Overview

Brief Summary

The Northern Flicker (Colaptes auratus) is an extremely widely distributed woodpecker in North and Middle America. As the species boundaries are currently defined, the range of this species includes most of Canada south to north-central Nicaragua. Formerly, the Northern Flicker was treated as two separate species, the Yellow-shafted Flicker (C. auratus) to the east and north and the Red-shafted Flicker (C. cafer) to the west. However, evidence of extensive interbreeding where the ranges of these forms come into contact (as well as shifting philosophical views about species definitions) led to the "lumping" of the Yellow-shafted and Red-shafted Flickers. "Yellow-shafted" Flickers have yellow wing linings and undertail, gray crown, and tan face, with a red crescent on the nape; the male has a black moustachial stripe. "Red-shafted" Flickers have a brown crown and gray face, with no red crescent on the nape; the male has a red moustachial stripe. In the western Great Plains, there is a broad zone where all the flickers are intergrades, showing a mix of Yellow-shafted and Red-shafted characteristics. Another currently recognized species, the Gilded Flicker (Colaptes chrysoides), was formely treated as falling within C. auratus. All these flickers have a white rump that is conspicuous in flight.

Northern Flickers can be found in open woodlands, open situations, and parks—almost any habitat with at least a few trees (but generally not in dense forest that lack open areas for foraging). The diet consists mainly of ants and other insects, but fruits are eaten as well, especially in fall and winter, and sometimes seeds and nuts. Flickers are often seen foraging on the ground.

Male Northern Flickers defend their nesting territory with calling, drumming, and aggressive displays (swinging the head back and forth, flicking the wings open and spreading the tail to show its bright underside). Courtship and aggressive displays are largely similar. The commonly heard call on the breeding ground is a long, loud series of "wicka" notes; other vocalizations may be heard year-round.

Northern Flickers typically nest in cavities in dead trees or wooden posts (they may rarely nest in a ground burrow). The cavity is excavated by both sexes, typically 2 to 6 m above the ground (but sometimes to 30 m or more). The eggs are white and the usual clutch size is 5 to 8 eggs (although there may be as few as 3 or as many as 12). Incubation, for 11 to 16 days, is by both sexes, with the male incubating at night and during part of the day. Both parents feed the young (by regurgitation). Young leave the nest around 4 weeks after hatching and are fed by the parents for some time.

"Yellow-shafted" Flickers breeding in Alaska and Canada are strongly migratory, with large numbers traveling east and then south in the fall. "Red-shafted " Flickers often move shorter distances, moving southward and from mountains into lowlands, with some eastward movement into the Great Plains in winter.

(Kaufman 1996; AOU 1998; Dunn and Alderfer 2011)

  • American Ornithologists' Union. 1998. Check-list of North American Birds, 7th edition. American Ornithologists' Union, Washington, D.C.
  • Dunn, J.L. and J. Alderfer. 2011. National Geographic Field Guide to the Birds of North America. National Geographic Society, Washington, D.C.
  • Kaufman, K. 1996. Lives of North American Birds. Houghton Mifflin, Boston.
Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

This woodpecker ranges from Alaska eastward to Quebec, then south throughout the entire United States. Northern Flickers are migratory and winter in the southern part of this range and in northern Mexico (Palmer and Fowler 1975, Farrand, Jr. 1988, Winkler et al. 1995). In addition, these woodpeckers are found on Grand Cayman, Cuba, and range as far south as the highlands of Nicaragua (Winkler et al. 1995).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description


Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDS: from tree limit in central Alaska, northwestern Mackenzie, northern Manitoba, James Bay, central Quebec, southern Labrador, and Newfoundland, south to Baja California, southern Texas, Gulf coast, sounthern Florida, Nicaragua, Cuba and Grand Cayman. WINTERS: southern Canada south (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Northern Flickers range from Alaska eastward to Quebec, then south throughout the entire United States. Northern Flickers are migratory. They winter in the southern part of the United States and in northern Mexico. In addition, these woodpeckers are found on Grand Cayman, Cuba, and range as far south as the highlands of Nicaragua.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

This bird is 30 to 35 cm in length (Palmer and Fowler 1975, Winkler et al. 1995). Its wingspan is 54.1 cm, tail length is 12.2 cm, and bill length is 4.2 cm (Palmer and Fowler 1975). This is the only woodpecker to have a gray-brown barred back and white rump. The male has a tan head, gray crown, red nape, black moustache, and a black cresent on the breast. Underneath, the male is light tan with heavy black spotting. The tail is black on top. In the Eastern form, Yellow-shafted Flicker, the male has yellow underwings and under the tail, while the Western form, the Red-shafted Flicker, has reddish underwings (Peterson 1967, Palmer and Fowler 1975, Farrand, Jr. 1988).

