Overview

Brief Summary

The Pileated Woodpecker (Dryocopus pileatus) is the largest woodpecker in North America (excluding the, sadly, almost surely extinct Ivory-billed Woodpecker). Pileated Woodpeckers feed mainly on ants and other insects, excavating deep into rotten wood with their powerful bills, but also eat a significant amount of fruit and nuts. Carpenter ants may account for up to 60% of the diet and wild fruits, berries, and nuts may account for a quarter of the diet. Pileated Woodpeckers leave characteristic rectangular or oval holes in dead trees.

Pileated Woodpeckers are resident from much of Canada south along the western coast of North America to central California (and in Idaho, Montana, and Wyoming) and across most of the eastern United States, especially in the Southeast. They are found mainly in mature deciduous and mixed deciduous-coniferous forests, woodlots, and swamps, but also in coniferous forest. Pileated Woodpeckers became rare in eastern North America with the clearing of forests after European colonization of the continent. However, populations increased during much of the 20th century and these woodpeckers can even be seen around the edges of cities in parks and suburbs.

Pileated Woodpeckers defend their territories with loud drumming and calling. Courtship displays include spreading the wings (displaying white wing patches), erecting the crest, swinging the head back and forth, and performing a gliding display flight. At a prospective nest site, both sexes may tap or drum on wood. The nest site is a cavity in a dead tree (or dead branch of a live tree), sometimes in a utility pole, usually 15 to 80 feet above the ground. A new cavity is generally excavated each year, with both sexes excavating. The 3 to 5 white eggs are incubated by both sexes for around 18 days (with the male incubating at night and during part of the day). The young are fed (by regurgitation) by both parents. They leave the nest after 26 to 28 days, but may remain with the parents for 2 to 3 months.

Although Pileated Woodpeckers are generally permanent year-round residents, some individuals may wander far from breeding areas.

(Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Dunn, J.L. and J. Alderfer. 2011. National Geographic Field Guide to the Birds of North America. National Geographic Society, Washington, D.C.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Resident through forested North America from Nova Scotia, New Brunswick, s. Quebec, and central Ontario south to s. Florida, and west to forested river bottoms extending into the Great Plains in e. Texas and se. Oklahoma. The winter range is also the same. A permanent resident of deciduous or coniferous forests in southern Canada and in the western, midwestern, and eastern United States.

Biogeographic Regions: atlantic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) RESIDENT: from southern and eastern British Columbia and southwestern Mackenzie across southern Canada to Quebec and Nova Scotia, south in Pacific states to central California, in the Rocky Mountains to Idaho and western Montana, in the central and eastern U.S. to the eastern Dakotas, Gulf Coast, and southern Florida, and west in the eastern U.S. to Iowa, Kansas, Oklahoma, and Texas (AOU 1983). Absent from or very limited in much of northern Illinois, Indiana, and Ohio. In the Great Plains, found primarily along the eastern edge in bottomland forests along major streams. In recent years, however, there have been increasing numbers of records farther west than illustrated in Bull and Jackson (1995). In Oklahoma these include records west to Major, Caddo, Woodward, and Comanche counties, Oklahoma (Ely 1990, Baumgartner and Baumgartner 1992, McGee and Neeld 1972, Powders 1986). Also reported from Nebraska (Rapp 1953), a return after disappearance at the end of the last century. Maps in Winkler et al. (1995) show the species much farther north in western Canada than known. See also range map for Canada in Godfrey (1986). There are many extralimital records. In the east, occurs from sea level to 1500+ m in the Appalachians; in California to about 2300 m (Short 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The Pileated Woodpecker is the largest woodpecker found in most of North America. Only the possibly extirpated Ivory-billed Woodpecker (Campephilus principalis) in the southeastern United States and Cuba and the Imperial Woodpecker (Campephilus imperialis) of western Mexico are larger. Dryocopus pileatus is best recognized by its large, dull black body and red crest. Because of its size and chisel-shaped bill, this woodpecker is particularly adept at excavating, and it uses this ability to construct nests and roost cavities and to find food.

Average mass: 364 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 42 cm

Weight: 308 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Except for the probably extinct ivory-billed woodpecker (Campephilus principalis) of the southeastern United States and imperial woodpecker (C. IMPERIALIS) of montane western Mexico, the pileated is the largest woodpecker in North America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Coniferous or deciduous forest. Prefers to nest in mesic areas, close to streams; selects stands with greatest basal area, greatest density of stems, and highest crown canopy. Typically roost in hollow trees with multiple entrances.

Terrestrial Biomes: forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Dense deciduous (favored in southeast), coniferous (favored in north, northwest and west), or mixed forest, open woodland, second growth, and (locally) parks and wooded residential areas of towns. Prefers woods with a tall closed canopy and a high basal area. Most often in areas of extensive forest or minimal isolation from extensive forest. Uses a minimum of 4 cavities per year (only one for raising brood).

