Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Comprehensive Description

Summary

A medium sized bird with fawn and black colour. Its long thin beak and crown are distinctive. It can be seen probing the soil on lightly vegetated grounds with its beak.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

"A fawn coloured bird with black-and-white zebra markings on back, wings and tail ; a conspicuous fan-shaped crest and Ions, slender, slightly curved bill. Sexes alike."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

About that of the Myna.
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"Singly or pairs, usually on the ground in lightly wooded country."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"The Hoopoe is a bird of open country, plains as well as hills upto about 5,000 feet, ft is fond of lawns, gardens and groves in and about towns and villages. Scattered pairs and family parties of four or live birds are usually met with, feeding exclusively on the ground, probing into the soil and amongst the fallen leaves with bill partly open like forceps. It walks and runs on its short legs with a quail-like but somewhat waddling gait. When digging, the crest is depressed and projects in a point behind the head suggestive ol a miniature pickaxe. When the bird is alarmed or excited, the crest is quickly erected and opened lanwise. It flies off in an undulating, undecided sort of way to resettle at some distance whereupon the crest is again raised. The call is a suit and musical, but penetrating, hoo-po, or hoo-po-po repeated several times and often intermittently for over 10 minutes at a stretch. When calling from a branch the bird lowers and bobs its head so that the bill lies almost flat against the breast, the tail at the same time being depressed and turned in under the perch as if in an effort to make both ends meet. At other times the head is jerked forward at each successive call as if barking, and the crest raised and lowered from time to time. Besides this call, it has a variety of harsh subdued caws and wheezy chuckles. Its diet consists of insects, grubs and pupa, it is beneficial to agriculture bv virtue of the vast numbers of insect pests it destroys."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 11.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

"The season ranges between February and April. A hole in a wall, roof, under eaves or in a rotten branch or stump is selected and lined untidily with rags, hair, wool, straw and rubbish. The normal clutch consists of 5 or 6 eggs, white when fresh but becoming discoloured as incubation progresses. The female is a close sitter and seldom leaves the nest, being zealously fed by her mate all through this period. The nest is notorious for the mass of filth that accumulates there, and for the abominable stench it emits. Moth sexes share in feeding the young."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Upupa epops

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTGATTTTTGGAGCATGAGCCGGAATAGTGGGTACAGCCCTTAGCCTCTTAATCCGTGCAGAACTAGGACAACCAGGAACCCTCCTGGGCGACGACCAGATCTACAATGTAGTCGTCACCGCCCATGCTTTCGTAATAATCTTCTTCATGGTCATACCGATTATAATCGGAGGCTTCGGAAACTGATTAGTCCCATTAATAATCGGCGCACCAGACATGGCATTCCCCCGTATAAATAACATAAGCTTTTGACTACTCCCACCCTCCTTTCTTCTTCTAATAGCCTCCTCCACAGTTGAAGCCGGGGCCGGCACAGGATGAACAGTCTACCCCCCCTTAGCCGGCAATCTCGCCCATGCTGGAGCCTCTGTTGACCTAGCAATCTTCTCACTTCACCTAGCCGGAATTTCCTCTATCCTAGGGGCAATCAATTTTATCACAACAGCTATCAACATAAAACCCCCATCACTGTCACAATACCAAACCCCACTATTTGTCTGATCAGTATTAATCACTGCCGTACTACTCCTTCTATCCCTACCAGTTTTAGCAGCCGGCATCACAATACTTCTGACCGACCGAAACCTGAACACCACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAATCCTATACCAACACTTATTCTGATTCTTCGGACACCCAGAAGTATACATCCTAATCCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Upupa epops

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red List Category & Criteria: Least Concern ver 3.1
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Resident breeder and regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hoopoe

The hoopoe /ˈhp/ (Upupa epops) is a colourful bird found across Afro-Eurasia, notable for its distinctive "crown" of feathers. It is the only extant species in the family Upupidae. One insular species, the Saint Helena hoopoe, is extinct, and the Madagascar subspecies of the hoopoe is sometimes elevated to a full species. Like the Latin name upupa, the English name is an onomatopoeic form which imitates the cry of the bird. The hoopoe is the national bird of Israel.