Average mass: 170.0 g.

Range length: 30.0 to 35.0 cm.

Average wingspan: 54.1 cm.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: male more colorful

Average mass: 120 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Northern Flickers are 30 to 35 cm in length. Their wingspan is 54.1 cm, tail length is 12.2 cm, and bill length is 4.2 cm. They are the only woodpecker to have a gray-brown barred back and white rump. The male has a tan head, gray crown, red nape (back of the head and neck), black moustache, and a black cresent on the breast. Underneath, the male is light tan with heavy black spotting. The tail is black on top. In the Eastern forms, called Yellow-shafted Flickers, males have yellow underwings, while the Western forms, called Red-shafted Flickers, have reddish underwings. Females are similar in appearance but somewhat less colorful.

Average mass: 170.0 g.

Range length: 30.0 to 35.0 cm.

Average wingspan: 54.1 cm.

Other Physical Features: endothermic ; bilateral symmetry

Sexual Dimorphism: male more colorful

Average mass: 120 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 32 cm

Weight: 142 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

These woodpeckers are found in wooded areas that have stands of dead trees (Palmer and Fowler 1975). They are also found in open areas, forest edges, clear-cut areas, burnt areas, agricultural lands, and residential areas (Winkler et al. 1995).

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Open forest, both deciduous and coniferous, open woodland, open situations with scattered trees and snags, riparian woodland, pine-oak association, parks (AOU 1983). Nests in dead tree trunk, or stump, or dead top of live tree; sometimes nests in wooden pole, building or earth bank. Digs a nest hole cavity or reuses old one. Holes usually 2.5-7.5 m above ground (Harrison 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern Flickers are found in wooded areas that have stands of dead trees. They are also found in open areas, forest edges, clear-cut areas, burnt areas, agricultural lands, and residential areas.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeding populations north of southern Canada generally move south for winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Their chief food is ants. Other insects they consume include grasshoppers, crickets, termites, wasps, aphids, beetles and their larvae, caterpillars, and spiders. Cherries and the berries of dogwood, Virgina creeper, poison ivy, sumac, hackberry, and blackgum are also important foods as well as weed seeds, acorns, and other types of nut kernals (Palmer and Fowler 1975, Winkler et al. 1995). In the fall and winter, greater than half their food intake is in the form of fruit (Palmer and Fowler 1975).

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds on insects (ants, beetles, wasps, grasshoppers, grubs, etc). Feeds on the ground or catches insects in the air. Also eats fruits, berries, and seeds (clovers, grasses, ragweed, etc.) (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Northern flickers mainly consume insects and invertebrates, such as Orthoptera, Gryllidae, Formicidae, Isoptera, Hymenoptera, Aphididae, Coleoptera and their larvae, Lepidoptera, and Araneae. They also consume fruits in the fall and winter, as well as weed seeds, acorns, and other types of nuts.

Animal Foods: insects; terrestrial non-insect arthropods

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Northern Flickers help to control the populations of their invertebrate prey, especially ant populations. They also create nests that are later used by other cavity-nesting species of birds and by squirrels.

Ecosystem Impact: creates habitat

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Northern flickers do not respond strongly to predators. They may make tentative flights around the predator or make bill-poking movements towards the predator. Young in the nest are vulnerable to nest predators such as raccoons, squirrels, and snakes. Once they reach adulthood, northern flickers are preyed upon by several birds of prey that specialize on hunting birds. In eastern North America this includes Cooper's hawks and sharp-shinned hawks.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Northern Flickers help to control the populations of their invertebrate prey, especially ant populations. They also create nests that are later used by other cavity-nesting species of birds and by squirrels.