In Missouri, abundance increased with area covered with bottomland forest, density of trees at least 30 cm dbh, and density of snags at least 54 cm dbh (Renken and Wiggers 1993). In West Virginia found in all forest types, at all elevations, but less common in spruce-northern hardwoods forest and most common in mixed hardwood forest (Hall 1983).

Nests are in cavities excavated by both sexes usually in dead stubs in shaded places; cavity entrance averages about 14 m above ground (see photos and descriptions in Harrison 1975, 1979). Usually digs a new hole for each year's brood, but the same cavity may be used for several years. Nest tree species and size varies among regions and even within regions depending on site and availability. In southern British Columbia, preferred nest sites were in live aspen with heartwood decay, in trees larger than 40 cm dbh (Harestad and Keisker 1989). In northwest Montana, most of 54 nest trees were large western larch (Larix occidentalis) and nest trees averaged 74.9 cm dbh (McClelland 1979). In northeast Oregon, 75% of nest trees were ponderosa pine (Pinus ponderosa) and mean dbh of nest trees was 84 cm (Bull 1987). In western Oregon, 73% of nest trees were Douglas-fir (Pseudotsuga menziesii) and nest trees averaged 69 cm dbh (Mellen 1987). In Virginia, 28% of nest trees were hickory (Carya spp.), 22% red oak (Quercus rubra), 17% chestnut oak (Q. PRINUS) and nest trees averaged 54.6 cm dbh (Conner et al. 1975). Most studies report nests 5-17 m above ground in wood softened by fungal rot, in trees usually 100-180 years old, over 51 cm DBH, 12-21 m tall, and often near permanent water (Bushman and Therres 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Although generally considered to be a resident species, there is evidence of some migratory movement in the northern part of its range. Hall (1983) reported a small southward movement of pileated woodpeckers in fall along the Allegheny Front of West Virginia. Sutton (1930) also noted gradual southward movement in fall through New York state. In British Columbia, the paucity of winter records in the northern half of the province indicates that many breeding individuals there move considerable distances to the south (Campbell et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

This woodpecker feeds on insects, primarily carpenter ants and woodboring beetle larvae; also wild fruits and nuts. It pries off long slivers of wood to expose ant galleries. The Pileated Woodpecker uses its long, extensible, pointed tongue with barbs and sticky saliva to catch and extract ants from tunnels.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds extensively on carpenter ants (Camponotus spp.) and beetle larvae obtained by chiseling into standing trees, stumps, and logs; also digs into anthills on ground and eats other insects, fruits, and seeds (Hoyt 1957). In Wisconsin, Nicholls (1994) found the cerambycid wood borer, Trigonarthris, to be the major prey of pileated woodpeckers feeding at dead American elms (Ulmus americana). The preference of the birds for feeding at larger trees seemed related to the requirement of the beetles for larger trees as their habitat. There tends to be seasonal variation in the diet and foraging strategy to take advantage of available foods. More fruit and seeds are taken in late summer and fall (Conner 1979, Hoyt 1948, Sprunt and Chamberlain 1970); more excavation for arthropods is done in winter (Conner 1979, Hoyt 1948, Pfitzenmeyer 1956, Tanner 1942). Quantitative studies of diet include stomach content and scat analysis. In a range-wide, year-round study, Beal (1911) found 80 stomachs to include 22% beetles (Cerambycidae, Buprestidae, Elateridae, Lucanidae, Scarabaeidae, Carabidae), 40% ants (Camponotus sp., Crematogaster sp.), 11% other insects, and 27% vegetable (numerous fruits, see Bull and Jackson 1995). Analyses of 330 scats in Oregon revealed 68% carpenter ants, 29% thatching ants (FORMICA), 0.4% beetles, and 2% other. The species is opportunistic, known to take advantage of insect outbreaks (e.g., western spruce budworm (Choristoneura occidentalis) Bull and Jackson 1995), the progression of fruiting trees in an area (Stoddard 1978), and to visit suet feeders in many areas of eastern North America (Connecticut, Hardy 1958; Mississippi, Jackson, pers. obs.; Tennessee, Spofford 1947; Georgia, Stoddard 1978; Minnesota, Tusler 1958 ).