Taxonomy and systematics[edit]

The hoopoe is classified in the clade Coraciiformes, which also includes kingfishers, bee-eaters, rollers, and woodhoopoes.[2] A close relationship between the hoopoe and the woodhoopoes is also supported by the shared and unique nature of their stapes.[3] In the Sibley-Ahlquist taxonomy, the Hoopoe is separated from the Coraciiformes as a separate order, the Upupiformes. Some authorities place the woodhoopoes in the Upupiformes as well.[4]

The fossil record of the hoopoes is very incomplete, with the earliest fossil coming from the Quaternary.[5] The fossil record of their relatives is older, with fossil woodhoopoes dating back to the Miocene and those of an extinct related family, the Messelirrisoridae, dating from the Eocene.[4]

It is the only extant member of its family, although some treatments consider some of the subspecies as separate species. Several authors have separated the Madagascan subspecies (U. e. marginata) as a separate species, and also the resident African form U. e. africana. The morphological differences between the most commonly split subspecies, U. e. marginata, and the other subspecies are minor, and only U. e. marginata has distinctly different vocalisations.[6] One accepted separate species, the Saint Helena hoopoe, U. antaios, lived on the island of St Helena but became extinct in the 16th century, presumably due to introduced species.[5]

The genus Upupa was created by Linnaeus in his Systema naturae in 1758. It then included three other species with long curved bills:[7]

Subspecies[edit]

U. e. epops in Galicia, Spain.

Nine subspecies of hoopoe are recognised by Kristin (in the 2001 Handbook of the Birds of the World). They vary mostly in size and the depth of colour in the plumage. Two further subspecies have been proposed, U. e. minor in South Africa and U. e. orientalis in north western India.

Subspecies[6]Breeding range[6]Distinctive features[6]
U. e. epops
Linnaeus, 1758
NW Africa, Canary Islands, and from Europe through to south central Russia, north west China and south to north west India.Nominate
U. e. major
C.L. Brehm, 1855
North east AfricaLarger than nominate, longer billed, narrower tailband, greyer upperparts
U. e. senegalensis
Swainson, 1913
Senegal to EthiopiaSmaller than nominate, shorter winged
U. e. waibeli
Reichenow, 1913
Cameroon through to north KenyaAs U. e. senegalensis but darker plumage and more white on wings
U. e. africana
Bechstein, 1811
Central Africa to South AfricaMuch more rufous than nominate
U. e. marginata
Cabanis & Heine, 1860
MadagascarLarger, much more pale than U. e. africana
U. e. saturata
Lönnberg, 1909
Japan, Siberia to Tibet and south ChinaAs nominate, greyer mantle, less pink below
U. e. ceylonensis
Reichenbach, 1853
Indian SubcontinentSmaller than nominate, more rufous overall, no white in crest
U. e. longirostris
Jerdon, 1862
South east AsiaLarger than nominate, pale

Description[edit]

The muscles of the head allow the Hoopoe's bill to be opened when it is inserted into the ground

The hoopoe is a medium sized bird, 25–32 cm (9.8–12.6 in) long, with a 44–48 cm (17–19 in) wingspan. It weighs 46–89 g (1.6–3.1 oz). The species is highly distinctive, with a long, thin tapering bill that is black with a fawn base. The strengthened musculature of the head allows the bill to be opened when probing inside the soil. The hoopoe has broad and rounded wings capable of strong flight; these are larger in the northern migratory subspecies. The hoopoe has a characteristic undulating flight, which is like that of a giant butterfly, caused by the wings half closing at the end of each beat or short sequence of beats.[6]

The call is typically a trisyllabic oop-oop-oop, which gives rise to its English and scientific names, although two and four syllables are also common. In the Himalayas, the calls can be confused with that of the Himalayan cuckoo (Cuculus saturatus), although the cuckoo typically produces four notes. Other calls include rasping croaks, when alarmed, and hisses. Females produce a wheezy note during courtship feeding by the male.[8] Both genders, when disturbed, call a rough charrrrrr, strongly reminiscent of the warning cry of the Eurasian jay. The food begging call of the nestlings is similar to that of a common swift: tiiii.