Ecosystem Impact: creates habitat

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Northern flickers do not respond strongly to predators. They may make tentative flights around the predator or make bill-poking movements towards the predator. Young in the nest are vulnerable to nest predators such as Procyon lotor, Sciuridae, and Squamata. Once they reach adulthood, northern flickers are preyed upon by several birds of prey that specialize on hunting birds. In eastern North America this includes Accipiter cooperi and Accipiter striatus.

Known Predators:

  • Cooper's hawks (Accipiter_cooperii)
  • sharp-shinned hawks (Accipiter_striatus)
  • raccoons (Procyon_lotor)
  • snakes (Serpentes)
  • squirrels (Sciuridae)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Colaptes auratus is prey of:
Bubo virginianus
Squamata
Sciuridae
Accipiter striatus
Accipiter cooperii
Procyon lotor

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Colaptes auratus preys on:
Hymenoptera

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Cavities excavated by flickers are used by many species of secondary cavity users.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Aggressive displays such as "bill directing" or "bill poking" are used by flickers. That is, a flicker may point his bill at a rival with his head tilted forward, or actually peck at an opponent. A more aggressive display is "head swinging," whereby a flicker will use side-to-side movements of his head and body against an opponent. There is also a "head bobbing" display that may be used. Sometimes tail spreading accompanies head swinging or bobbing displays.

Flickers sing during flight. Their song is a loud "wick wick wick wick wick," while individual notes sound like a loud "klee-yer" and a squeaky "flick-a flick-a flick-a."

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Aggressive displays such as "bill directing" or "bill poking" are used by flickers. That is, a flicker may point his bill at a rival with his head tilted forward, or actually peck at an opponent. A more aggressive display is "head swinging," whereby a flicker will use side-to-side movements of his head and body against an opponent. There is also a "head bobbing" display that may be used. Sometimes tail spreading accompanies head swinging or bobbing displays.

Flickers sing during flight. Their song is a loud "wick wick wick wick wick," while individual notes sound like a loud "klee-yer" and a squeaky "flick-a flick-a flick-a."

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The longest lifespan recorded is 9 years and 2 months for a yellow-shafted form of the Northern Flicker and 6 years and 8 months for a red-shafted form of the Northern Flicker. Most Northern Flickers probably live much less than this, maybe surviving only a few years.

Range lifespan

Status: wild:
9.0 (high) years.

Average lifespan

Status: wild:
110 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

The longest lifespan recorded is 9 years and 2 months for a yellow-shafted form of the Northern Flicker and 6 years and 8 months for a red-shafted form of the Northern Flicker. Most Northern Flickers probably live much less than this, maybe surviving only a few years.

Range lifespan

Status: wild:
9.0 (high) years.

Average lifespan

Status: wild:
110 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 12.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mating System: monogamous

The breeding season occurs from February to July (Winkler et al. 1995). The nest is excavated in dead tree trunks, dead parts of live trees, or telephone poles (Palmer and Fowler 1975, Winkler et al. 1995). These woodpeckers will build nests in nestboxes (Palmer and Fowler 1975). Nests are usually built below 3 m (Winkler et al. 1995).

There are 3 to 12 white, glossy eggs per clutch (Winkler et al. 1995). Larger clutches have been reported (Palmer and Fowler 1975), but these clutches are the result of eggs from more than one female (Winkler et al. 1995). The eggs are approximately 3 cm by 2.2 cm and weigh 7 g. Both parents incubate the eggs for 11 to 16 days. One or two annual broods occur (Palmer and Fowler 1975).

Breeding interval: Northern Flickers breed each year, they may have one or two clutches within the nesting season.

Breeding season: February to July

Range eggs per season: 3.0 to 12.0.

Range time to hatching: 16.0 (high) days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average eggs per season: 4.

Both parents help to incubate the eggs and care for nestlings. After the nestling period of 25 to 28 days, the young remain with the parents for some time, calling to the parents to be fed. Young flickers will molt to adult plumage from June to October.

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Incubation by both sexes, lasts 11-12 days. Nestlings are altricial. Young are tended by both adults; leave nest 25-28 days after hatching.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mating System: monogamous

The breeding season occurs from February to July. The nest is made in dead tree trunks, dead parts of live trees, or telephone poles. Northern Flickers will also build nests in nestboxes. Nests are usually built below 3 meters above the ground.