Logs and stumps are important foraging substrates in many areas (e.g., Mannan 1984, Renken and Wiggers 1989, Schardien and Jackson 1978), but Aubry and Raley (1992) rarely observed foraging on logs in closed canopy forests of western Washington. Mannan (1984) found the pileated to forage on dead wood substrates 96% of the time.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Many occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Geographic variation in abundance is linked to availability and quality of habitat. Comparative data are few, but Price et al. (in press, and in Bull and Jackson 1995) show areas of greatest numbers on U.S. Fish and Wildlife Service Breeding Bird Surveys to be in the southeastern United States.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In Missouri, population density varied from 0.5 to 4.1 territories per 100 ha, with the highest densities of birds positively correlated with increasing area of old growth bottom land forest, increasing canopy closure, and increasing density of snags greater than 0.54 cm dbh (Renken and Wiggers 1993). In western Oregon, mature forests support higher populations than do younger forests (Mannan et al. 1980).

In Missouri, territory sizes ranged from 53-160 ha, and territory size decreased with increasing percent forest overstory canopy cover, increasing saw timber cover, and log and stump volume (Renken and Wiggers 1989). In conifer forests of northeastern Oregon, home range was 128-240 ha (Bull and Meslow 1977). Home range in New York varied in radius from 4.8 to 6.4 km in a mixed conifer-hardwood forest (Hoyt 1957) [Note: these data do not appear in the cited Hoyt 1957].

Parasites have rarely been reported, but include the following. Humpbacked flies (Phoridae), were found on nestlings in New York (Hoyt 1957). TOUCANECTES DRYOCOPI, a subcutaneous mite, was found in the head and neck region of Louisiana birds (Pence 1971). In Oregon nests, Wilson and Bull (1977) found DERMANYSSUS GALLINOIDES, a mite (Mesostigmata: Laelaptoidea) and Carnus hemapterus, and a fly (Diptera: Milichiidae). Collins et al. (1966) identified two blood parasites, Plasmodium sp. and Haemoproteus sp. from a South Carolina bird. Nickol (1969) examined three Louisiana pileateds for Acanthocephala, but found none.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
155 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Dryocopus pileatus is oviparous, its incubation period is approximately 12-14 days. Both parents incubate eggs alternately during the day; the male incubates at night. The eggs are attended 99% of the time. Kilham (1979) reported that eggs were unattended for up to 20 minutes in the first few days; attended nearly 100% of the time after that. A clutch size of 4 is most common in this woodpecker.

Average time to hatching: 18 days.

Average eggs per season: 4.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pairs share a territory year round (Bull and Jackson 1995). On warm days of February and early March in the southeastern U.S. and March through early April in northern areas there is an increase in vocalizations and drumming associated with pair formation and increased territoriality. Vocalizations and drumming take place with greatest frequency in early morning and late afternoon (Hoyt 1941). Courtship behavior is described in detail by Kilham (1979, 1983), with additional details and circumstances by Arthur (1934), Hoyt (1944), and Oberman (1989). Nest construction, egg-laying, hatching, and fledging are also progressively later from south to north (Bull and Jackson 1995) and likely from lower to higher altitudes (at least in California, Harris 1982).

Early egg dates in the southern U.S. are in early March; late egg dates, from northern areas, are in mid-June. Similarly, nestlings have been found from mid-May in the southeast to mid-July in the north (Bull and Jackson 1995, Peterjohn 1989). Young remain with adults at least through late summer or early fall. Clutch size is usually 3-4 throughout the range (Bent 1939, Christy 1939); a clutch of 6 was reported by Audubon and Chevalier (1842). Incubation takes 15-19 days (Bendire 1895, Hoyt 1944, Kilham 1979), by both sexes. Young are tended by both parents, leave nest at 22-26 days (Hoyt 1944, Bull and Jackson 1995).

Longevity records thus far include several birds surviving for 9 years (Bull and Jackson 1995, Bull and Meslow 1988, Hoyt and Hoyt 1951, Hoyt 1952). However, through 1981, there had only been 15 recoveries from a total of 670 banded (Clapp et al. 1983), thus it is quite possible that this species could live much longer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dryocopus pileatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGATTATTCTCCACCAACCACAAGGACATTGGCACTCTGTATCTTATCTTCGGCGCATGAGCCGGCATAATCGGCACAGCCCTCAGCCTCCTTATNCGCGCTGAACTAGGCCAACCTGGCACCCTCCTCGGCGAC---GATCAAATCTACAACGTCATCGTTACCGCCCATGCATTCGTAATAATCTTCTTCATAGTCATACCCATCATGATTGGCGGGTTTGGAAACTNACTCGTCCCACTCATAATCGGAGCTCCCNACATAGCATTCCCACGAATGAACAACATAAGCTTNTGACTCCTCCCACCATNATTCCTGCTCCTTNTAGCNTCCTCCACAGTAGAGGCAGGGGCAGGAACAGGCTGAACTGTCTACCCGCCCCTCGCTGGCAACTTAGCCCATGCAGGAGCCTCAGTAGACCTGGCCATCTTCTCACTCCACCTAGCGGGTATCTCATCCATCCACGGGGCAATCAACTTTATTACCACGGCCATTAACATAAAACCCCCAGCCATCTCACAATACCAAACCCCTCTATTTGTCTGATCCGTCCTCATCACCGCTGTTCTCCTCCTCCTATCCCTCCCAGTCCTCGCCGCTGGCATCACGATACTCCTCACAGACCGCAATCTAAACACCACATTCTTTGACCCTGCCGGAGGGGGCGACCCAATCCTCTACCAACATCTCTTCTGATTTTTTGGCCACCCCGAAGTTTACATCCTCATCCTTCCAGGATTTGGCATGATCTCCCACGTAGTAGCCTACTACGCTGGCAAAAAAGNNNNTTTCGGCTACATGGGAATAGTATGAGCCATACTATCTATTGGATTCCTCGGCTTTATCGTATGAGCTCACCACATGTTCACCGTAGGGATAGACGTAGACACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dryocopus pileatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pileated woodpeckers have a large range and large population size, so they are not considered threatened or endangered. They are protected by the U.S. Migratory Bird Act.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widely distributed in wooded areas of North America; population has been stable or increasing in recent decades.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to increase of 25%