Distribution and habitat[edit]

The hoopoe is widespread in Europe, Asia, and North Africa, Sub-Saharan Africa and Madagascar.[6] Most European and north Asian birds migrate to the tropics in winter.[9] In contrast, the African populations are sedentary all year. The species has been a vagrant in Alaska;[10] U. e. saturata was recorded there in 1975 in the Yukon Delta.[11] Hoopoes have been known to breed north of their European range,[12] and in southern England during warm, dry summers that provide plenty of grasshoppers and similar insects,[13] although as of the early 1980s northern European populations were reported to be in the decline, possibly due to changes in climate.[12]

The hoopoe has two basic requirements of its habitat: bare or lightly vegetated ground on which to forage and vertical surfaces with cavities (such as trees, cliffs or even walls, nestboxes, haystacks, and abandoned burrows[12]) in which to nest. These requirements can be provided in a wide range of ecosystems, and as a consequence the hoopoe inhabits a wide range of habitats such as heathland, wooded steppes, savannas and grasslands, as well as forest glades. The Madagascar subspecies also makes use of more dense primary forest. The modification of natural habitats by humans for various agricultural purposes has led to hoopoes becoming common in olive groves, orchards, vineyards, parkland and farmland, although they are less common and are declining in intensively farmed areas.[6] Hunting is of concern in southern Europe and Asia.[11]

Hoopoes make seasonal movements in response to rain in some regions such as in Ceylon and in the Western Ghats.[14] Birds have been seen at high altitudes during migration across the Himalayas. One was recorded at about 6,400 m (21,000 ft) by the first Mount Everest expedition.[8]

Behaviour and ecology[edit]

A hoopoe sunbathing, on Lanzarote

In what was long thought to be a defensive posture, hoopoes sunbathe by spreading out their wings and tail low against the ground and tilting their head up; they often fold their wings and preen halfway through.[15] They also enjoy taking dust and sand baths.[16]

Diet and feeding[edit]

The diet of the hoopoe is mostly composed of insects, although small reptiles, frogs and plant matter such as seeds and berries are sometimes taken as well. It is a solitary forager which typically feeds on the ground. More rarely they will feed in the air, where their strong and rounded wings make them fast and manoeuvrable, in pursuit of numerous swarming insects. More commonly their foraging style is to stride over relatively open ground and periodically pause to probe the ground with the full length of their bill. Insect larvae, pupae and mole crickets are detected by the bill and either extracted or dug out with the strong feet. Hoopoes will also feed on insects on the surface, probe into piles of leaves, and even use the bill to lever large stones and flake off bark. Common diet items include crickets, locusts, beetles, earwigs, cicadas, ant lions, bugs and ants. These can range from 10 to 150 mm in length, with a preferred prey size of around 20–30 mm. Larger prey items are beaten against the ground or a preferred stone to kill them and remove indigestible body parts such as wings and legs.[6]

Breeding[edit]

Young and mature hoopoe in Dubai park
Hoopoe eggs MHNT

Hoopoes are monogamous, although the pair bond apparently only lasts for a single season, and territorial. The male calls frequently to advertise his ownership of the territory. Chases and fights between rival males (and sometimes females) are common and can be brutal.[6] Birds will try to stab rivals with their bills, and individuals are occasionally blinded in fights.[17] The nest is in a hole in a tree or wall, and has a narrow entrance.[16] It may be unlined, or various scraps may be collected.[12] The female alone is responsible for incubating the eggs. Clutch size varies with location: northern hemisphere birds lay more eggs than those in the southern hemisphere, and birds at higher latitudes have larger clutches than those closer to the equator. In central and northern Europe and Asia the clutch size is around 12, whereas it is around four in the tropics and seven in the subtropics. The eggs are round and milky blue when laid, but quickly discolour in the increasingly dirty nest.[6] They weigh 4.5 grams.[15] A replacement clutch is possible.[12]

Hoopoes have well-developed anti-predator defences in the nest. The uropygial gland of the incubating and brooding female is quickly modified to produce a foul-smelling liquid, and the glands of nestlings do so as well. These secretions are rubbed into the plumage. The secretion, which smells like rotting meat, is thought to help deter predators, as well as deter parasites and possibly act as an antibacterial agent.[18] The secretions stop soon before the young leave the nest.[15] From the age of six days, nestlings can also direct streams of faeces at intruders, and will hiss at them in a snake-like fashion.[6] The young also strike with their bill or with one wing.[15]

The incubation period for the species is between 15 and 18 days, during which time the male feeds the female. Incubation begins as soon as the first egg is laid, so the chicks are born asynchronously. The chicks hatch with a covering of downy feathers. By around day three to five, feather quills emerge which will become the adult feathers. The chicks are brooded by the female for between 9 to 14 days.[6] The female later joins the male in the task of bringing food.[16] The young fledge in 26 to 29 days and remain with the parents for about a week more.[12]

Relationship with humans[edit]

Hoopoe (דוכיפת) in Israel. The Hoopoe is Israel's national bird.