There are 3 to 12 white, glossy eggs per clutch. Larger clutches have been reported, but these clutches are the result of eggs from more than one female. The eggs are approximately 3 cm by 2.2 cm and weigh 7 g. Both parents incubate the eggs for 11 to 16 days.

Breeding interval: Northern Flickers breed each year, they may have one or two clutches within the nesting season.

Breeding season: February to July

Range eggs per season: 3.0 to 12.0.

Range time to hatching: 16.0 (high) days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Average eggs per season: 4.

Both parents help to incubate the eggs and care for nestlings. After the nestling period of 25 to 28 days, the young remain with the parents for some time, calling to the parents to be fed. Young flickers will molt to adult plumage from June to October.

Parental Investment: altricial ; male parental care ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Colaptes auratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACCGATGACTATTCTCCACCAACCACAAGGACATTGGCACTCTATACCTTATCTTTGGCGCATGAGCCGGCATAATCGGCACAGCCCTCAGCCTCCTCATTCGCGCTGAACTAGGTCAACCCGGCACCCTTCTCGGCGAT---GATCAAATTTACAACGTTATCGTCACCGCCCATGCATTCGTAATAATCTTCTTTATAGTCATACCCATCANAATCGGCGGATTCGGAAACTGACTTGTACCCCTCATGATCGGAGCCCCTGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTTCTCCCACCATCTTTCCTACTCCTCCTAGCCTCCTCTACAGTAGAAGCAGGAGCAGGCACAGGCTGAACCGTCTACCCCCCCCTCGCTGGCAACCTAGCCCACGCAGGAGCTTCAGTAGACCTAGCCATCTTCTCACTTCACCTAGCGGGTATCTCATCCATCCTAGGAGCAATTAACTTCATCACCACAGCCATCAACATGAAACCCCCAGCCATCTCACAGTACCAAACCCCCCTATTCGTCTGATCCGTCCTCATCACCGCCGTCCTTCTCCTCCTATCCCTCCCAGTTNTNGCNGCCGGCATCACAATACTTCTCACAGACCGCAACCTAAATNCCACATTCTTCGACCCCGCTGGAGGAGGAGACCCAATTCTCTACCAACACCTCTTCTGATTCTTTGGTCACCCTGAAGTTTACATCCTCATCCTCCCAGGATTTGGCATGATCTCCCACGTAGTAGCATACTACGCTGGCAAAAAAGAACCTTTCGGCTACATAGGAATAGTATGGGCTATACTGTCCATCGGATTCCTCGGCTTTATCGTTTGAGCCCACCACATATTCACCGTGGGAATGGACGTTGACACCCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Colaptes auratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 31
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Populations are not seriously endangered by human activity, although human activity sometimes destroys their habitat. Few conservation measures are being taken because Northern Flickers are not recognized as endangered. As a migratory North American bird they are protected by the U.S. Migratory Bird Act.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Populations are not seriously endangered by human activity, although human activity sometimes destroys their habitat. Few conservation measures are being taken because Northern Flickers are not recognized as endangered. As a migratory North American bird they are protected by the U.S. Migratory Bird Act.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size is unknown given recent taxonomic splits.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: The cause of the declines in recent decades is unknown; perhaps food resources (ants) have become scarce due to pesticide use and/or, in the south, the impact of imported fire ants (are these eaten by flickers?) on native ants (S. Droege). Subspecies CHRYSOIDES (gilded flicker) has declined in southern California due to loss and degradation of riparian forest habitat and extirpation of saguaros (California Department of Fish and Game 1990). European starlings sometimes usurp nest sites, but flickers do not necessarily incur a reduction in fecundity because they may be able to renest successfully later in the season, though this is not without its problems (Ingold 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: Along the lower Colorado River, subspecies CHRYSOIDES may eventually benefit from riparian forest revegetation efforts when trees reach size suitable for nesting (California Department of Fish and Game 1990).

See Mitchell (1988) for specifications for the construction and placement of nest boxes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

These woodpeckers are very useful destroyers of insect pests, including the European corn borer. Since they have a particular taste for ants, these woodpeckers also eliminate plant-injuring aphids which provide "honeydew" for ants (Palmer and Fowler 1975).