Comments: North American Breeding Bird Survey (BBS) data indicate a significant increase of 33% in North America between 1966 and 1993, and a nonsignificant increase of 5.3% between 1984 and 1993 (Price et al. 1995). As evidenced from the historical literature, populations have fluctuated greatly over the years. They declined with clearing of the forests in the late 1800s, but increased again as forest reclaimed abandoned farms (Becker 1942, Bull and Jackson 1995, Pearsall 1976, Peterjohn 1989). Declines may have been greater in the northeastern U.S. than in the southeastern U.S. (Hoyt 1941). In Ohio, had vanished from most areas except the Allegheny Plateau and the extreme northeast, and Jones (1903) considered the species in danger of extinction. Jacobs (1933) recalled the pileated as a common woodland bird in southwestern Pennsylvania in the 1880s, but near extinction in the early 1930s. Since the late 1920s and early 1930s, when many farms were abandoned, has increased in numbers and in area occupied. Widespread death of large American elms as a result of Dutch elm disease since 1930 has resulted in increases in arthropod foods and potential nesting/roosting sites (Nicholls 1994), leading to growth and expansion of populations. Hoyt (1963) analyzed Christmas Bird Count (CBC) data for five New England states from 1920 to 1959 and demonstrated a dramatic increase through the years. Robbins (1991) examined CBC data for Wisconsin and found a similar trend in increasing numbers from 1962 to 1986. Most authors reported noticeable increases beginning in the 1960s and continuing into the 1990s.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Major threats are (from greatest to least): (1) conversion of forest habitats to non-forest habitats, (2) short rotation, even-age forestry, (3) monoculture forestry, (4) forest fragmentation, (5) removal of logging residue, downed wood, and pine straw that would ultimately put nutrients back into the ecosystem and provide foraging substrate, (6) lightning striking cavity/roost trees because they are the oldest, tallest trees around as a result of cutting priorities, (7) deliberate killing by humans, and (8) toxic chemicals. The first four threats are ones that have been a major concern for some time. As an example of habitat losses, nonfederal forested wetlands decreased by 5 million acres in the continental U.S. between 1982 and 1987 (Cubbage and Flather 1992). Forest fragmentation has been recognized as a major problem for many wildlife species (e.g., Wilcove 1990), but it results in habitat changes within as well as between fragments. In the southeast, smaller fragments tend to become drier (hence less conducive to conditions favorable to the pileated) and also change in plant species composition and tend towards younger successional stages (Rudis 1992). Removal of logging residue, downed wood, and pine straw from forested areas is becoming increasingly common. Considerable research directed at finding ways to maximize economic returns from the forest through such actions is being conducted by the U.S. Forest Service and others (e.g., Howard and Setzer 1989) and pine straw is currently sold on some southern forests. Removing these materials not only removes the nutrients they contain and foraging substrates for pileated woodpeckers and others, but also changes the water balance of the forest floor, making the forest a drier environment less suitable for the arthropod fauna the woodpecker is dependent on. Shooting by humans was a serious problem in the past (e.g., Sclater 1912, Stoddard 1947) and continues in some areas (Jackson, pers.obs.). The birds are an impressive and easy target and in some quarters are considered to harm trees. Becker (1942) offered one of the most detailed accounts of the disappearance of the species. Toxic chemicals can affect woodpeckers in two ways: (1) by direct poisoning and (2) by killing their arthropod prey. Careless use of agricultural chemicals and widespread control programs such as have been conducted in the past against the imported fire ant can have both affects. In addition, when woodpeckers nest in chemically treated utility poles, embryos or chicks can be killed by the fumes (Rumsey 1970). In the eastern U.S., rat snakes (Elaphe obsoleta) have been reported as nestling predators (Gress and Wiens 1983, Kilham 1959, Moore 1984). Both sharp-shinned (Accipiter striatus; Smith 1983) and Cooper's (A. COOPERI; Michael 1921) hawks are known as potential predators on pileated woodpeckers. Erdman (pers. comm.) has found remains of adults and juveniles at goshawk (A. GENTILIS) nests in Wisconsin. The sharp-shinned hawk is certainly more of a threat to fledglings than to adults. Todd (1944) reported predation by a gray fox (Urocyon cinereoargenteus) on a ground-feeding pileated in Tennessee. Because they feed extensively on the ground, woodpeckers are vulnerable to being killed by vehicles as they approach or leave feeding sites (e.g., Eifrig 1944), an argument for keeping downed wood away from highway rights-of-ways.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: So long as appropriate areas of old growth forest are maintained, the potential for restoration of woodpecker populations is high. Introduction of birds to areas where they have been extirpated, such as Prince Edward Island (Godfrey 1986), may be possible using techniques developed by DeFazio et al. (1987) for red-cockaded woodpeckers. Captive breeding is a possibility, but has not been accomplished, nor is it an acceptable alternative to habitat maintenance. Several woodpeckers have been maintained in captivity, some for several years (Hoyt 1950, Rumsey 1968), thus at least the knowledge is available for short-term maintenance of birds that might be used in translocation efforts.

