Articles on this page are available in 2 other languages: Chinese (Simplified) (12), Dutch (1) (learn more)

Overview

Brief Summary

Description

When the poet Percy Bysshe Shelley wrote of the skylark 'Hail to thee, blithe spirit, bird thou never were't', he may well have had the exalted song of this species in mind. On a warm summer day, the sky can seem full of birdsong as the skylark seems to hang suspended somewhere overhead. This territorial display can last for as long as five minutes as the bird reaches the zenith of its flight and then slowly descends. The sexes are alike and the birds are streaky brown on the back and buff-white below with dark-brown streaking on the upper breast. The tail is brown with outer-tail feathers of white. There is a small up-turned crest on the back of the head, visible only when raised
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

There is no bird that sings for such a long time and from such a great height as the sky lark. Sky larks breed in open areas with low growth. In the Netherlands, this means grasslands, heath fields, salt marshes and dunes. The breeding season begins in April and ends in July. In this period, they can raise as many as four nests. In the autumn, a percentage of the Dutch breeding birds migrate to southern Europe, while sky larks breeding in more northerly regions spend the winter in the Netherlands. However if it freezes, they too will depart for the south.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The skylark nests between April and August, and successful pairs may raise up to four broods in one breeding season. Three to five eggs are laid, incubated by the female for 11 days. The nest is always on the ground, and is usually very well concealed within vegetation. The young birds leave the nest when 8 - 10 days old, but remain dependant on their parents for a further 1 - 2 weeks. The male performs his song flights throughout the breeding season. In winter, skylarks move away from upland areas, but large flocks occur on lowland farmland, often in conjunction with other species such as meadow pipits. Stubble fields provide the most important winter food source but set-aside can be useful, particularly if cereal stubbles are in short supply.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Skylarks are native to North Africa, Asia, and Europe. British populations do not migrate, but populations from eastern Asia migrate to southeastern China and populations in the eastern Palearctic migrate to the northern Mediterranean. Skylarks have been introduced to Australia, Canada, Hawaii, and New Zealand.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); australian (Introduced ); oceanic islands (Introduced ); pacific ocean (Introduced )

  • Grzimek, B. 2003. Family: Larks. Pp. 353-354 in M Hutchins, ed. Grzimek's Encyclopedia of Animals, Vol. 2, 2nd Edition. Detroit: Gale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: British Isles, Scandinavia, northern Russia, and northern Siberia south to northwestern Africa, northern Mediterranean, Asia Minor, northern China, Korea, and Japan. NON-BREEDING: from breeding range south to northern Africa, Persian Gulf, and eastern China. INTRODUCED: established in Australia, New Zealand, Hawaii (all main islands; most abundant on Hawaii, Maui, and Lanai), and British Columbia (Vancouver Island). Recently spread to mainland of British Columbia and to San Juan Islands, Washington (AOU 1983)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The skylark's breeding range covers all of Europe and the temperate zone of Asia as far east as Japan and the Kamchatka peninsular. Breeding birds are mainly resident in the UK, although numbers are swelled in winter by visitors from the continent. Although breeding skylarks have declined by more than 50% over the last 25 years, the bird is still widespread in the UK, in both the uplands and lowlands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The sexes are alike in the plumage, but males are slightly larger. Skylarks usually range in size from 18-19 cm. They have a wing-span of 30-36 cm. Females of the species can weight 17-47 g, while males can weigh 27-55 g. Their bills are short but strong. Skylarks generally have streaked black-brown plumage, some have a yellow or grey overall tone. Their underside is a buff-white. Skylarks have brown-streaked crown feathers that can be raised to a small crest.

Range mass: 17 to 55 g.

Range length: 18 to 19 cm.

Range wingspan: 30 to 36 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 0.722 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 18 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Skylarks live in areas of open country. They are generally found living in extensive croplands, marshes, or meadows. They prefer to live among cereal grasses or low green herbage. Skylarks avoid wooded areas, even areas with isolated trees seem to be unsuitable. Skylarks feed, nest, and do most other activities on the ground.

Range elevation: 1000 (high) m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland

Wetlands: marsh

Other Habitat Features: agricultural

  • Jonsson, L. 1992. Birds of Europe with North America and the Middle East. London: A & C Black.
  • Cramp, S. 1988. Alauda arvensis. Pp. 188-205 in S Cramp, ed. Handbook of the birds of Europe, the Middle East, and North Africa:the birds of the Western Palearctic, Vol. V, 1 Edition. Oxford: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 36 specimens in 1 taxon.
Water temperature and chemistry ranges based on 28 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.803 - 11.597
  Nitrate (umol/L): 1.227 - 10.807
  Salinity (PPS): 5.715 - 35.226
  Oxygen (ml/l): 6.271 - 8.295
  Phosphate (umol/l): 0.231 - 0.640
  Silicate (umol/l): 2.022 - 12.889