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

These woodpeckers are very useful destroyers of insect pests, including European corn borers. Since they have a particular taste for ants, these woodpeckers also eliminate plant-injuring aphids which provide "honeydew" for ants.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Northern flicker

The northern flicker (Colaptes auratus) is a medium-sized member of the woodpecker family. It is native to most of North America, parts of Central America, Cuba, the Cayman Islands, and is one of the few woodpecker species that migrate. There are over 100 common names for the northern flicker. Among them are: yellowhammer, clape, gaffer woodpecker, harry-wicket, heigh-ho, wake-up, walk-up, wick-up, yarrup, and gawker bird. Many of these names are attempts at imitating some of its calls.

Taxonomy[edit]

The northern flicker is part of the genus Colaptes which encompasses 12 New-World woodpeckers. There are two living and one extinct subspecies of C. auratus. The existing sub-species were at one time considered separate species but they commonly interbred where ranges overlap and are now considered one species by the American Ornithologists Union. Whether or not they are separate species is a well-known example of the species problem.

  • The yellow-shafted flicker (Colaptes auratus auratus) resides in eastern North America. They are yellow under the tail and underwings and have yellow shafts on their primaries. They have a grey cap, a beige face and a red bar at the nape of their neck. Males have a black moustache. Colaptes comes from the Greek verb colapt, to peck. Auratus is from the Latin root aurat, meaning "gold" or "golden" and refers to the bird's underwing.
Under the name "yellowhammer" it is the state bird of Alabama.[2]
  • The red-shafted flicker (Colaptes auratus cafer) resides in western North America. They are red under the tail and underwings and have red shafts on their primaries. They have a beige cap and a grey face. Males have a red moustache. The scientific name, Colaptes auratus cafer, is the result of an error made in 1788 by the German systematist, Johann Gmelin, who believed that its original habitat was in South Africa among the Xhosa people, then known as the "Kaffir" people.
  • The †Guadalupe flicker (Colaptes auratus/cafer rufipileus) extinct c. 1910.

Description[edit]

Red-shafted northern flicker: female (left), male (right)

Adults are brown with black bars on the back and wings. A mid-to-large-sized woodpecker measures 28–36 cm (11–14 in) in length and 42–54 cm (17–21 in) in wingspan.[3][4] The body mass can vary from 86 to 167 g (3.0 to 5.9 oz).[5] Among standard scientific measurements, the wing bone measures 12.2–17.1 cm (4.8–6.7 in), the tail measures 7.5–11.5 cm (3.0–4.5 in), the bill measures 2.2–4.3 cm (0.87–1.69 in) and the tarsus measures 2.2–3.1 cm (0.87–1.22 in). The largest-bodied specimens are from the northern stretches of the species range, such as Alaska or Newfoundland and Labrador, whereas the smallest specimens come from Grand Cayman Island.[6] A necklace-like black patch occupies the upper breast, while the lower breast and belly are beige with black spots. Males can be identified by a black or red moustachial stripe at the base of the beak. The tail is dark on top, transitioning to a white rump which is conspicuous in flight.

The subspecies plumage varies as described in Taxonomy section.

Call and flight[edit]

This bird's call is a sustained laugh, ki ki ki ki, more congenial than that of the pileated woodpecker. One may also hear a constant knocking as they often drum on trees or even metal objects to declare territory. Like most woodpeckers, northern flickers drum on objects as a form of communication and territory defense. In such cases, the object is to make as loud a noise as possible, and that’s why woodpeckers sometimes drum on metal objects.

Long Island, NY, August 1996. By Tony Phillips.

Problems playing this file? See media help.

Like many woodpeckers, its flight is undulating. The repeated cycle of a quick succession of flaps followed by a pause creates an effect comparable to a rollercoaster.

Behavior[edit]

Diet[edit]

According to the Audubon guide, "flickers are the only woodpeckers that frequently feed on the ground", probing with their beak, also sometimes catching insects in flight. Although they eat fruits, berries, seeds and nuts, their primary food is insects. Ants alone can make up 45% of their diet. Other invertebrates eaten include flies, butterflies, moths, beetles, and snails. Flickers also eat berries and seeds, especially in winter, including poison oak and ivy, dogwood, sumac, wild cherry and grape, bayberries, hackberries, and elderberries, and sunflower and thistle seeds. Flickers often go after ants underground (where the nutritious larvae live), hammering at the soil the way other woodpeckers drill into wood. They have been observed breaking into cow patties to eat insects living within. Their tongues can dart out 50 mm (2.0 in) beyond the end of the bill to snare prey. As well as eating ants, flickers have a behavior called anting, during which they use the acid from the ants to assist in preening, as it is useful in keeping them free of parasites.