Preserve Selection and Design Considerations: Preserves should be designed differently for different geographic regions and habitat types. For example, in the eastern and southeastern U.S., every opportunity should be taken to link preserves to corridors of forest habitat along major rivers and streams. In montane areas of the west, preserves would be best along rivers and streams, but also on the windward rather than on the leeward sides of mountains because of the higher humidity (hence greater decay, hence greater food and nest site potential) associated with windward sites.

In various areas, reported as requiring forest patch sizes of at least 20-70 ha, unless other forested areas are nearby (Bushman and Therres 1988). Dispersal distances need to be known and considered when planning any preserve or management area, and data from birds in similar habitats within the region should be used for planning purposes. Dispersal data are scant at present, based on recoveries of banded birds in New York (32 km from site of banding) and Alberta (16 km), and from detailed studies of banded and radio-equipped birds in Oregon in which birds nested from 0.7 to 8.7 km from their natal site (Bull and Jackson 1995).

No estimates have been made of minimum viable population size for this species, nor for that matter have populations been carefully defined.

Management Requirements: Short and Horne (1990) listed five factors upon which conservation of European woodpeckers depends. These are a minimum starting point for the conservation of the pileated. The factors are: 1. Maintenance of wooded areas in which dead and dying trees are allowed to remain. 2. Retention of dead or dying stubs of some live trees. 3. Retention of dying trees in open areas of parkland, golf courses and woodland. 4. Management of wet forests to allow decay of rotting trees (it should be remembered that dying trees are part of the ecosystem, and their integration into new growth as humus is important to natural forest regeneration). 5. Selective cutting rather than clear-cutting of managed forests.

Optimal forest management practices for the mid-Atlantic states include those that maintain a density of around 24 snags per 40 ha; suitable nest sites can be provided by leaving uncut filter strips along streams or by maintaining dense stands where long-continued competition weakens sawtimber trees (Bushman and Therres 1988). Removal of thinning slash or logging debris (foraging substrates) reduces habitat quality (Renken and Wiggers 1989).

The woodpecker was selected as a management indicator of old growth forest ecosystems for some U.S. Forest Service regions. On Pacific Northwest forests, an emphasis has been placed on leaving > 5 standing dead trees (snags) per ha as potential nest and roost sites and on leaving 120 ha patches of older forests (Brown 1985, Bull and Jackson 1995, Thomas et al. 1979). Most of 100 woodpecker management areas were occupied by the species on five National Forest ranger districts in Oregon and Washington (Bull and Jackson 1995).

Mellen et al. (1992) questioned the adequacy of Forest Service management guidelines because home range data were based on density estimates. Based on home range and habitat use data from the Pacific Northwest, Bull and Holthausen (1993) recommended increasing the size of management areas (to 364 ha) and the number of management areas per forest. Composition of management areas should be about 75% in grand fir (Abies grandis) type, 25% old growth, the remainder mature stands; at least 50% of the stands should have > 60% canopy cover, at least 40% should remain unlogged, and the remainder should be selectively logged to leave mature stands after logging. Because of the importance of downed logs as foraging sites, Bull and Holthausen also recommended leaving > 100 logs (preferably > 38 cm diameter) per ha. To provide for nest and roost sites and foraging, they also recommended leaving > 8 snags per ha with a preference for snags > 51 cm dbh.

