding them with a “churring” call.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Melanerpes erythrocephalus (red-headed woodpecker) preys on:
Diptera
Lepidoptera
Coleoptera
wood-borers
Curculionidae
Hymenoptera
Myiarchus

Based on studies in:
USA: Illinois (Forest)

This list may not be complete but is based on published studies.
  • A. C. Twomey, The bird population of an elm-maple forest with special reference to aspection, territorialism, and coactions, Ecol. Monogr. 15(2):175-205, from p. 202 (1945).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

In Michigan, 52% of red-headed woodpecker nest cavities were usurped by starlings (Ingold 1989). In Ohio, 15% of cavities were lost to starlings (Ingold 1994). Woodpeckers do not necessarily incur a reduction in fecundity because they may be able to renest successfully later in the season, though this is not without its problems (Ingold 1994). High fidelity to breeding site--15 of 45 banded adults returned to previous year's nest area (Ingold 1991); one male moved 1 kilometer between breeding seasons (Belson 1998).

Summer territories 3.1-8.5 hectares (Venables and Collopy 1989); winter territories smaller (0.17 hectare to 1 hectare (Williams and Batzli 1979, Venables and Collopy 1989, Moskovits 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: density, fire exclusion, hardwood, litter, prescribed burn, prescribed fire, restoration, surface fire, tree

Oak savanna and other woodland habitats utilized by red-headed woodpeckers historically experienced frequent light- to moderate-severity surface fires [10]. Perhaps relating to an adaptive response to historical FIRE REGIMES, red-headed woodpeckers respond favorably toward sites restored through prescribed fire. For instance, red-headed woodpeckers increased in oak savanna restoration sites in Minnesota where prescribed fire was applied every 1 to 2 years over a 32-year period. The increase was likely due to an increase in standing dead trees on the site. The burn units with the highest dead:live tree ratio (0.623:0.865), lowest tree density (74-80 trees/ha), and lowest leaf area index (0.44-0.64) were most suitable to red-headed woodpeckers [19]. In Indiana, red-headed woodpeckers in a 60- to 120-year-old oak-hickory stand were present in prescribed surface fire sites but not in the unburned sites. The fires reduced understory woody vegetation by 40% to 80% and leaf litter by 50% to 80% [2]. Likewise, red-headed woodpeckers in Illinois were more abundant in oak savanna habitats restored through prescribed fire (3.1 individuals/10-point counts) than in closed-canopy forests that had not been burned (0.8 individual\/10-point counts) [9].

In a Kansas tallgrass prairie, red-headed woodpeckers on average were observed in low abundance (0.3 bird/km) in unburned watersheds, while none were observed in burned watersheds. Less woody vegetation was present in the burned sites than in the unburned sites, which may account for the lack of forest-dependent red-headed woodpeckers [100].

In a mature longleaf pine-loblolly pine-shortleaf pine stand with an open hardwood understory, more nonbreeding red-headed woodpeckers were observed in stands burned under prescription during the dormant season (0.16/plot) compared to the number observed in stands burned under prescription during the growing season (0.07/plot) in Georgia. However, the results were not statistically significant (P=0.53). Stands were burned every 3 years [50]. The opposite result was seen in a North Carolina study, where higher densities of red-headed woodpeckers were observed in plots burned under prescription during the growing season than in plots burned under prescription during the dormant season [25].

Mean observations of red-headed woodpeckers were higher in longleaf pine-loblolly pine-shortleaf pine/grassland restoration stands (0.14 detection/point count) than in traditionally managed longleaf pine-loblolly pine-shortleaf pine sawtimber stands (0.06 detection/point count) in Mississippi. The difference was nearly significant (P=0.08). The mixed pine-grassland restoration sites were even-aged stands with rotations ≥70 years, a prescribed burn interval of 2 to 3 years, and mid-story hardwood removal. Traditionally managed mixed pine sawtimber sites in the same study were subject to a 35-year rotation, prescribed burn intervals of 4 to 7 years, and no hardwood removal [98].

Red-headed woodpecker abundance was highest at the beginning of a fire exclusion regime in a loblolly pine-shortleaf pine stand in Florida. The lowest red-headed woodpecker abundance was continuously observed 6 to 15 years after fire exclusion was initiated. Hardwoods had created a thick mid-story up to 16 feet (5 m) following 15 years of fire exclusion [26]. In another Florida study, red-headed woodpeckers were most commonly observed in mature burned sandhills of naturally seeded longleaf pine (>50 years old) where burning had occurred within the last 3 years and at least 1 growing season had passed since the last fire. Red-headed woodpeckers were also regularly observed in mature flatwoods that had been burned within the past 5 years in Florida [90].

The use of silvicultural treatments in addition to fire may alter the postfire response of the red-headed woodpecker. The combined effects of fire and other silvicultural treatments in a Florida longleaf pine habitat were examined. Two years after an initial prescribed burn, experimental treatments of herbicide (hexazinone) and chainsaw felling-girdling of most hardwoods and all sand pine were applied. A burn-only site and a control site were also monitored. A second prescribed burn was conducted in the spring 2 years after the other experimental treatments were applied. The herbicide-treated plots had the lowest abundance of red-headed woodpeckers in the year after the final prescribed burn, but the highest abundance among all treatments a year later. The burn-only plots and the felling-girdling plots had intermediate abundance of red-headed woodpeckers during both years of observation. No red-headed woodpeckers were observed in control plots. None of the differences were significant (P>0.05) [68].

The following table provides fire return intervals for plant communities and ecosystems where the red-headed woodpecker is important. For further information, see the FEIS review of the dominant plant species listed below.