Graphical representation

Temperature range (°C): 7.803 - 11.597

Nitrate (umol/L): 1.227 - 10.807

Salinity (PPS): 5.715 - 35.226

Oxygen (ml/l): 6.271 - 8.295

Phosphate (umol/l): 0.231 - 0.640

Silicate (umol/l): 2.022 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Open country, grasslands, tundra, marshy and sandy areas, and wide forest clearings (AOU 1983). BREEDING: Nests in a shallow depression on the ground, lined with roots, grasses, and hair.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Skylarks utilise a wide range of open habitats including saltmarsh and coastal grazing land, arable farmland and rough grazing in the uplands. The majority of foraging is carried out in short vegetation and once crops reach a certain height in summer, they become less suitable for skylarks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Skylarks are omnivores that eat seeds and insects. Skylarks are known to eat weed seeds and waste grain. They also eat invertebrates such as beetles, caterpillars, spiders, millipedes, earthworms, and slugs. They forage on the ground, searching for food visually.

Animal Foods: insects; terrestrial non-insect arthropods; mollusks; terrestrial worms

Plant Foods: seeds, grains, and nuts

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds on seeds, grains, and small invertebrates (including: insects, spiders, earthworms, slugs, and millipedes) (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Skylarks eat pests such as caterpillars and weed seeds that are detrimental to crops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Small falcons (Falco) prey on adult skylarks, but these predators are not common. Nestlings and eggs are taken by ground-dwelling predators, such as foxes (Vulpes) and snakes (Serpentes). Humans used to prey upon these birds, capturing them in clap-nets and selling them. This greatly reduced their numbers, but the practice has since been prohibited in England. Skylarks are cryptically colored, helping to camouflage them as they search for prey on the ground.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

During winter, gathers into feeding flocks that may include > 100 individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Male skylarks are more vocal than females. Skylarks are known for the complex songs employed by males. Song flight usually begins with a silent ascent. When they reach an altitude of 50-100 m they begin to hover and circle over territory while continuing to sing. They then begin a spiral descent and cease to sing once 10-20 m are reached. The song itself consists of loud, trli or dji whistles in varying pitch patterns. Frequent repetition occurs as well as trills and tremolos with varying speed, pitch, length, and timbre. Skylarks may also sing on the ground with much the same singing pattern but often quieter, shorter, and consisting of more warbling and pauses.

Skylarks also communicate through a dry chirrup, prriee and prreet call.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The annual mortality rate for adult skylarks was measured as 33.5% in England. One skylark was documented as living to 8 years 5 months old.

Range lifespan

Status: wild:
10.2 (high) years.

Average lifespan

Status: captivity:
10.1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Male skylarks sing throughout the day, starting in the dawn hours. The song is mostly heard February through July, but a more faint song can be heard throughout the rest of the year. They usually begin their song after flying into the air 10-20 m. They then progress to flying 50-100 m up, then slowly spiral down with periods of hovering in the air. This can proceed for 10-15 minutes. The song itself usually consists of singing trills and cadenzas along with babbling and mimicry. It is used as a display to attract females.

Skylarks pair early in the year between April and July. Courting may include high-speed chases in the air and their renowned singing behaviors. The birds are monogamous but only about half of mating pairs remain together after a year.

Mating System: monogamous ; cooperative breeder

Skylark nests are often found near short vegetation and consist of a shallow depression in the ground. The depression is lined with stems and leaves, and the inner part is lined with finer materials like hair. The nest is built primarily by the female, although the male may help to form the depression in the ground. Skylarks lay 3-4, sometimes 5, eggs.

Breeding interval: Skylarks breed once yearly.

Breeding season: Skylarks breed from April to July.

Range eggs per season: 3 to 5.

Range time to hatching: 11 to 15 days.

Average time to hatching: 11 days.

Range fledging age: 8 to 10 days.

Average time to independence: 25 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 3.

Females build the nest with little help from males. Once the young are hatched both parents care for them. Adults gather food for the young by making a pile of insects on the ground. When enough insects are collected, they are carried away to young and the soft parts are fed to them. Females incubate eggs for a period of 11-14 days. Both males and females protect the nest. Hatchlings leave the nest between 8-10 days after they hatch. Skylarks often have two, and sometimes three, broods each season.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Protecting: Male, Female)