See Mitchell (1988) for specifications for the construction and placement of nest boxes.

Management Research Needs: 1. Greater knowledge is needed regarding the relationship between arthropod habitat requirements and those of the woodpecker. Although studies have identified habitat parameters needed by the woodpecker, the nature and significance of phenological variation in key habitat components has not been adequately addressed. For example, what factors influence the longevity of a snag that is a potential cavity or food tree? What is the nature of the progression of decay and invasion by prey of the woodpecker?

2. How is nesting success and fledgling weight/health related to habitat quality? How do nestling development features and phenology found by Hoyt (1944) compare across the range of the species and the range of habitats in which the bird is found?

3. How many feeding trips per day are made to nestlings of various ages? How far do parents travel in habitats of different types to find food for nestlings?

4. To what extent could nest trees be created by killing large trees and then topping them to leave a cross section exposed at the top to encourage fungal decay? [This has been done experimentally in Oregon with explosives (Bull et al. 1981).]

5. Could artificial roost/nest cavities be created following the approach taken for red-cockaded woodpeckers (Copeyon 1990, Allen 1991)?

6. At what age do fledglings become independent of parents? How does this vary geographically, seasonally, or with habitat quality? Does survival and success of young vary with age at independence?

7. What factors influence successful dispersal of young? How far will they normally disperse?

8. Can fledglings be successfully introduced to isolated areas with small or no populations using techniques such as those employed for the red-cockaded woodpecker (DeFazio et al. 1987)?

9. How genetically variable is the species? To what extent is forest fragmentation contributing to genetic fixation within populations?

10. Numerous studies and anecdotal materials indicate that the diet emphasizes Camponotus ants and beetle larvae, with the seasonal addition of fruit and a wide array of foods when opportunity appears. However, even the most detailed of these studies do not allow good comparisons to be made and do not allow examination of diets of males versus females, adults versus juveniles, or the potential for significant geographic variation. Nor have studies of diet been linked to habitat quality. Further work is needed to clarify dietary needs and variation and relationships of diet quality to habitat quality and home range.

11. Why do pileateds enlarge the cavities of red-cockaded woodpeckers? Answers to date have been speculative and offer little in the way of behavioral observations.

Biological Research Needs: 1. While the incubation period of the species is given as 18 days by several authors (Bendire 1895, Burns 1915, Hoyt 1944, Harris 1982), these authors seem to be quoting one another with little hard data. Kilham (1979) gives the incubation period as 15-16 days. Since the incubation period of the closely related black woodpecker (Dryocopus martius) is given as 12-14 days (Cramp 1985), further study with better documentation seems to be needed.

2. Why do pileated woodpeckers excavate on utility poles and houses, and how can these actions be deterred?

3. Several species of woodpeckers have been shown to have sex-specific foraging niches. Is this true for pileateds?

4. What is the key species role of the pileated? What other species are dependent on it for nest/roost cavities or for food resources. The excavations of pileated woodpeckers are often used as foraging sites by other species (Jackson, pers. obs.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Probably there are many protected occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Dryocopus pileatus hollows out nests 8 inches wide and 2 feet deep. Homeowners and utility companies are often concerned about damage to homes and trees. However, there are many products now on the market to prevent or repair this damage. Also, providing nesting boxes or other nesting habitat for the birds may be a successful strategy (Texas Partners in Flight, 2000). It is illegal to harm or remove the birds without a permit.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

As a large, non-migratory insectivore, the pileated woodpecker may provide an important role in controlling insect outbreaks, particularly those of tree beetles. Also, this woodpecker may be a keystone species because its nest excavations provide habitat for many other species (Aubrey and Raley, 2002).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Serious negative economic impact can result from woodpecker excavations in utility poles (Pfitzenmeyer 1956, Dennis 1964, Rumsey 1970). This problem seems to be most serious where the utility poles are near water and where mature forest and large snags are limited. Occasionally the pileated woodpecker damages wood-sided homes in forested settings. Pennant (1785) noted that it fed on ripe corn.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Stewardship Overview: The primary management concern is the provision of required forest habitats (Bull and Jackson 1995). These include both deciduous and coniferous forests, the most important characteristics of the forests being that they are extensive, include mature trees and snags, a more or less open forest floor littered with decaying wood, and a relatively humid environment that promotes fungal decay and the ant, termite, and beetle populations on which these birds feed. Streamside forests are particularly important because of the more humid environment they create and the linear and dendritic corridors they provide for dispersal of the birds into new areas. Successful management in an area will require maintenance of old growth forest with dense canopy cover, especially broad corridors along streams and lakes.