Community or Ecosystem Dominant Species Fire Return Interval Range (years)
maple-beech Acer-Fagus spp. 684-1,385 [13,95]
maple-beech-birch Acer-Fagus-Betula spp. >1,000
silver maple-American elm Acer saccharinum-Ulmus americana <5 to 200
sugar maple Acer saccharum >1,000
sugar maple-basswood Acer saccharum-Tilia americana >1,000 [95]
birch Betula spp. 80-230 [87]
plains grasslands Bouteloua spp. <35 [67,99]
sugarberry-America elm-green ash Celtis laevigata-Ulmus americana-Fraxinus pennsylvanica <35 to 200
beech-sugar maple Fagus spp.-Acer saccharum >1,000
black ash Fraxinus nigra 95]
green ash Fraxinus pennsylvanica <35 to >300 [24,95]
cedar glades Juniperus virginiana 3-22 [37,67]
yellow-poplar Liriodendron tulipifera <35
shortleaf pine Pinus echinata 2-15
shortleaf pine-oak Pinus echinata-Quercus spp. <10
slash pine Pinus elliottii 3-8
slash pine-hardwood Pinus elliottii-variable <35
sand pine Pinus elliottii var. elliottii 25-45 [95]
South Florida slash pine Pinus elliottii var. densa 1-15 [64,81,95]
longleaf-slash pine Pinus palustris-P. elliottii 1-4 [64,95]
longleaf pine-scrub oak Pinus palustris-Quercus spp. 6-10
pocosin Pinus serotina 3-8
pond pine Pinus serotina 3-8
eastern white pine-northern red oak-red maple Pinus strobus-Quercus rubra-Acer rubrum 35-200
loblolly pine Pinus taeda 3-8
loblolly-shortleaf pine Pinus taeda-P. echinata 10 to <35
Virginia pine Pinus virginiana 10 to <35
Virginia pine-oak Pinus virginiana-Quercus spp. 10 to <35
sycamore-sweetgum-American elm Platanus occidentalis-Liquidambar styraciflua-Ulmus americana <35 to 200 [95]
eastern cottonwood Populus deltoides <35 to 200 [67]
black cherry-sugar maple Prunus serotina-Acer saccharum >1,000
oak-hickory Quercus-Carya spp. <35
northeastern oak-pine Quercus-Pinus spp. 10 to <35 [95]
oak-gum-cypress Quercus-Nyssa-spp.-Taxodium distichum 35 to >200 [64]
southeastern oak-pine Quercus-Pinus spp. <10
white oak-black oak-northern red oak Quercus alba-Q. velutina-Q. rubra <35
northern pin oak Quercus ellipsoidalis <35
bear oak Quercus ilicifolia <35
bur oak Quercus macrocarpa <10 [95]
oak savanna Quercus macrocarpa/Andropogon gerardii-Schizachyrium scoparium 2-14 [67,95]
chestnut oak Quercus prinus 3-8
northern red oak Quercus rubra 10 to <35
post oak-blackjack oak Quercus stellata-Q. marilandica <10
live oak Quercus virginiana 10 to<100 [95]
cabbage palmetto-slash pine Sabal palmetto-Pinus elliottii <10 [64,95]
  • 10. Brawn, Jeffrey D.; Robinson, Scott K.; Thompson, Frank R. 2001. The role of disturbance in the ecology and conservation of birds. Annual Review of Ecology and Systematics. 32: 251-276. [55773]
  • 90. Tucker, James W.; Hill, Geoffrey E.; Holler, Nicholas R. 2003. Longleaf pine restoration: implications for landscape-level effects on bird communities in the lower Gulf Coastal Plain. Southern Journal of Applied Forestry. 27(2): 107-121. [44563]
  • 2. Aquilani, Steven M.; Morrell, Thomas E.; LeBlanc, David C. 2003. Breeding bird communities in burned and unburned sites in a mature Indiana oak forest. Proceedings of the Indiana Academy of Science. 112(2): 186-191. [60825]
  • 9. Brawn, Jeffrey D. 2006. Effects of restoring oak savannas on bird communities and populations. Conservation Biology. 20(2): 460-469. [61997]
  • 19. Davis, Mark A.; Peterson, David W.; Reich, Peter B.; Crozier, Michelle; Query, Toby; Mitchell, Eliot; Huntington, Josh; Bazakas, Paul. 2000. Restoring savanna using fire: impact on the breeding bird community. Restoration Ecology. 8(1): 30-40. [35984]
  • 24. Eggler, Willis A. 1980. Live oak. In: Eyre, F. H., ed. Forest cover types of the United States and Canada. Washington, DC: Society of American Foresters: 63-64. [49984]
  • 26. Engstrom, R. Todd; Crawford, Robert L.; Baker, W. Wilson. 1984. Breeding bird populations in relation to changing forest structure following fire exclusion: a 15-year study. The Wilson Bulletin. 96(3): 437-450. [60735]
  • 37. Guyette, Richard; McGinnes, E. A., Jr. 1982. Fire history of an Ozark glade in Missouri. Transactions, Missouri Academy of Science. 16: 85-93. [5170]
  • 50. King, T. Gregory; Howell, Mark A.; Chapman, Brian R.; Miller, Karl V.; Schorr, Robert A. 1998. Comparisons of wintering bird communities in mature pine stands managed by prescribed burning. The Wilson Bulletin. 110(4): 570-574. [36037]
  • 64. Myers, Ronald L. 2000. Fire in tropical and subtropical ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 161-173. [36985]
  • 67. Paysen, Timothy E.; Ansley, R. James; Brown, James K.; Gottfried, Gerald J.; Haase, Sally M.; Harrington, Michael G.; Narog, Marcia G.; Sackett, Stephen S.; Wilson, Ruth C. 2000. Fire in western shrubland, woodland, and grassland ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 121-159. [36978]
  • 68. Provencher, Louis; Gobris, Nancy M.; Brennan, Leonard A.; Gordon, Doria R.; Hardesty, Jeffrey L. 2002. Breeding bird response to midstory hardwood reduction in Florida sandhill longleaf pine forests. Journal of Wildlife Management. 66(3): 641-661. [42243]
  • 81. Snyder, James R.; Herndon, Alan; Robertson, William B., Jr. 1990. South Florida rockland. In: Myers, Ronald L.; Ewel, John J., eds. Ecosystems of Florida. Orlando, FL: University of Central Florida Press: 230-274. [17391]
  • 87. Swain, Albert M. 1978. Environmental changes during the past 2000 years in north-central Wisconsin: analysis of pollen, charcoal, and seeds from varved lake sediments. Quaternary Research. 10: 55-68. [6968]
  • 95. Wade, Dale D.; Brock, Brent L.; Brose, Patrick H.; Grace, James B.; Hoch, Greg A.; Patterson, William A., III. 2000. Fire in eastern ecosystems. In: Brown, James K.; Smith, Jane Kapler, eds. Wildland fire in ecosystems: Effects of fire on flora. Gen. Tech. Rep. RMRS-GTR-42-vol. 2. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 53-96. [36983]
  • 98. Wood, Douglas R.; Burger, L. Wes, Jr.; Bowman, Jacob L., Hardy, Carol L. 2004. Avian community response to pine-grassland restoration. Wildlife Society Bulletin. 32(3): 819-829. [61603]
  • 99. Wright, Henry A.; Bailey, Arthur W. 1982. Fire ecology: United States and southern Canada. New York: John Wiley & Sons. 501 p. [2620]
  • 100. Zimmerman, John L. 1992. Density-dependent factors affecting the avian diversity of the tallgrass prairie community. The Wilson Bulletin. 104(1): 85-94. [60823]
  • 13. Cleland, David T.; Crow, Thomas R.; Saunders, Sari C.; Dickmann, Donald I.; Maclean, Ann L.; Jordan, James K.; Watson, Richard L.; Sloan, Alyssa M.; Brosofske, Kimberley D. 2004. Characterizing historical and modern FIRE REGIMES in Michigan (USA): a landscape ecosystem approach. Landscape Ecology. 19: 311-325. [54326]
  • 25. Engstrom, R. T.; McNair, D. B.; Brennan, L. A.; Hardy, C. L.; Burger, L. W. 1996. Influence on birds of dormant versus lightning-season prescribed fire in longleaf pine forests: experimental design and preliminary results. In: Wadsworth, Kelly G.; McCabe, Richard E., eds. Facing realities in resource management: Transactions of the 61st North American wildlife and natural resource conference; 1996 March 22-27; Tulsa, OK. 61. [Place of publication unknown]: [Publisher unknown]: 200-207. [62434]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Direct Effects of Fire

More info for the terms: direct effects of fire, fire severity, fuel, prescribed fire, severity, snag, tree

The direct effects of fire on red-headed woodpeckers are largely speculative. Fire is unlikely to have major effects on adult birds because adults can fly from smoke and flames [55]. However, fire could have detrimental effects on nestlings and eggs, since their mobility is limited [55].

