Articles on this page are available in 1 other language: Spanish (8) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Colibri thalassinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTGTACTTAATTTTTGGCGCGTGGGCCGGAATAGTTGGAACCGCCCTCAGCCTGCTAATTCGAGCAGAGCTCGGCCAGCCAGGCACCCTTCTCGGAGACGACCAGATCTACAACGTAATTGTCACCGCCCATGCCTTCGTAATAATCTTCTTCATGGTTATGCCCATTATAATCGGGGGGTTCGGAAACTGACTGATCCCGCTCATAATTGGAGCTCCCGACATAGCATTCCCCCGTATAAACAATATAAGCTTCTGACTCCTACCGCCGTCGTTCCTCCTTCTTCTCGCCTCCTCTACAGTGGAAGCAGGCGCAGGCACAGGATGAACTGTGTACCCGCCCCTAGCTGGCAACCTGGCCCACGCAGGCGCATCAGTAGACCTAGCCATCTTCTCCCTTCACTTATCGGGTATTTCATCCATCCTGGGGGCAATCAACTTTATTACTACTGCAATTAACATAAAACCACCCGCTCTATCACAATACCAAACCCCCCTATTCGTCTGATCCGTTCTCATTACCGCCGTACTACTCCTCCTCTCTCTCCCAGTGCTTGCCGCAGGGATTACAATATTGCTCACAGACCGAAATCTAAACACCACATTCTTCGACCCAGCCGGAGGGGGTGACCCTATCCTATACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Colibri thalassinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend is not known, but the population is not believed to be decreasing sufficiently rapidly to approach the thresholds under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 500,000-4,999,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Green violetear

The green violetear (Colibri thalassinus) is a medium-sized, metallic green hummingbird species commonly found in forested areas from Mexico to northern South America.

Male displaying his "ears"

Taxonomy[edit]

At a feeder in Savegre, Costa Rica

The green violetear belongs to the order Apodiformes. Hummingbirds share this order with the swifts, such as the white-collared swift. The name Apodiformes is derived from the Greek words "a pous," meaning "without foot." While apodiforms do in fact have feet, they are quite small and their legs are short and relatively weak. Many birds in this order cannot walk, and thus rarely if ever land on the ground since quick escape from predators is virtually impossible. For this reason members of this order spend a majority of their time in the air.

The violetear genus (Colibri) includes three other species: sparkling violetear, brown violetear, and white-vented violetear. The green and sparkling violetears are similar in appearance and overlap in range but are generally found at different altitudes and in different habitats. These four hummingbirds are characterized by their violet ear patches. In all four species there is no strong sexual dimorphism.

Description[edit]

In flight

Physical[edit]

The green violetear is roughly medium-sized by hummingbird standards. It averages around 9.7 to 12 cm (3.8 to 4.7 in) in total length. Its bill is black and mostly straight with only a slight downward curve and measures from 1.8 to 2.5 cm (0.71 to 0.98 in).[2][3] The body mass can vary from 4.8 to 5.6 g (0.17 to 0.20 oz).[4] Among standard measurements, the wing chord is 5.8 to 6.8 cm (2.3 to 2.7 in) and the tail is 3.5 to 4.3 cm (1.4 to 1.7 in).[5] It is shining green above with a glittering violet ear-patch on the sides of its neck. Its throat and chest are a more glittering green with a shining green belly. The tail is a metallic blue-green with more bronzy central feathers and a prominent black subterminal band.

Vocalizations[edit]

Solitary males sing from high, exposed twigs in their territory every day. Their song is a monotonously repeated sharp and dry “tsu-tzeek” at a rate of about one call per second.

