Articles on this page are available in 1 other language: Spanish (8) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Colibri thalassinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TCTGTACTTAATTTTTGGCGCGTGGGCCGGAATAGTTGGAACCGCCCTCAGCCTGCTAATTCGAGCAGAGCTCGGCCAGCCAGGCACCCTTCTCGGAGACGACCAGATCTACAACGTAATTGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATGGTTATGCCCATTATAATCGGGGGGTTCGGAAACTGACTGATCCCGCTCATAATTGGAGCTCCCGACATAGCATTCCCCCGTATAAACAATATAAGCTTCTGACTCCTACCGCCGTCGTTCCTCCTTCTTCTCGCCTCCTCTACAGTGGAAGCAGGCGCAGGCACAGGATGAACTGTGTACCCGCCCCTAGCTGGCAACCTGGCCCACGCAGGCGCATCAGTAGACCTAGCCATCTTCTCCCTTCACTTATCGGGTATTTCATCCATCCTGGGGGCAATCAACTTTATTACTACTGCAATTAACATAAAACCACCCGCTCTATCACAATACCAAACCCCCCTATTCGTCTGATCCGTTCTCATTACCGCCGTACTACTCCTCCTCTCTCTCCCAGTGCTTGCCGCAGGGATTACAATATTGCTCACAGACCGAAATCTAAACACCACATTCTTCGACCCAGCCGGAGGGGGTGACCCTATCCTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Colibri thalassinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight (A. Panjabi in litt. 2008)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Green Violetear

Male displaying his "ears"

The Green Violetear (Colibri thalassinus) is a medium-sized, metallic green hummingbird species commonly found in forested areas from Mexico to northern South America.

Contents

Taxonomy

GreenvioletearsavegreL36.JPG

The Green Violetear belongs to the order Apodiformes. Hummingbirds share this order with the swifts, such as the white-collared swift. The name Apodiformes is derived from the Greek words "a pous," meaning "without foot." While apidiforms do in fact have feet, they are quite small and their legs are short and relatively weak. Many birds in this order cannot walk, and thus rarely if ever land on the ground since quick escape from predators is virtually impossible. For this reason members of this order spend a majority of their time in the air.

All hummingbirds belong to the family Trochilidae, a family exclusive to The Americas. The most diverse hummingbird populations reside in northwestern South America. This family contains what is considered to be the world’s smallest bird, the Bee Hummingbird (Mellisuga helenae). Hummingbirds are notorious for their ability to rotate the entire wing at the shoulders, permitting stationary hovering and even backwards flight, the latter of which is a skill exclusive to hummingbirds.

There are two other species which occupy the Violetear (Colibri) genus; the Brown Violetear and the Sparkling Violetear. While their ranges overlap, they are generally found at different altitudes and occupy different habitats. These three hummingbirds are characterized by their violet ear patches. In all three species there is no strong sexual dimorphism.

Description

In flight

Physical

The Green Violetear is roughly medium-sized by hummingbird standards. It averages around 9.7 to 12 cm (3.8 to 4.7 in) in total length. Its bill is black and mostly straight with only a slight downward curve and measures from 1.8 to 2.5 cm (0.71 to 0.98 in).[2][3] The body mass can vary from 4.8 to 5.6 g (0.17 to 0.20 oz).[4] Among standard measurements, the wing chord is 5.8 to 6.8 cm (2.3 to 2.7 in) and the tail is 3.5 to 4.3 cm (1.4 to 1.7 in).[5] It is shining green above with a glittering violet ear-patch on the sides of its neck. Its throat and chest are a more glittering green with a shining green belly. The tail is a metallic blue-green with bronzier central feathers and a prominent black subterminal band.

Vocalizations

Solitary males sing from high, exposed twigs in their territory every day. Their song is a monotonously repeated sharp and dry “tsu-tzeek” at a rate of about one call per second.

Distribution and habitat

Distribution

The Green Violetear has a range from the highlands of southern Mexico to Honduras; the highlands of Costa Rica and western Panama; mountains of northern Venezuela and the Andes from western Venezuela to western Bolivia.

Habitat

Common habitats for the green violetear is in the canopy and borders of subtropical and lower temperate forest, secondary woodland and scrub, and clearings and gardens in the subtropical zone on both slopes of the Andes. It is recorded mostly between altitudes of 1200 to 2300m, though they will sometimes wander as far down as 500m in search of food sources. It generally prefers more humid and high-altitude areas, such as cloud forests, than the similar Sparkling Violetear and is completely absent from the central valley where the Sparkling Violetear is most prevalent. However, the two species will sometimes be seen in the same areas feeding at flowering Inga trees.

Behavior

Diet

Greenvioletearinhand1.jpg

The Green Violetear forages alone but tends to gather at flowering trees, especially coffee-shade Inga. They feed at mid-level to canopy and often hold and defend a feeding territory. They primarily feed on nectar and small insects. The Green Violetear has been recorded as attaining the greatest flying speed ever recorded for a hummingbird, with a pair of birds having attained 90 mph (140 km/h) during a chase, although other species may be able to attain similar speeds.[6]

Breeding

Like most hummingbirds, the Green Violetear is a solitary nester. The male’s only involvement in the breeding process is to attract and mate with the female. The female is then responsible for choosing a nest location, generally on a low, small horizontal branch in a protected area. The nest is small and built from various plant materials, cobwebs, and down woven together to form a sturdy cup structure. Two small white eggs are laid within the nest and the female incubates them on her own. Incubation time is 14–18 days. Hatchlings are primarily fed insects due to high nutritional requirements. No information was found on the length of the nestling stage or age at fledgling.

References

  1. ^ BirdLife International (2012). "Colibri thalassinus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106001847. Retrieved 16 July 2012.
  2. ^ Hilty, S. L., and W. L. Brown. 1986. A guide to the birds of Colombia. Princeton University Press, Princeton, New Jersey.
  3. ^ Howell, S. N. G., and S. Webb 1995. A guide to the birds of Mexico and northern Central America. Oxford University Press, New York, New York.
  4. ^ Weske, J. S. 1972. The distribution of the avifauna in the Apurimac Valley of Peru with respect to environmental gradients, habitat, and related species. Ph.D. thesis, University of Oklahoma, Norman, Oklahoma.
  5. ^ Wetmore, A. 1968. The birds of the Republic of Panama. Part 2. Columbidae (pigeons) to Picidae (woodpeckers). Smithsonian Miscellaneous Collections volume 150, part 2. Smithsonian Institution Press, Washington, D.C.
  6. ^ Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. ISBN 978-0-85112-235-9. 
  • Ridgely, Robert S. & Greenfield, Paul J. (2001): The Birds of Ecuador: Field Guide. Cornell University Press, Ithaca, New York. ISBN 0-8014-8721-8
  • Ridgely, Robert S. & Greenfield, Paul J. (2001): The Birds of Ecuador: Status, Distribution, and Taxonomy. Cornell University Press, Ithaca, New York. ISBN 0-8014-8720-X
  • Restall, Robin (2007): Birds of Northern South America: An Identification Guide. Yale University Press, New Haven and London. ISBN 978-0-300-10862-0
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!