Only one paper documenting the direct effects of fire on red-headed woodpeckers was found. In the study, a longleaf pine snag containing an active red-headed woodpecker nest ignited during a prescribed May fire in the Florida sandhills [4]. The snag fell on the day of the fire and the nestlings initially survived. The parents continually visited and fed the nestlings. However, by the fourth day, the nestlings had died and were covered with ants [4]. Based on these observations, it is plausible to conclude that the nestlings may have survived if they were within a few days of fledging.

The effects of fire on canopy nesting birds depend primarily on fire severity [55]. Severe surface fires and crown fires may cause injury or death to species nesting in the forest canopy, but such fires typically happen late in the breeding season presumably after many nestlings have fledged. Effects on reproductive success may depend upon the timing of a fire event and any attempts to raise a second brood [55]. See Timing of Major Life History Events for more information on the reproductive biology of the red-headed woodpecker.

Snags are both created and lost during fires. In a red-headed woodpecker study in the sandhills and wet pine flatwoods of central Florida, >33% of nest snags were created during past fires [5]. In other minor habitat types in the study, 83% of nest snags were also created by fire. Prescribed fire later destroyed approximately 50% of the nest snags in the wet pine flatwoods, 70% of nest snags in the sandhills, and no nest snags in the other habitats. The sandhills were dominated by longleaf pine, the flatwoods were dominated by pond pine and longleaf pine, and the other habitats were dominated by sand pine (P. clausa), loblolly pine, and loblolly bay (Gordonia lasianthus) [5].

Fires that destroy nest trees may limit the reproductive potential of canopy-nesting birds. However, taking measures to protect nest trees may minimize the impact fire has on red-headed woodpeckers and their nests. In a review, Robbins and Myers [70] cited a North Carolina study in which red-cockaded woodpeckers were mildly affected by growing-season prescribed fires. Before the fires, flammable materials were cleared from the bases of nest trees. Four red-cockaded woodpecker nests in the study successfully fledged 9 young, while a fifth nest failed. Study recommendations for minimizing deleterious effects of growing-season fire on red-cockaded woodpeckers and their nests include: 1) burning only after nests have been identified; 2) burning only on sites with low fuel accumulation; 3) burning only on days with low ambient temperatures; 4) clearing fuels from the bases of nest trees; and 5) setting backfires to the windward side of nest trees [70]. Since red-headed woodpeckers share some nesting preferences and habitats with the red-cockaded woodpecker, such as the use of large trees for nesting in pine habitats, red-headed woodpeckers may incur similar benefits from prefire site preparation.

Short-term food availability may be improved by fire. Other flycatching birds, such as eastern phoebes (Sayornis phoebe), eastern wood-pewees (Cantopus virens), eastern kingbirds (Tyrannus tyrannus), tree swallows (Tachycineta bicolor), southern rough-winged swallows (Stelgidopteryx ruficollis), and purple martins (Progne subis), actively forage on the multitude of insects available in smoke [51]. Fruits, such as huckleberries and blackberries, that are also utilized as forage may be unavailable during the same year of a burn, but are often abundant during following years [86].

  • 5. Belson, Michael Shane. 1998. Red-headed woodpecker (Melanerpes erythrocephalus) use of habitat at Wekiwa Springs State Park, Florida. Orlando, FL: University of Central Florida. 65 p. Thesis. [65156]
  • 4. Belson, M. Shane; Small, Parks E. 1998. Uncommon behaviors of red-headed woodpeckers in central Florida. Florida Field Naturalist. 26(2): 44-45. [61941]
  • 51. Komarek, E. V., Sr. 1969. Fire and animal behavior. In: Proceedings, annual Tall Timbers fire ecology conference; 1969 April 10-11; Tallahassee, FL. No. 9. Tallahassee, FL: Tall Timbers Research Station: 161-207. [13531]
  • 55. Lyon, L. Jack; Telfer, Edmund S.; Schreiner, David Scott. 2000. Direct effects of fire and animal responses. In: Smith, Jane Kapler, ed. Wildland fire in ecosystems: Effects of fire on fauna. Gen. Tech. Rep. RMRS-GTR-42-vol. 1. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 17-23. [44435]
  • 70. Robbins, Louise E.; Myers, Ronald L. 1992. Seasonal effects of prescribed burning in Florida: a review. Misc. Publ. No. 8. Tallahassee, FL: Tall Timbers Research, Inc. 96 p. [21094]
  • 86. Stoddard, Herbert L., Sr. 1963. Bird habitat and fire. In: Proceedings, 2nd annual Tall Timbers fire ecology conference; 1963 March 14-15; Tallahassee, FL. Tallahassee, FL: Tall Timbers Research Station: 163-175. [18997]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: mast, tree

Red-headed woodpeckers are temperate migrants with migratory habits that are largely influenced by the availability of mast in winter [6,40,63]. Migrants typically travel south and east in autumn if the mast fails at breeding sites. If mast is plentiful, however, red-headed woodpeckers often overwinter at or near their breeding sites [80]. Fall migration occurs from late August to early November with a peak in September [6,35,63,80]. Spring migration commences in mid-February with a peak from late April to mid-May [6,35,80].

Red-headed woodpeckers are highly territorial and aggressive [6,49,63]. Confrontations between conspecifics and other species are common [6,42,69]. Red-headed woodpeckers usurp nests from northern flickers (Colaptes auratus) and red-bellied woodpeckers (Melanerpes carolinus) [42,45]. In turn, red-headed woodpecker nests are occasionally usurped by European starlings (Sturnus vulgaris) [42,43,45]. Despite their aggressive temperaments, red-headed woodpeckers occasionally share a nest tree with other species including red-bellied woodpeckers, northern flickers, European starlings, American kestrels (Falco sparverius), and Indiana bats (Myotis sodalis) [43,44,53,69,94].

Although solitary in winter [57,62], red-headed woodpeckers are monogamous and may remain paired for several breeding seasons [44]. Red-headed woodpeckers are primary cavity nesters that excavate their own nest and roost cavities [80,83]. However, they also use existing holes for nesting and roosting [5,20,80]. Nesting is typically initiated from early May to mid-June, but it may begin as early as February in the Southeast [42,45,69,85]. Excavation of nest cavities begins during the second half of April, peaks in early May, and continues until the end of July [35,42]. Egg laying begins in early May and usually ends by mid-August [7,35,42,48]. Clutches contain 4 to 5 eggs on average, with 3 to 10 eggs possible [6,35,42,48,59,96]. Some pairs raise 2 broods in a season [6,42,43,44]. Clutch size is typically larger during first brood attempts than second brood attempts [42].

Incubation lasts 12 to 14 days [6,7,48,59,69]. Asynchronous hatching may occur if incubation begins before all eggs are laid [48]. Nestlings are present from mid-May to late August with a peak in early to mid-June in the southern extent of the range and a mid-July peak in the northern extent [42,45]. Fledging occurs from the second week of June to the first week of September [7,35,42,45]. Nestlings fledge at approximately 24 to 30 days of age [6,7,59,69]. Pairs in Mississippi fledged 2.1 to 2.3 young/brood on average [42]. Parents drive juveniles from the nest several weeks after fledging [7,62].