  • Bannerman, D. 1953. Skylark. Pp. 33-40 in The Birds of the British Isles, Vol. 11. Edinburgh: Oliver and Boyd.
  • Bruun, B., H. Delin, L. Svensson. 1992. Birds of Britain and Europe. London: Hamlyn.
  • Jonsson, L. 1992. Birds of Europe with North America and the Middle East. London: A & C Black.
  • Cramp, S. 1988. Alauda arvensis. Pp. 188-205 in S Cramp, ed. Handbook of the birds of Europe, the Middle East, and North Africa:the birds of the Western Palearctic, Vol. V, 1 Edition. Oxford: Oxford University Press.
  • Grzimek, B. 2003. Family: Larks. Pp. 353-354 in M Hutchins, ed. Grzimek's Encyclopedia of Animals, Vol. 2, 2nd Edition. Detroit: Gale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size 3-4. Incubation 11-12 days, by female. Nestlings altricial and downy, tended by both adults, leave nest about 9-10 days after hatching, may not fly until about 21 days old (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alauda arvensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTCTCCAACCCACAAAGACATTGGCACACTCTACCTAATCTTCGGCGCATGAGCCGGAATGGTGGGTACTGCCCTAAGCCTTCTCATCCGAGCAGAGCTGGGCCAACCCGGCGCCCTGCTGGGAGACGACCAAATTTATAACGTAGTCGTTACAGCCCATGCCTTCGTAATAATCTTCTTTATAGTCATGCCGATTATGATCGGAGGTTTCGGAAACTGACTAGTTCCCCTAATAATCGGTGCACCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTACCACCATCCTTCCTTCTCCTACTAGCCTCCTCCACAGTAGAAACAGGCGCAGGAACAGGCTGAACAGTCTACCCCCCACTGGCCGGCAATCTAGCCCACGCCGGAGCCTCAGTCGACCTGGCCATCTTCTCCCTACATCTAGCAGGTATTTCATCAATCCTGGGGGCTATCAATTTCATCACCACAGCCATCAACATAAAACCACCTGCCCTCTCCCAATACCAAACGCCCCTGTTCGTATGATCAGTCCTGATCACTGCCGTTCTCCTACTCCTCTCCCTCCCCGTCTTAGCTGCTGGTATTACCATGCTTCTCACCGATCGCAACCTTAATACCACTTTCTTCGACCCCGCAGGCGGAGGAGACCCAGTACTCTACCAACACCTATTCTGATTCTTCGGCCACCCAGAGGTCTACATCCTAATCCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Alauda arvensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 27
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The population size of skylarks introduced in North America is declining due to development in their habitats. Skylarks in Europe, Asia, Australia, New Zealand, and Hawaii are stable. In some areas agricultural practices, and loss of open grasslands and farmlands does threaten skylark populations.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Winter visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: N1B - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Protected under the Wildlife and CountrysideAct (1981), as amended and the Wildlife (Northern Ireland) Order 1985. Listed under the EC Birds Directive
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 40000000-80000000 breeding pairs, equating to 120000000-240000000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 245000000-960000000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The move to more intensive farming methods is thought to be the main cause of the decline in the skylark. The chief reason is the move from spring to autumn sown crops because, in spring, these crops quickly become too tall and dense for skylarks. Crops sown in spring are still short and thin enough to provide suitable nesting and foraging habitat. Autumn sowing has led to a decline in stubble fields available during the winter months and so reduced the availability of grain and weed seeds. Increasing use of agri-chemicals has reduced the invertebrate populations on which the birds depend for food in the breeding season.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Despite a substantial reduction in population size, the distribution of the skylark has remained fairly constant and the species is still one of our most widespread and familiar birds. The skylark is the subject of an action plan managed by the Royal Society for the Protection of Birds (RSPB), with other partners including English Nature, the British Trust for Ornithology and the Joint Nature Conservancy Council (JNCC). The objectives of the plan are to stabilise the skylark population, and maintain the present breeding numbers of around 2 million pairs. The plan aims to achieve this by encouraging more environmentally friendly methods of farming, including a reduction in the use of agrichemicals. Reform of the Common Agricultural Policy (CAP) is required, however, if these targets are to be met. The RSPB is currently trialling a project to encourage farmers to leave 'scrapes', or bare patches, when drilling crops in autumn, to improve the spring nesting conditions for skylarks. These 'scrapes' would be made by lifting the seed drill, so that the sward height preferred by the birds would be achieved. These potential nesting sites would be created away from the vehicle access 'tramlines' and the edge of the field, as these tend to be patrolled by potential ground predators.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Skylarks are known to ravage spring cabbage plants and consume corn and other crops cultivated by humans. The advantage of skylarks consuming pests and weed seeds outweighs the disadvantage of their taste for certain crops.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Skylarks consume the seeds of weeds and detrimental plants as well as detrimental insects. This is advantageous to farmers.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eurasian Skylark

The Eurasian Skylark (Alauda arvensis) is a small passerine bird species. This lark breeds across most of Europe and Asia and in the mountains of north Africa. It is mainly resident in the west of its range, but eastern populations are more migratory, moving further south in winter. Even in the milder west of its range, many birds move to lowlands and the coast in winter. Asian birds appear as vagrants in Alaska; this bird has also been introduced in Hawaii, western North America, eastern Australia and New Zealand.