Habitat[edit]

Flickers may be observed in open habitats near trees, including woodlands, edges, yards, and parks. In the western United States, one can find them in mountain forests all the way up to treeline. Northern flickers generally nest in holes in trees like other woodpeckers. Occasionally, they have been found nesting in old, earthen burrows vacated by belted kingfishers or bank swallows. Both sexes help with nest excavation. The entrance hole is about 7.6 cm (3.0 in) in diameter, and the cavity is 33–41 cm (13–16 in) deep. The cavity widens at bottom to make room for eggs and the incubating adult. Inside, the cavity is bare except for a bed of wood chips for the eggs and chicks to rest on. Once nestlings are about 17 days old, they begin clinging to the cavity wall rather than lying on the floor.

Lifespan[edit]

The oldest yet known "yellow-shafted" northern flicker lived to be at least 9 years 2 months old, and the oldest yet known “red-shafted” northern flicker lived to be at least 8 years 9 months old.[citation needed]

Reproduction[edit]

Two males in a territorial display during spring

Their breeding habitat consists of forested areas across North America and as far south as Central America. They are cavity nesters who typically nest in trees but they will also use posts and birdhouses if sized and situated appropriately. They prefer to excavate their own home although they will reuse and repair damaged or abandoned nests. Abandoned flicker nests create habitat for other cavity nesters. Flickers are sometimes driven from nesting sites by another cavity nester, the European starling.

It takes about 1 to 2 weeks to build the nest which is built by both sexes of the mating pairs. The entrance hole is roughly 5 to 10 cm (2.0 to 3.9 in) wide.

Northern flicker feeding juvenile at nest cavity entrance

A typical clutch consists of 6 to 8 eggs whose shells are pure white with a smooth surface and high gloss. The eggs are the second largest of the North American woodpecker species, exceeded only by the pileated woodpecker's. Incubation is by both sexes for approximately 11 to 12 days. The young are fed by regurgitation and fledge about 25 to 28 days after hatching.

Wintering and migration[edit]

Northern birds migrate to the southern parts of the range; southern birds are often permanent residents.

References[edit]

  1. ^ BirdLife International (2012). "Colaptes auratus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ "Alabama State Bird". Alabama Emblems, Symbols and Honors. Alabama Department of Archives & History. 2006-04-27. Retrieved 2007-03-18. 
  3. ^ [1] (2011).
  4. ^ [2] (2011).
  5. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  6. ^ Woodpeckers: An Identification Guide to the Woodpeckers of the World by Hans Winkler, David A. Christie & David Nurney. Houghton Mifflin (1995), ISBN 978-0-395-72043-1
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Also called the Common Flicker. Three forms previously were considered separate species, and then conspecific, then partially split: C. AURATUS (yellow-shafted Flicker); C. CAFER (Red-shafted Flicker); C. CHRYSOIDES (Gilded Flicker). Sibley and Monroe (1990), citing information from N. K. Johnson, noted that interbreeding between CAFER and CHRYSOIDES is limited; they treated the later as a distinct species, C. CHRYSOIDES. Fletcher and Moore (1992) found very little geographic variation in allozymes across the three subspecies groups and the entire continental U.S. (birds in general are known to display little allozymic differentiation, even between recognized species). These results agree with previous findings that the hybrid zone between Red- and Yellow-shafted Flickers does not act as a barrier to nuclear gene flow. The allozyme data indicate a population structure that is not congruent with that indicated by mtDNA data (see Fletcher and Moore 1992). Fletcher and Moore concluded that more data are needed before taxonomic considerations regarding the Gilded Flicker (CHRYSOIDES subspecies group) can be adequately addressed. AOU (1995) cited limited hybridization between AURATUS and CHRYSOIDES and marked clutch size differences in recognizing C. AURATUS (with CAFER) and C. CHRYSOIDES as distinct species. Isolated form on Cuba, CHRYSOCAULOSUS, usually treated as a race of C. AURATUS and form in Middle America, MEXICANOIDES, usually treated as a race of C. CAFER (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!