Red-headed woodpeckers generally have high nesting success. In Colorado, red-headed woodpeckers experienced 50% to100% nesting success [7]. Average nest success was 78% throughout the United States [59].

Red-headed woodpecker mortality is highly variable. Winter mortality of red-headed woodpeckers in Ohio was 7% [23]. Annual mortality of adult red-headed woodpeckers was reported as 38% in a review [59]. Adult mortality was low in a Colorado study [7]. Red-headed woodpeckers may succumb to exposure in winter. Both adult and juvenile red-headed woodpeckers were found dead in Illinois after heavy snowfall and severe cold. Immature red-headed woodpeckers may fare worse than adults [34].

The maximum life span of the red-headed woodpecker is unknown. One red-headed woodpecker was recaptured 9 years and 11 months after banding [12]. However, most red-headed woodpeckers probably do not live more than 2 years [35].

  • 5. Belson, Michael Shane. 1998. Red-headed woodpecker (Melanerpes erythrocephalus) use of habitat at Wekiwa Springs State Park, Florida. Orlando, FL: University of Central Florida. 65 p. Thesis. [65156]
  • 6. Bent, Arthur Cleveland. 1939. Life histories of North American woodpeckers. U.S. Natural History Bulletin No. 174. 334 p. [62579]
  • 7. Bergstrom, John T. 1977. Ecology and behavior of woodpeckers in the South Platte River floodplain. Greeley, CO: University of Northern Colorado. 110 p. Dissertation. [65319]
  • 12. Clapp, R. B.; Klimkiewicz, M. K.; Futcher, A. G. 1983. Longevity records of North American birds: Columbidae through Paridae. Journal of Field Ornithology. 54: 123-137. [65032]
  • 20. Dennis, John V. 1971. Species using red-cockaded woodpecker holes in northeastern South Carolina. Journal of Ornithological Investigation. 42(2): 79-87. [26097]
  • 23. Doherty, Paul F., Jr.; Grubb, Thomas C., Jr.; Bronson, C. L. 1996. Territories and caching-related behavior of red-headed woodpeckers wintering in a beech grove. The Wilson Bulletin. 108(4): 740-747. [61930]
  • 34. Graber, Jean W.; Graber, Richard R. 1979. Severe winter weather and bird populations in southern Illinois. The Wilson Bulletin. 91(1): 88-103. [65135]
  • 35. Graber, Jean W.; Graber, Richard R.; Kirk, Ethelyn L. 1977. Illinois birds: Picidae. Biological Notes No. 102. Urbana, IL: State of Illinois, Department of Registration and Education, Natural History Survey Division. 73 p. [64983]
  • 40. Herkert, James R. 1995. An analysis of midwestern breeding bird population trends: 1966-1993. The American Midland Naturalist. 134(1): 41-50. [26795]
  • 42. Ingold, Danny J. 1989. Nesting phenology and competition for sites among red-headed and red-bellied woodpeckers and European starlings. The Auk. 106: 209-217. [61938]
  • 43. Ingold, Danny J. 1990. Simultaneous use of nest trees by breeding red-headed and red-bellied woodpeckers and European starlings. The Condor. 92(1): 252-253. [61936]
  • 44. Ingold, Danny J. 1991. Nest-site fidelity in red-headed and red-bellied woodpeckers. The Wilson Bulletin. 103(1): 118-122. [61934]
  • 45. Ingold, Danny J. 1994. Influence of nest-site competition between European starlings and woodpeckers. The Wilson Bulletin. 106(2): 227-241. [24096]
  • 48. Jackson, Jerome A. 1976. A comparison of some aspects of the breeding ecology of red-headed and red-bellied woodpeckers in Kansas. The Condor. 78(1): 67-76. [61965]
  • 49. Kilham, Lawrence. 1983. Red-headed woodpecker. In: Paynter, Raymond A., Jr., ed. Life history studies of woodpeckers of eastern North America. Publications of the Nuttall Ornithological Club, No. 20. Cambridge, MA: Nuttall Ornithological Club: 113-128. [65711]
  • 53. Kurta, Allen; Kath, Joseph; Smith, Eric L.; Foster, Rodney; Orick, Michael W.; Ross, Ronald. 1993. A maternity roost of the endangered Indiana bat (Myotis sodalis) in an unshaded, hollow, sycamore tree (Platanus occidentalis). The American Midland Naturalist. 130(2): 405-407. [53799]
  • 57. MacRoberts, Michael H. 1975. Food storage and winter territory in red-headed woodpeckers in northwestern Louisiana. The Auk. 92(2): 382-385. [61967]
  • 59. Martin, Thomas E. 1995. Avian life history evolution in relation to nest sites, nest predation, and food. Ecological Monographs. 65(1): 101-127. [61994]
  • 63. Mumford, Russell E.; Keller, Charles E. 1984. The birds of Indiana. Bloomington, IN: Indiana University Press. 376 p. [60761]
  • 69. Reller, Ann Willbern. 1972. Aspects of behavioral ecology of red-headed and red-bellied woodpeckers. The American Midland Naturalist. 88(2): 270-290. [61970]
  • 80. Smith, Kimberly G.; Withgott, James H.; Rodewald, Paul G. 2000. Red-headed woodpecker--Melanerpes erythrocephalus. In: Poole, A.; Gill, F., eds. The birds of North America. No. 518. Philadelphia, PA: The Academy of Natural Sciences; Washington, DC: The American Ornithologists' Union: 1-27. [61928]
  • 83. Stauffer, Dean F.; Best, Louis B. 1980. Habitat selection by birds of riparian communities: evaluation effects of habitat alterations. Journal of Wildlife Management. 44(1): 1-15. [8118]
  • 85. Stevenson, Henry M.; Anderson, Bruce H. 1994. The birdlife of Florida. Gainesville, FL: University of Florida Press. 892 p. [60776]
  • 94. Venables, Ann,; Collopy, Michael W. 1989. Seasonal foraging and habitat requirements of red-headed woodpeckers in north-central Florida. Tallahassee, FL: Florida Game and Fresh Water Fish Commission, Nongame Wildlife Program. 49 p. [61978]
  • 96. Wiebe, Karen L.; Koenig, Walter D.; Martin, Kathy. 2006. Evolution of clutch size in cavity-excavating birds: the nest site limitation hypothesis revisited. The American Naturalist. 167(3): 343-353. [61902]
  • 62. Moskovits, Debra. 1978. Winter territorial and Foraging behavior of red-headed woodpeckers in Florida. Wilson Bulletin. 90(4): 521-535. [61957]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Red-headed woodpeckers communicate using many different calls. They also communicate by drumming on wooden surfaces, such as trees, with their beak. This makes a loud, fast noise. Vocalizations and drumming can be used to communicate many different things. They may be used to defend a territory, to attract a mate, or to communicate between parents. For example a male and female may perform mutual tapping while building the nest. The male taps on the inside of the nest cavity and the female taps on the outside. This is one way that the pair can communicate with each other.

Communication Channels: visual ; acoustic

Other Communication Modes: duets

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Red-headed woodpeckers communicate using a wide array of calls and drumming. Both vocalizations and drumming seem to be used in a variety of social situations, including territorial encounters, courtship, copulation and communication between a mated pair. For example, mutual tapping (male tapping on the inside of the nest cavity while female taps on the outside) may play an important role in courtship.