Species Impact: Pileateds are a serious problem in some cavity clusters of the endangered red-cockaded woodpecker (Picoides borealis) in the southeastern United States (Jackson 1978, 1994). The pileated enlarges red-cockaded woodpecker cavities, making them unsuitable for use by the endangered species. Apparently this action is usually in search of food, rather than appropriation of the cavity as a nest or roost site, although a pileated occasionally uses an enlarged cavity for roosting. Also thought to have harassed or competed with ivory-billed woodpeckers (Short and Horne 1990, Tanner 1942).

From an ecosystem management perspective, woodpeckers could have a negative impact on other species in that it may not be a good indicator of old growth forest (as it is being used) because it will forage in younger forests (Mellen et al. 1992). On the positive side, old pileated cavities and enlarged red-cockaded woodpecker cavities provide nesting sites for squirrels (Sciurus spp.), wood ducks (Aix sponsa), eastern screech owls (Otus asio), and many other vertebrate and invertebrate species. Many of the prey of the pileated are insects of negative economic importance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pileated Woodpecker

The Pileated Woodpecker (Dryocopus pileatus, formerly Picus pileatus) is a very large North American woodpecker, roughly crow-sized, inhabiting deciduous forests in eastern North America, the Great Lakes, the boreal forests of Canada, and parts of the Pacific coast. It is also the largest woodpecker in the United States, except the possibly extinct Ivory-billed Woodpecker.

Description[edit]

Plate 111 of the Birds of America by John James Audubon, depicting the Pileated Woodpecker

Adults are 40 to 49 cm (16 to 19 in) long, span 66 to 75 cm (26 to 30 in) across the wings and weigh 250 to 400 g (8.8 to 14.1 oz), with an average weight of 300 g (11 oz). Each wing measures 21.4 to 25.3 cm (8.4 to 10.0 in), the tail measures 14 to 17.4 cm (5.5 to 6.9 in), the bill is 4.1–6 cm (1.6–2.4 in) and the tarsus measures 3.1–3.8 cm (1.2–1.5 in).[2][3] They are mainly black with a red crest, and have a white line down the sides of the throat. They show white on the wings in flight. The flight of these birds is strong and direct but has an undulating quality, similar to the relatively unique flight-style of all woodpeckers. Adult males have a red line from the bill to the throat, in adult females these are black.[4] Two species found in the Old World, the White-bellied and Black Woodpeckers are closely related and occupy the same ecological niche in their respective ranges that the Pileated occupies in North America.[2] The only North American birds of similar plumage and size are the Ivory-billed Woodpecker of the Southeastern United States and Cuba, and the related Imperial Woodpecker of Mexico. However, unlike the Pileated, both of those species are extremely rare, if not extinct. Most reports of the Ivory-billed Woodpecker are believed to be erroneous reports of the far more common Pileated.

The call is a loud, far-carrying laugh, sometimes described as a "jungle bird" call due its wild, un-fettered quality. The Northern Flicker, which is very different looking and weighs about half as much as a Pileated, has a similar-sounding call but has a weaker voice. Its drumming can be very loud, often sounding like someone striking a tree with a hammer.

Subspecies[edit]

Up to four subspecies of Pileated Woodpeckers have been recognized historically. However, many authors only recognize two subspecies, the southernly D. p. pileatus and the northerly D. p. abieticola, and the differences between the other two subspecies other than range are not well described. Generally, Pileated Woodpeckers follow Bergmann's rule being smaller and more compact in the south (pileatus) and larger in the North (abieticola). The ranges of the potential four subspecies are described below.[2][5]

  • Southern Pileated Woodpecker (D. p. pileatus) – the southeastern U.S., except Florida.
  • Northern Pileated Woodpecker (D. p. abieticola) – Distributed from the Canadian Prairies provinces east through Eastern Canada and the northern United States.
  • Florida Pileated Woodpecker (D. p. floridanus) –the Florida peninsula and Florida Keys.
  • Western Pileated Woodpecker (D. p. picinus) – western North America.

Distribution and habitat[edit]

Their breeding habitat is forested areas across Canada, the eastern United States and parts of the Pacific coast. This bird favors mature forests and heavily wooded parks. They specifically prefer mesic habitats with large, mature hardwood trees, often being found in large tracts of forest. However, they also inhabit smaller woodlots as long as they have a scattering of tall trees.

Behavior[edit]

Male excavating a nest hole

These birds mainly eat insects, especially carpenter ants and wood-boring beetle larvae. They also eat fruits, nuts, and berries, including poison ivy berries.[6] Pileated Woodpeckers will often chip out large and roughly rectangular holes in trees while searching out insects, especially ant galleries.[4] They also will lap up ants by reaching with their long tongue into crevices. They are self-assured on the vertical surfaces of large trees but can seem awkward while feeding on small branches and vines. Pileated woodpeckers may also forage on or near the ground, especially around fallen, dead trees, which can contain a smorgasbord of insect life. They may forage around the sides of human homes or even cars and can occasionally be attracted to suet-type feeders. Although they are less likely feeder visitors than smaller woodpeckers, Pileateds may regularly be attracted to them in areas experiencing harsh winter conditions.