The diet of the hoopoe includes many species considered by humans to be pests, such as the pupae of the processionary moth, a damaging forest pest.[19] For this reason the species is afforded protection under the law in many countries.[6]

Hoopoes are distinctive birds and have made a cultural impact over much of their range. They were considered sacred in Ancient Egypt, and were "depicted on the walls of tombs and temples". They achieved a similar standing in Minoan Crete.[15]

In the Bible, Leviticus 11:13–19, hoopoes were listed among the animals that are detestable and should not be eaten. They are also listed in Deuteronomy (14:18[20]) as not kosher.

Hoopoes also appear in the Quran, in Surah Al-Naml 27:20–22: "And he Solomon sought among the birds and said: How is it that I see not the hoopoe, or is he among the absent? (20) I verily will punish him with hard punishment or I verily will slay him, or he verily shall bring me a plain excuse. (21) But he [the hoopoe] was not long in coming, and he said: I have found out (a thing) that thou apprehendest not, and I come unto thee from Sheba with sure tidings." Islamic literature also states that a hoopoe saved Moses and the children of Israel from being crushed by the giant Og[21] after crossing the Red Sea.

Hoopoes were seen as a symbol of virtue in Persia. A hoopoe was the leader of the birds in the Persian book of poems The Conference of the Birds.

Hoopoes were thought of as thieves across much of Europe, and harbingers of war in Scandinavia.[22] In Estonian tradition, hoopoes are strongly connected with death and the underworld; their song is believed to foreshadow death for many people or cattle.[23]

The hoopoe is the king of the birds in the Ancient Greek comedy The Birds by Aristophanes. In Ovid's Metamorphoses, book 6, King Tereus of Thrace rapes Philomela, his wife Procne's sister, and cuts out her tongue. In revenge, Procne kills their son Itys and serves him as a stew to his father. When Tereus sees the boy's head, which is served on a platter, he grabs a sword but just as he attempts to kill the sisters, they are turned into birds—Procne into a swallow and Philomela into a nightingale. Tereus himself is turned into an epops (6.674), translated as lapwing by Dryden[24] and lappewincke (lappewinge) by John Gower in his Confessio Amantis,[25] or hoopoe in A.S. Kline's translation.[26] The bird's crest indicates his royal status, and his long, sharp beak is a symbol of his violent nature. English translators and poets probably had the northern lapwing in mind, considering its crest.

The hoopoe was chosen as the national bird of Israel in May 2008 in conjunction with the country's 60th anniversary, following a national survey of 155,000 citizens, outpolling the white-spectacled bulbul.[27][not in citation given] It is the state bird of the Punjab province of India. The hoopoe appears on the Logo of the University of Johannesburg and is the official mascot of the University's sports. The municipality of Armstedt, Germany, has a hoopoe in its coat of arms.

References[edit]