Communication Channels: visual ; acoustic

Other Communication Modes: duets

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest known wild red-headed woodpecker lived at least 9 years and 11 months.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: wild:
119 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Annual adult survivorship is estimated to be about 62% in this species. The oldest known wild red-headed woodpecker lived at least 9 years and 11 months.

Range lifespan

Status: wild:
12 (high) years.

Average lifespan

Status: wild:
119 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10 years
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In the southeastern U.S. and Ohio, nests generally are initiated in early May (Ingold 1989, 1994). Clutch size is four to seven (usually five). Incubation about 14 days, by both sexes. Young are tended by both parents, leave nest at about 27 days. Commonly two broods annually in south.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-headed woodpeckers are probably monogamous. We do not know very much about how males and female form breeding pairs, or how long breeding pairs stay together. Some breeding pairs breed together for several years.

Mating System: monogamous

Red-headed woodpeckers nest in tree holes, under roofs of buildings, in fence posts, or in utility poles. They like holes in dead trees the best. The male and female work together to drill out the nest hole. The opening of the hole is usually 5-6 cm wide, but inside the tree the hole gets wider, usually 7-11 cm. They reach 20 to 60 cm into the tree.

Red-headed woodpeckers lay their eggs between April and July. They lay 3 to 10 eggs in each clutch. Both parents incubate the eggs for 12 to 14 days. The chicks are altricial (helpless) when they hatch; they are naked and their eyes are closed for the first 12 to 13 days. Both parents feed and brood the chicks. The chicks leave the nest at 24 to 31 days old. They are strong fliers and can catch their own food soon after fledging. If chicks stay near the nest, the parents chase them away after several weeks. The chicks will are able to breed the next summer.

Red-headed woodpeckers raise one or two broods a year. Breeding pairs may even start laying eggs for a second brood while they are feeding their first brood of chicks. They usually raise the second brood in a new nest hole.

Breeding interval: Red-headed woodpeckers have one or two broods a year.

Breeding season: The breeding season spans from April to July.

Range eggs per season: 3 to 10.

Average eggs per season: 5.

Range time to hatching: 12 to 14 days.

Range fledging age: 24 to 31 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

Male and female red-headed woodpeckers build the nest, incubate the eggs, and feed and brood the chicks.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Smith, K., J. Withgott, P. Rodewald. 2000. Red-headed woodpecker (Melanerpes erythrocephalus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 518. Philadelphia: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-headed woodpeckers are thought to be monogamous, though polygyny may occur. There is little information available about formation or duration of pair bonds in this species, though some pairs are known to have mated together over several seasons.

Mating System: monogamous

These woodpeckers nest in cavities that they excavate with their beaks. The nest sites range from natural holes, to under roofs of buildings, to fence posts, or utility poles. Preferred nest sites are in dead trees. Both the male and female excavate the nest, though the male does most of the drilling. The cavity is 20 to 60 cm deep. The cavity entrance is 5-6 cm in diameter, but expands inside to nearly twice that width.

The eggs are laid between April and July, with clutch sizes of 3 to 10 eggs, most commonly 5 eggs. Incubation begins after the last egg is laid, and lasts 12 to 14 days. Both parents incubate, with males incubating at night. The chicks are altricial when they hatch; they are naked and their eyes don’t open for 12 to 13 days. The young are fed and brooded by both parents and leave the nest at 24 to 31 days old. The chicks are strong fliers and able to catch their own food soon after fledging. Chicks that remain near the nest after several weeks are chased away by the parents. The chicks will be able to breed the next summer.

Red-headed woodpeckers have one or two broods a year. Pairs may start a second nesting attempt while still feeding the first brood. Though the second brood can be raised in the same nest, a new nest cavity is usually found.

Breeding interval: Red-headed woodpeckers have one or two broods a year.

Breeding season: The breeding season spans from April to July.

Range eggs per season: 3 to 10.

Average eggs per season: 5.

Range time to hatching: 12 to 14 days.

Range fledging age: 24 to 31 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 5.

Male and female red-headed woodpeckers share most of the parental responsibilities, including nest construction, incubation, feeding, brooding and otherwise caring for the young.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

  • Smith, K., J. Withgott, P. Rodewald. 2000. Red-headed woodpecker (Melanerpes erythrocephalus). Pp. 1-28 in A Poole, F Gill, eds. The Birds of North America, Vol. 518. Philadelphia: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melanerpes erythrocephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTCTCCACCAACCACAAAGACATTGGCACACTGTACCTCATCTTCGGTGCATGAGCTGGCATAATTGGNACAGCCCTCAGCCTACTCATTCGCGCTGAACTAGGCCAACCTGGCACCCTCCTAGGTGAC---GACCAAATTTATAATGTNATCGTCACTGCCCACGCATTCGTGATAATTTTCTTTATAGTNATACCCATCATAATTGGNGGATTTGGAAACTGACTCGTACCCCTAATAATTGGNGCCCCCGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGANTTCTCCCCCCATCATTCCTTCTCCTCCTAGCCTCCTCTACCGTAGAAGCAGGAGCTGGAACAGGATGAACTGTCTACCCACCCCTTGCCGGCAACCTAGCCCACGCAGGAGCCTCAGTAGACCTAGCCATCTTCTCACTCCACCTAGCCGGTATTTCATCTATCCTAGGGGCAATTAACTTCATTACAACAGCCATCAACATGAAACCCCCAGCCACTTCCCAATACCAAACCCCACTATTCGTCTGATCCGTCCTCATCACTGCCATCCTACTCCTCCTATCCCTCCCAGTCCTCGCTGCTGGCATCACAATGCTTCTCACAGACCGCAACCTAAACACTACATTCTTTGACCCCGCCGGAGGAGGTGACCCAATCCTATACCAACACCTCTTTTGATTCTTTGGCCATCCAGAAGTCTACATCCTCATCCTTCCAGGATTCGGAATTATCTCGCATGTAGTAGCATACTATGCTGGTAAAAAGGAACCCTTCGGCTATATGGGTATGGTATGAGCTATGCTCTCCATCGGNTTCCTCGGCTTTATTGNTTGAGCCCACCATATATTTACCGTAGGAATGGATGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Melanerpes erythrocephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4B - Apparently Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Butcher, G., Rosenberg, K. & Wells, J.

Justification
This species has shown long-term declines which have continued at a moderately rapid rate owing to loss and degradation of its habitat in recent decades. Consequently it is considered Near Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-headed woodpeckers used to be very common in North America. However, they are becoming less common. In the 1890's, European starlings (Sturnus_vulgaris) were brought to North America from Europe. European starlings became very common. They compete with red-headed woodpeckers for nesting cavities, and make it difficult for red-headed woodpeckers to find a nest site to breed. Red-headed woodpeckers also lose nest sites when people cut down old dead trees.

Red-headed woodpeckers are often killed when they are hit by cars. To make sure that red-headed woodpeckers survive, humans need to protect their habitat and control populations of European starlings.

Red-headed woodpeckers are protected under the US Migratory Bird Treaty Act.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red-headed woodpeckers were once very common throughout eastern North America, but have been decreasing in abundance. In the 1890's, the introduction of European starlings (Sturnus vulgaris) had a significant negative impact on red-headed woodpeckers. The starlings compete with these woodpeckers for their nesting holes, frequently driving them from their homes.