Contents

Description

Skylark

The Eurasian Skylark is 16 to 18 centimetres long. It is a bird of open farmland and heath, known throughout its range for the song of the male, which is delivered in hovering flight from heights of 50 to 100 m, when the singing bird may appear as just a dot in the sky from the ground. The song generally lasts two to three minutes, but it tends to last longer later in the mating season. The male has broader wings than the female. This adaptation for more efficient hovering flight may have evolved because of female Eurasian Skylarks' preference for males that sing and hover for longer periods and so demonstrate that they are likely to have good overall fitness.

Like most other larks, the Eurasian Skylark is a rather dull-looking species on the ground, being mainly brown above and paler below. It has a short blunt crest on the head, which can be raised and lowered. In flight it shows a short tail and short broad wings. The tail and the rear edge of the wings are edged with white, which are visible when the bird is flying away, but not if it is heading towards the observer. The Eurasian Skylark has sturdy legs and spends much time on the ground foraging for seeds, supplemented with insects in the breeding season.

The Eurasian Skylark makes a grass nest on the ground, hidden amongst vegetation. It is sometimes found nesting in bracken, using it for cover. Generally the nests are very difficult to find. Three to six eggs are laid in June. A second or third brood may be started later in the year. The eggs are yellow/white with brownish/purple spots mainly at the large end.

Effects of UK agriculture

A Eurasian Skylark in the Lake District, England, with two beetles caught in its beak

In the UK, Eurasian Skylark numbers have declined over the last 30 years, as determined by the Common Bird Census started in the early 1960s by The British Trust for Ornithology. There are now only 10% of the numbers that were present 30 years ago. The RSPB have shown that this massive decline is mainly due to changes in farming practices and only partly due to pesticides. In the past cereals were planted in the spring, grown through the summer and harvested in the early autumn. Cereals are now planted in the autumn, grown through the winter and are harvested in the early summer. The winter grown fields are much too dense in summer for the Eurasian Skylark to be able to walk and run between the wheat stems to find its food.

English farmers are now encouraged and paid to maintain and create biodiversity for improving the habitat for Eurasian Skylarks. Natural England's Environmental Stewardship Scheme offers 5 and 10 year grants for various beneficial options. For example there is an option where the farmer can opt to grow a spring cereal instead of a winter one, and leave the stubble untreated with pesticide over the winter. The British Trust for Ornithology likens the stubbles to 'giant bird tables' – providing spilt grain and weed seed to foraging birds.[2]

The RSPB's research, over a six-year period, of winter-planted wheat fields has shown that suitable nesting areas for Eurasian Skylarks can be made by turning the seeding machine off (or lifting the drill) for a 5 to 10 metres stretch as the tractor goes over the ground to briefly stop the seeds being sown. This is repeated in several areas within the same field to make about two skylark plots per hectare. Subsequent spraying and fertilising can be continuous over the entire field. DEFRA suggests that Eurasian Skylark plots should not be nearer than 24 m to the perimeter of the field, should not be near to telegraph poles, and should not be enclosed by trees!

When the crop grows, the Eurasian Skylark plots (areas without crop seeds) become areas of low vegetation where Eurasian Skylarks can easily hunt insects, and can build their well camouflaged ground nests. These areas of low vegetation are just right for Skylarks, but the wheat in the rest of the field becomes too closely packed and too tall for the bird to seek food. At the RSPB's research farm in Cambridgeshire Skylark numbers have increased threefold (from 10 pairs to 30 pairs) over six years. Fields where Eurasian Skylarks were seen the year before (or nearby) would be obvious good sites for Skylark plots. Farmers have reported that skylark plots are easy to make and the RSPB hope that this simple effective technique can be copied nationwide.

In culture

When the word "lark" is used without specification, it usually refers to this species (OED). A collective noun for Eurasian Skylarks is an "exaltation". Although the OED describes this usage as "fanciful", it traces it back to a quotation from John Lydgate dating from about 1430. The verb "skylark", originally used by sailors, means "play tricks or practical jokes; indulge in horseplay, frolic". The verb and noun "lark", with similar meaning, may be related to "skylark" or to the dialect word "laik" (New Shorter OED).

The bird is the subject of poems by Percy Bysshe Shelley ("To a Sky-Lark"), Ted Hughes ("Skylarks"), and numerous others; and of pieces of music including The Lark Ascending by Ralph Vaughan Williams.

References

Further reading

Identification

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly named "Eurasian skylark" (see AOU 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!