  1. ^ BirdLife International (2012). "Upupa epops". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Hackett, Shannon J.; et al. (2008). "A Phylogenomic Study of Birds Reveals Their Evolutionary History". Science 320 (1763): 1763–1768. doi:10.1126/science.1157704. PMID 18583609. 
  3. ^ Feduccia, Alan (1975). "The Bony Stapes in the Upupidae and Phoeniculidae: Evidence for Common Ancestry". The Wilson Bulletin 87 (3): 416–417. 
  4. ^ a b Mayr, Gerald (2000). "Tiny Hoopoe-Like Birds from the Middle Eocene of Messel (Germany)". Auk 117 (4): 964–970. doi:10.1642/0004-8038(2000)117[0964:THLBFT]2.0.CO;2. 
  5. ^ a b Olson, Storrs (1975). Paleornithology of St Helena Island, south Atlantic Ocean. Smithsonian Contributions to Paleobiology 23. 
  6. ^ a b c d e f g h i j k l m Kristin, A (2001). "Family Upupidae (Hoopoes)". In Josep, del Hoyo; Andrew, Elliott; Sargatal, Jordi. Handbook of the Birds of the World. Volume 6, Mousebirds to Hornbills. Barcelona: Lynx Edicions. pp. 396–411. ISBN 84-87334-30-X. 
  7. ^ (Latin) Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). pp. 117–118. 
  8. ^ a b Ali, S. and Ripley, S. D. (1983). Handbook of the Birds of India and Pakistan. Volume 4 (2 ed.). Oxford University Press, New Delhi. pp. 124–129. 
  9. ^ Reichlin, Thomas; Michael Schaub, Myles H. M. Menz, Murielle Mermod, Patricia Portner, Raphaël Arlettaz & Lukas Jenni (2008). "Migration patterns of Hoopoe Upupa epops and Wryneck Jynx torquilla: an analysis of European ring recoveries". Journal of Ornithology 150 (2): 393. doi:10.1007/s10336-008-0361-3. 
  10. ^ Dau, Christian; Paniyak, Jack (1977). "Hoopoe, A First Record for North America". Auk 94 (3): 601. 
  11. ^ a b Heindel, Matthew T.; Jonathan Alderfer (ed.) (2006). Complete Birds of North America. National Geographic Society. p. 360. ISBN 0-7922-4175-4. 
  12. ^ a b c d e f Pforr, Manfred; Alfred Limbrunner (1982). The Breeding Birds of Europe 2: A Photographic Handbook. London: Croom and Helm. p. 82. ISBN 0-7099-2020-2. 
  13. ^ Soper, Tony (1982). Birdwatch. Exeter, England: Webb & Bower. p. 141. ISBN 0-906671-55-8. 
  14. ^ Champion-Jones, RN (1937). "The Ceylon Hoopoe (Upupa epops ceylonensis Reichb.)". J. Bombay Nat. Hist. Soc. 39 (2): 418. 
  15. ^ a b c d e Fry, Hilary C. (2003). Christopher Perrins, ed. Firefly Encyclopedia of Birds. Firefly Books. p. 382. ISBN 1-55297-777-3. 
  16. ^ a b c Harrison, C.J.O.; Christopher Perrins (1979). Birds: Their Ways, Their World. The Reader’s Digest Association. pp. 303–304. ISBN 0-89577-065-2. 
  17. ^ Martín-Vivaldi, Manuel; Palomino, José J. and Soler, Manuel (2004). "Strophe Length in Spontaneous Songs Predicts Male Response to Playback in the Hoopoe Upupa epops". Ethology 110 (5): 351–362. doi:10.1111/j.1439-0310.2004.00971.x. 
  18. ^ Martín-Platero, Antonio M. et al. (2006). "Characterization of Antimicrobial Substances Produced by Enterococcus faecalis MRR 10-3, Isolated from the Uropygial Gland of the Hoopoe (Upupa epops)". Applied and Environmental Microbiology 72 (6): 4245–4249. doi:10.1128/AEM.02940-05. PMC 1489579. PMID 16751538. 
  19. ^ Battisti, A; Bernardi, M. and Ghiraldo, C. (2000). "Predation by the hoopoe (Upupa epops) on pupae of Thaumetopoea pityocampa and the likely influence on other natural enemies". Biocontrol 45 (3): 311–323. doi:10.1023/A:1009992321465. 
  20. ^ Deuteronomy Chapter 14:18. mechon-mamre.org
  21. ^ M. Th Houtsma (1987). E.J. Brill's First Encyclopaedia of Islam, 1913-1936. Brill Academic Publishers. p. 990. ISBN 9789004082656.
  22. ^ Dupree, N (1974). "An Interpretation of the Role of the Hoopoe in Afghan Folklore and Magic". Folklore 85 (3): 173–93. doi:10.1080/0015587X.1974.9716553. JSTOR 1260073. 
  23. ^ Mall Hiiemäe, Forty birds in Estonian folklore IV. translate.google.com
  24. ^ Garth, Samuel; Dryden, John et al. "'Metamorphoses' by Ovid". 
  25. ^ Book 5, lines 6041 and 6046. Gower, John. "Confessio Amantis". Project Gutenberg. Retrieved 2009-02-17. 
  26. ^ Kline, A.S. (2000). "The Metamorphoses: They are transformed into birds". Retrieved 2009-02-17. 
  27. ^ Reuters photo credit: Ofir Lotan (May 29, 2008). "Day in pictures". San Francisco Chronicle. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!