Also contributing to the decline of red-headed woodpeckers is the increased removal of dead trees containing potential nest sites. The increased use of automobiles has also led to declining numbers of red-headed woodpeckers, which are often struck by cars when swooping for prey. In order to conserve red-headed woodpeckers, their habitat needs to be protected and European starling populations must be controlled.

Red-headed woodpeckers are protected under the US Migratory Bird Treaty Act. They are listed as a near-threatened species by the IUCN.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Rich et al. (2004).


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: HABITAT: Local declines probably have been due to loss of nesting habitat as a result of firewood cutting and forest clearing for agriculture and residential development. Loss of mature bottomland hardwood forest continues to pose threats to breeding and wintering habitat (Kilham 1958, Moscovits 1978). More than 63 percent of the original southeastern bottomland hardwood forests have been lost, and the rate of loss per decade in eastern Texas is 14 percent (USFWS 1984). Declining in urban and suburban areas due to removal of dead limbs and branches (Pulich 1988). Reforestation of eastern U.S., loss of small orchards, loss of chestnuts, decline of oak savannah habitat, fire suppression in the 20th century, and the switch to "cleaner" agricultural practices (e.g., removal of hedgerows, odd corners on fields, larger monoculture fields) probably have all contributed to the decline (Smith et al., in press). Habitat areas in isolated woodlots and trees surrounded by cropland may increase exposures to pesticides, but this has not been documented. COMPETTION: In Michigan, 52 percent of nest cavities were usurped by European Starling (STURNUS VULGARIS; Ingold 1989). In Ohio, 15 percent of cavities were lost to starlings (Ingold 1994). Woodpeckers do not necessarily incur a reduction in fecundity because they may be able to re-nest successfully later in the season, though this is not without its problems (Ingold 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Habitat degradation, as a result of the removal of dead trees and branches in urban areas (Pulich 1988), and loss of nesting habitat to firewood cutting, clear cutting, agricultural development and river channelling in rural areas (Ehrlich et al. 1992, Melcher 1998), appears to be responsible. Collisions with moving vehicles may be a contributing factor, but persecution as a pest by farmers and utility companies is currently minimal (Smith et al. 2000, del Hoyo et al. 2002).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Restoration Potential: Probably good, provided adequate nesting and foraging substrates and good mast production areas are available. In the midwest, Brawn (1998) found population densities increasing in areas of oak savannah restoration.

Preserve Selection and Design Considerations: Preserves need to include woodlot fragments greater than 1.99 hectares (Gutzwiller and Anderson 1987) with a diverse size selection of dead limbs and snags, preferably in groups because birds require multiple snags for roosting and/or foraging (Conner 1976, Sedgewick and Knopf 1990). Open areas above and on the ground are needed for flycatching and ground foraging (Conner and Adkisson 1977). Preserves in longleaf pine savannah should encourage maintenance of a greater basal area of mature pines and numerous large diameter snags and logs (Shackelford and Conner 1997).

Open bottomland forest is extremely important as breeding and wintering habitat (Dickson 1978) and supports large wintering populations in some areas. The correlation of wintering numbers with mast crop abundance (Smith 1986) suggests a need to provide ample mast (e.g., acorns and beechnuts). In a Colorado study, a high density of medium sized trees were important for nest selection (Sedgewick and Knopf 1990), with open areas of 30 meters or greater around nest trees. (Jackson 1976). One model of nesting habitat suggests that fragment area and size of nearest streamside habitat were significantly related to probability of nesting in southeastern Wyoming (Smith et al., in press).

Management Requirements: Management in bottomland forest should include provision of a mature overstory where trees are left to die of natural causes to supply a sufficient number of small and large snags and logs. In some habitats, prescribed burning to deter pioneering hardwoods and remove ground cover could be utilized to maintain a savannah-like condition with increased aerial and ground foraging opportunities (Shackelford and Conner 1997). Preference for dead limbs as nesting substrates and sensitivity to management that reduces dead limb length suggest a need to maintain dead limbs on large living and dead trees in urban park-like areas and vacant lots (Sedgewick and Knopf 1990). Young trees could be planted in a temporal sequence to provide replacement trees in areas where natural replacement is reduced (Conner 1976). Will forage in clearcuts that retain hardwood snags and nest in ones with pine snags (Dickson et al. 1983). Partners in Flight suggests a patch size of 17,400 hectares to support a goal of about 500 breeding pairs. Will nest in artificial nest boxes. See Mitchell (1988) for specifications for the construction and placement of nest boxes.

Management Research Needs: Knowledge of size, species, bark condition, and decay conditions of nest and foraging trees and determination of forest structure that is conducive to snag formation could aid management (Conner et al. 1994). Nest success, effects of predation and the ecological relationships with other organisms are not well known. The demise of the American Chestnut and the widespread loss of Beech forests have deprived it of two historically important food sources. It may be a keystone species in certain ecosystems due to effects on cavity nesting animals and plant species composition (Smith et al., in press); its present reliance on acorns may have substantial importance for the dispersal of oak trees.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Conservation Actions Underway
It occurs in a number of protected areas, but no species-specific actions are known.

Conservation Actions Proposed
Continue to monitor population trends. Monitor rates of habitat loss and degradation. Use fire for its positive effects - prescribed burning and understorey thinning increased numbers in Arkansas by creating more open forest stands, improving foraging opportunities; however, whilst burning may create nest-snags, it also destroys existing nest-snags. Creation or maintenance of snags for nesting and roosting is of prime importance. Snags should be retained, in groups if possible. Dead branches should be retained on big trees in non-urban areas and only selectively pruned where hazardous in urban areas. Selective thinning of live trees appears to have a positive effect (e.g. removal of 50% of oak trees for prairie restoration on a reserve in Ohio immediately attracted nesting birds).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Use of Fire in Population Management

More info for the terms: prescribed fire, short-term effects, snag

Fires during late spring to mid-summer would likely cause the greatest mortality of nestlings and eggs. Timing prescribed fires outside the height of the nesting season would minimize direct mortality.

Red-headed woodpeckers respond favorably to snag recruitment and retention. Using fire to create new snags and maintain an open habitat would provide nesting sites and facilitate foraging opportunities. Additionally, protecting existing nesting and roosting trees by removing fuels from the bases would minimize the immediate and short-term effects on red-headed woodpecker habitat. If existing snags are destroyed by fire or some other event, recruiting new snags through prescribed fire or mechanical means may allow a red-headed woodpecker population to return to the site in the future.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the terms: competition, density, snag, tree

A steep decline in the global population of red-headed woodpeckers has been documented since 1966 [73]. Nationally, the average decline of the red-headed woodpecker was 2.6% annually between 1966 and 2005. From 1980 to 2005 the average decline was 4.2% annually. The declines for both periods are significant (P<0.01) [73]. In the Midwest, red-headed woodpeckers have declined 3.3% per year for a total decline of 63.8% between 1966 and 1993 [40]. Red-headed woodpecker declines in Florida are of high concern [90].

Collisions with automobiles [6,35] and competition for nesting cavities with other species, particularly European starlings and other woodpeckers, may be contributing to population decline [35,46]. In the past, red-headed woodpeckers were shot because they were considered agricultural pests in fruit groves and cornfields [6,35]. Red-headed woodpeckers also do considerable damage to utility poles and were shot as a result [6].