Distribution and habitat[edit]

Distribution[edit]

The green violetear breeds from the highlands of southern Mexico south to Honduras; the highlands of Costa Rica and western Panama; mountains of northern Venezuela, and the Andes from western Venezuela to western Bolivia. It is a rare but annual nonbreeding visitor to the United States, primarily southern and central Texas, with scattered records as far north as extreme southern Canada.[6]

Habitat[edit]

Common habitats for the green violetear is in the canopy and borders of subtropical and lower temperate forest, secondary woodland and scrub, and clearings and gardens in the subtropical zone on both slopes of the Andes. It is recorded mostly between altitudes of 1,200 to 2,300 m (3,900 to 7,500 ft), though they will sometimes wander as far down as 500 m (1,600 ft) in search of food sources. It generally prefers more humid and high-altitude areas, such as cloud forests, than the similar sparkling violetear and is completely absent from the central valley where the sparkling violetear is most prevalent. However, the two species will sometimes be seen in the same areas feeding at flowering Inga trees.

Behavior[edit]

Diet[edit]

A green violetear in hand

The green violetear forages alone but tends to gather at flowering trees, especially coffee-shade Inga. They feed at mid-level to canopy and often hold and defend a feeding territory. They primarily feed on nectar and small insects. The green violetear has been recorded as attaining the greatest flying speed ever recorded for a hummingbird, with a pair of birds having attained 90 mph (140 km/h) during a chase, although other species may be able to attain similar speeds.[7]

Breeding[edit]

Like most hummingbirds, the green violetear is a solitary nester. The male’s only involvement in the breeding process is to attract and mate with the female. The female is then responsible for choosing a nest location, generally on a low, small horizontal branch in a protected area. The nest is small and built from various plant materials, spider webs, and down woven together to form a sturdy cup structure. Two small white eggs are laid within the nest and the female incubates them on her own. Incubation time is 14–18 days. Hatchlings are primarily fed insects due to high nutritional requirements. No information was found on the length of the nestling stage or age at fledgling. Breeding takes place though the wet season into the early dry season, which varies by latitude.[8]

Migration[edit]

Seasonal movements of the green violetear are not well understood. Many individuals of northern populations move south or and/or to lower elevations following the end of the breeding season (July to November in Mexico), but regular occurrence hundreds of kilometres north of this range suggests a more complex migration strategy.[8][6]

References[edit]

  1. ^ BirdLife International (2012). "Colibri thalassinus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Hilty, S.L.; Brown, W.L. (1986). A Guide to the Birds of Colombia. Princeton, New Jersey: Princeton University Press. ISBN 978-0691083728. 
  3. ^ Howell, S.N.G.; Webb, S. (1995). A Guide to the Birds of Mexico and Northern Central America. New York, New York: Oxford University Press. ISBN 978-0198540120. 
  4. ^ Weske, J.S. (1972). The distribution of the avifauna in the Apurimac Valley of Peru with respect to environmental gradients, habitat, and related species (Ph.D.). Norman, Oklahoma: University of Oklahoma. 
  5. ^ Wetmore, A. (1968). The Birds of the Republic of Panama. Part 2. Columbidae (pigeons) to Picidae (woodpeckers). Smithsonian Miscellaneous Collections. vol. 150, part 2. Washington, D.C.: Smithsonian Institution Press. 
  6. ^ a b Williamson, Sheri (2001). A Field Guide to Hummingbirds of North America. New York, NY: Houghton Mifflin Harcourt. p. 199. ISBN 0-618-02496-4. 
  7. ^ Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. ISBN 978-0-85112-235-9. 
  8. ^ a b Hobbs, Mo; Arizmendi, M.C.; Rodríguez-Flores, C.; Soberanes-González, C. (2011). "Green Violetear (Colibri thalassinus)". In Schulenberg, T.S. Neotropical Birds Online. Ithaca: Cornell Lab of Ornithology. 
  • Ridgely, Robert S.; Greenfield, Paul J. (2001). The Birds of Ecuador: Field Guide. Ithaca, New York: Cornell University Press. ISBN 0-8014-8721-8. 
  • Ridgely, Robert S.; Greenfield, Paul J. (2001). The Birds of Ecuador: Status, Distribution, and Taxonomy. Ithaca, New York: Cornell University Press. ISBN 0-8014-8720-X. 
  • Restall, Robin (2007). Birds of Northern South America: An Identification Guide. New Haven and London: Yale University Press. ISBN 978-0-300-10862-0. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!