Usually, Pileated Woodpeckers excavate their large nests in the cavities of dead trees. Woodpeckers make such large holes in dead trees that the holes can cause a small tree to break in half. The roost of a Pileated Woodpecker usually has multiple entrance holes. Pileated Woodpeckers raise their young every year in a hole in a tree. In April, the hole made by the male attracts a female for mating and raising their young. Once the brood is raised, the Pileated Woodpeckers abandon the hole and will not use it the next year. When abandoned, these holes—made similarly by all woodpeckers—provide good homes in future years for many forest song birds and a wide variety of other animals. Owls and tree-nesting ducks may largely rely on holes made by Pileateds in which to lay their nests. Even mammals such as raccoons may use them. Other woodpeckers and smaller birds such as wrens may be attracted to Pileated holes to feed on the insects found in them. Ecologically, the entire woodpecker family is important to the well being of many other bird species. The Pileated Woodpecker will also nest in nest boxes about 4.6 m (15 ft) off the ground.

A Pileated Woodpecker pair stays together on its territory all year round and is a non-migratory species. It will defend the territory in all seasons, but will tolerate floaters during the winter.[7] When clashing with conspecifics, they engage in much chasing, calling, striking with the wings, and jabbing with the bill. Drumming is most commonly to proclaim a territory and hollow trees are often used to make the largest sound possible.

Pileated Woodpeckers have been observed to move to another site if any eggs have fallen out of the nest—a rare habit in birds. The cavity is unlined except for wood chips. Both parents incubate three to five eggs for 12 to 16 days. There is an average of clutch size of 4 per nest. The young may take a month to fledge.[8] The oldest known Pileated woodpecker was 12 years and 11 months old. Predators at the nest can include american martens, weasels, squirrels, rat snakes and gray foxes. Free-flying adults have fewer predators but can be taken in some numbers by Cooper's Hawks, Northern Goshawks, Red-tailed Hawks, Great Horned Owls and Barred Owls.[9]

Status[edit]

The Pileated Woodpecker occupies a large range and is quite adaptable. Its ability to survive in many wooded habitat types has allowed the species to survive human habitation of North America much better than the more specialized Ivory-billed Woodpecker. Pileated Woodpeckers have a large population size and, despite being non-migratory, are protected under the U.S. Migratory Bird Act. Due to the considerable damage that Pileated Woodpeckers can do to trees, some people may consider them harmful if found on their property, but the large birds control many insect populations, especially tree beetles, that may otherwise experience outbreaks.


Problems playing this file? See media help.

Gallery[edit]

References[edit]

  1. ^ BirdLife International (2012). "Dryocopus pileatus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c Woodpeckers: An Identification Guide to the Woodpeckers of the World by Hans Winkler, David A. Christie & David Nurney. Houghton Mifflin (1995), ISBN 978-0395720431
  3. ^ [1]
  4. ^ a b Pileated Woodpecker, Nature Works
  5. ^ [2]
  6. ^ Beal, F.E. 1895. Preliminary report on the food of Woodpeckers. United States Department of Agriculture. Division of Ornithology and Mammalogy. Bulletin No. 7. Government Printing Office. Washington, District of Columbia. p. 32.
  7. ^ Pileated Woodpecker, Canadian Biodiversity Web Site
  8. ^ Pileated Woodpecker, Talk about Wildlife
  9. ^ [3]
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Variation seems generally clinal: birds from northern areas average slightly larger than those from the southeast; those from Pacific Northwest, slightly darker than elsewhere (Bull and Jackson 1995). Considered part of a superspecies including the black-bodied woodpecker (Dryocopus [PILEATUS] SHULZI) of south-central South America and the lineated woodpecker (D. [PILEATUS] Lineatus) of Middle and South America by Short (1982).

Four geographic races recognized by AOU (1957): D. P. PILEATUS - midwest U.S. to south Atlantic and Gulf coasts; D. P. PICINUS - British Columbia to California, Montana, south to north Arizona and southwest New Mexico; D. P. ABIETICOLA - northeast British Columbia, across Canada and northern U.S. to maritimes and northeast U.S.; and D. P. FLORIDANUS - Florida peninsula. Two geographic races were recognized by Short (1982) and Winkler et al. (1995): D. P. ABIETICOLA from western and northern areas, and D. P. PILEATUS from eastern and southern areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!