Habitat loss is likely the primary cause of the decline of the red-headed woodpecker population. Predicted responses of habitat changes on red-headed woodpeckers are [83]:

All woody vegetation removed, resulting in pastures or hayfields Woody vegetation reduced to narrow strips along streams Woody canopy partly removed Woody canopy partly removed and shrubs/saplings thinned Shrubs/saplings thinned Snags removed
Extirpated from community Negative Positive Positive Positive Negative

Snag removal from wooded habitats has a drastic effect on the nesting potential of primary and secondary cavity nesters [83]. Red-headed woodpeckers respond negatively to snag removal [14,21,54,94]. Management recommendations for red-headed woodpeckers in Virginia include retaining snags in woodlots and planting young trees over time to encourage replacement when large trees die [14]. Failing to carry out this recruitment cycle may result in the elimination of mature woodlots in Virginia and the disappearance of the red-headed woodpecker in those areas [14]. Illustrating this point, approximately 53.1% of tree cavities utilized by red-headed woodpeckers were no longer usable after 5 years in a cottonwood bottomland forest in Colorado [76].

In loblolly pine habitat in South Carolina, red-headed woodpeckers were most common where no coarse woody debris was removed (6.8 breeding territories/40 ha) [54]. Red-headed woodpeckers were less common in plots where all down coarse woody debris was removed (3.6 breeding territories/40 ha) and least common in plots where all down coarse woody debris and all standing snags were removed (0.7 breeding territories/40 ha). The differences in breeding territory densities between the 3 stands were significant (P=0.023) [54]. The optimal number of snags required by red-headed woodpeckers in longleaf pine-loblolly pine stands in South Carolina is at least 7 snags/100 acres [39]. At least 1 snag/100 acres is required for red-headed woodpeckers to be present at all in longleaf and loblolly pine stands in South Carolina [39].

Red-headed woodpeckers in Texas were found in clearcuts with standing snags, but not in clearcuts without standing snags [21]. A minimum of 5 snags/ha was assumed adequate for nesting in a clearcut, but a higher density of snags may promote more foraging and nesting on a site. A possible management strategy is to leave large numbers of hardwoods standing during harvesting operations and then killing the standing trees over time to provide a continual recruitment of snags for cavity nesters [21].

Snags should be retained whenever possible [94]. Since tree cavities are ephemeral, recruitment of new snags is crucial for red-headed woodpecker populations to persist.
  • 6. Bent, Arthur Cleveland. 1939. Life histories of North American woodpeckers. U.S. Natural History Bulletin No. 174. 334 p. [62579]
  • 14. Conner, Richard N. 1976. Nesting habitat for red-headed woodpeckers in southwestern Virginia. Bird-Banding. 47(1): 40-43. [61966]
  • 21. Dickson, James G.; Conner, Richard N.; Williamson, J. Howard. 1983. Snag retention increases bird use of a clear-cut. Journal of Wildlife Management. 47(3): 799-804. [13855]
  • 35. Graber, Jean W.; Graber, Richard R.; Kirk, Ethelyn L. 1977. Illinois birds: Picidae. Biological Notes No. 102. Urbana, IL: State of Illinois, Department of Registration and Education, Natural History Survey Division. 73 p. [64983]
  • 39. Harlow, Richard F.; Guynn, David C., Jr. 1983. Snag densities in managed stands of the South Carolina coastal plain. Southern Journal of Applied Forestry. 7(4): 224-229. [12571]
  • 40. Herkert, James R. 1995. An analysis of midwestern breeding bird population trends: 1966-1993. The American Midland Naturalist. 134(1): 41-50. [26795]
  • 46. Ingold, Danny J. 1994. Nest-site characteristics of red-bellied and red-headed woodpeckers and northern flickers in East-Central Ohio. Ohio Journal of Science. 94(1): 2-7. [62016]
  • 54. Lohr, Steven M.; Gauthreaux, Sidney A.; Kilgo, John C. 2002. Importance of coarse woody debris to avian communities in loblolly pine forests. Conservation Biology. 16(3): 767-777. [60758]
  • 76. Sedgwick, James A.; Knopf, Fritz L. 1992. Cavity turnover and equilibrium cavity densities in a cottonwood bottomland. Journal of Wildlife Management. 56(3): 477-484. [19280]
  • 83. Stauffer, Dean F.; Best, Louis B. 1980. Habitat selection by birds of riparian communities: evaluation effects of habitat alterations. Journal of Wildlife Management. 44(1): 1-15. [8118]
  • 90. Tucker, James W.; Hill, Geoffrey E.; Holler, Nicholas R. 2003. Longleaf pine restoration: implications for landscape-level effects on bird communities in the lower Gulf Coastal Plain. Southern Journal of Applied Forestry. 27(2): 107-121. [44563]
  • 94. Venables, Ann,; Collopy, Michael W. 1989. Seasonal foraging and habitat requirements of red-headed woodpeckers in north-central Florida. Tallahassee, FL: Florida Game and Fresh Water Fish Commission, Nongame Wildlife Program. 49 p. [61978]
  • 73. Sauer, J. R.; Hines, J. E.; Fallon, J. 2005. Red-headed woodpecker Melanerpes erythrocephalus: North American breeding bird survey trend results. In: The North American breeding bird survey, results and analysis 1966-2005. Version 6.2.2006, [Online]. U.S. Department of the Interior, Geological Survey, Patuxent Wildlife Research Center, Migratory Bird Research (Producer). Available: http://www.mbr-pwrc.usgs.gov/bbs/bbs.html [2007, January 29]. [65354]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Red-headed woodpeckers sometimes feed on cultivated fruits and vegetables. This can cost small farmers.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

This bird is a favorite of birdwatchers and thus provides recreational value to humans.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Red-headed woodpeckers sometimes feed on cultivated fruits and vegetables. This can cost small farmers.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

This bird is a favorite of birdwatchers and thus provides recreational value to humans.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: Widespread over much of eastern North America, southern Canada to Florida, west to Utah. Associated with mature, open woodlots, parks, riverbottoms, cultivated areas with scattered trees and snags. Winter migration to bottomland forest in some areas during years of low mast production. Declining over much of breeding range. North American Breeding Bird Survey (BBS) data indicate the most serious declines in the Ozark-Ouachita Plateau, Ohio Hills, Northern Spruce Hardwoods, Great Lakes Plain, and the Southeast in general. It is the fastest declining cavity-nesting bird in Florida (Smith et al., in press). Main threat is nesting habitat loss due to the reduction in the number of dead trees and snags (Raphael and White 1984), loss of bottomland forest used for wintering (Conner et al. 1994). Management/preserve design need to consider habitats and practices favorable for production of a diverse size of snag/dead limbs, maintenance of open areas and low density ground cover for aerial and ground foraging, and mast production.

Species Impact: Was a major agricultural pest in colonial America (Brewer 1853), but much less so today, due to extensive monocultures. Probably caused more agricultural losses when small fields alternated with woodlands (Skutch 1985). In some areas of the Midwest and South, reported to cause considerable damage to utility poles (Stemmerman 1988), but probably responsible for only minor damage on a large scale (Dennis 1964).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Red-headed woodpecker

Not to be confused with Red-bellied woodpecker.

The red-headed woodpecker (Melanerpes erythrocephalus) is a small or medium-sized woodpecker from temperate North America. Their breeding habitat is open country across southern Canada and the eastern-central United States.

Taxonomy[edit]

The red-headed woodpecker's distinct colors are true to the bird's name.

The red-headed woodpecker was one of the many species originally described by Linnaeus in his 18th-century work Systema Naturae.[2] The specific epithet is derived from the Ancient Greek words erythros 'red' and kephalos 'head'.[3]

There are three subspecies recognized:

  • M. e. brodkorbi
  • M. e. caurinus
  • M. e. erythrocephalus

Description[edit]

Adults are strikingly tri-colored, with a black back and tail and a red head and neck. Their underparts are mainly white. The wings are black with white secondary remiges. Adult males and females are identical in plumage.[4] Juveniles have very similar markings, but have an all grey head.[4] Non-birders may often mistakenly identify red-bellied woodpeckers as red-headeds, whose range overlaps somewhat with that of the red-headed woodpecker. While red-bellied woodpeckers have some bright red on the backs of their necks and heads, red-headed woodpeckers have a much deeper red that covers their entire heads and necks, as well as a dramatically different overall plumage pattern.

These are mid-sized woodpeckers. Both sexes measure from 19 to 25 cm (7.5 to 9.8 in) in length, with a wingspan of 42.5 cm (16.7 in).[5][6] They weigh from 56 to 97 g (2.0 to 3.4 oz) with an average of 76 g (2.7 oz).[7] Each wing measures 12.7–15 cm (5.0–5.9 in), the tail measures 6.6–8.5 cm (2.6–3.3 in), the bill measures 2.1–3 cm (0.83–1.18 in) and the tarsus measures 1.9–2.5 cm (0.75–0.98 in).[8] The maximum longevity in the wild is 9.9 years.[7]

They give a tchur-tchur call or drum on territory.

Behavior[edit]

These birds fly to catch insects in the air or on the ground, forage on trees or gather and store nuts. They are omnivorous, eating insects, seeds, fruits, berries, nuts, and occasionally even the eggs of other birds.[4] About two thirds of their diet is made up of plants.[4] They nest in a cavity in a dead tree, utility pole, or a dead part of a tree that is between 2.45 and 24.5 m (8.0 and 80.4 ft) above the ground.[4] They lay 4 to 7 eggs in early May which are incubated for two weeks.[4] Two broods can be raised in a single nesting season.[4] Northern birds migrate to the southern parts of the range, with most having arrived on the breeding range by late April, and having left for winter quarters by late October;[9][10] southern birds are often permanent residents.

Conservation[edit]

The red-headed woodpecker is a once common but declining bird species found in southern Canada and east-central United States. Consistent long-term population declines have resulted in red-headed woodpecker's threatened status in Canada and several states in the US. This has led to an immediate need for conservation, which, so far, has been the focus of limited studies. Throughout most of its range it inhabits areas that have been heavily altered by humans. Factors suggested for red-headed woodpecker declines include: loss of overall habitat and, within habitats, standing dead wood required for nest sites,[11] limitations of food supply,[12] and possible nest-site competition with other cavity nesters such as European starlings or red-bellied woodpeckers.[13][14] Unfortunately few of these factors have been substantiated.

Of the 600 Canadian Important Bird Areas only seven report the red-headed woodpecker in their area: Cabot Head, Ontario on the Georgian Bay side of the tip of Bruce Peninsula; Carden Plain, Ontario east of Lake Simcoe; Long Point Peninsula and Marshes, Ontario along Lake Erie near London, Ontario; Point Abino, Ontario on Lake Erie near Niagara Falls; Port Franks Forested Dunes, Ontario northeast of Sarnia on Lake Huron; Kinosota/Leifur, Manitoba at the northwest side of Lake Manitoba south of The Narrows and east of Riding Mountain National Park; and along South Saskatchewan River from Empress, Alberta to Lancer Ferry in Saskatchewan.[15]

Popular culture[edit]

In the 1940s, Universal Studios popularized a television cartoon series about a red-headed woodpecker named "Woody Woodpecker," created by Walter Lantz. It remained in production until 1972 and continued thereafter in re-runs, and in a late-1990s revival for the Fox network.

In 1996, the United States Postal Service issued a 2-cent postage stamp depicting a perched red-headed woodpecker.[16] The stamp was discontinued at some time thereafter, but re-issued in 1999 and remained available for purchase until 2006.[17]

References[edit]

  1. ^ BirdLife International (2012). "Melanerpes erythrocephalus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ (Latin) Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). 
  3. ^ Liddell, Henry George and Robert Scott (1980). A Greek-English Lexicon (Abridged Edition). United Kingdom: Oxford University Press. ISBN 0-19-910207-4. 
  4. ^ a b c d e f g Porter, Eloise F.; James F. Parnell; Robert P. Teulings; Ricky Davis (2006). Birds of the Carolinas Second Edition. Chapel Hill, NC: University of North Carolina Press. p. 220. ISBN 978-0-8078-5671-0. 
  5. ^ Red-headed Woodpecker. All About Birds.
  6. ^ Red-headed woodpecker. biokids.umich.edu
  7. ^ a b Wasser, D. E.; Sherman, P. W. (2010). "Avian longevities and their interpretation under evolutionary theories of senescence". Journal of Zoology 280 (2): 103. doi:10.1111/j.1469-7998.2009.00671.x.  edit
  8. ^ Winkler, Hans; Christie, David A. and Nurney, David (1995) Woodpeckers: An Identification Guide to the Woodpeckers of the World, Houghton Mifflin, ISBN 978-0-395-72043-1
  9. ^ Henninger, W.F. (1906). "A preliminary list of the birds of Seneca County, Ohio". Wilson Bulletin 18 (2): 47–60. 
  10. ^ Ohio Ornithological Society (2004): Annotated Ohio state checklist.
  11. ^ Smith, K. G., J. H. Withgott, and P. G. Rodewald. (2000). Red-headed Woodpecker (Melanerpes erythrocephalus). The Birds of North America Online (A. Poole, Ed.). Cornell Lab of Ornithology; Retrieved from the Birds of North America Online, Ithaca.
  12. ^ Ontario Partners in Flight. (2008). Ontario Landbird Conservation Plan: Lower Great Lakes/St. Lawrence Plain, North American Bird Conservation Region 13. Ontario Ministry of Natural Resources, Bird Studies Canada, Environmental Canada. Draft Version 2.0.
  13. ^ Ingold, D. J. (1989). "Nesting phenology and competition for nest sites among Red-headed and Red-bellied Woodpeckers and European Starlings". Auk 106: 209–217. 
  14. ^ Ingold, D. J. (1994). "Influence of nest-site competition between European Starlings and woodpeckers". Wilson's Bulletin 106: 227–241. 
  15. ^ Important Bird Area Canada, Site Catalogue Query
  16. ^ America's 1996 Stamps Program (1996): Red-headed Woodpecker. Retrieved 2006-JAN-31.
  17. ^ USA Philatelic (2006). "Red-headed Woodpecker". USA Philatelic 11 (1): 31. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Common Names

red-headed woodpecker

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!