Articles on this page are available in 2 other languages: Chinese (Simplified) (12), Dutch (1) (learn more)

Overview

Brief Summary

Description

When the poet Percy Bysshe Shelley wrote of the skylark 'Hail to thee, blithe spirit, bird thou never were't', he may well have had the exalted song of this species in mind. On a warm summer day, the sky can seem full of birdsong as the skylark seems to hang suspended somewhere overhead. This territorial display can last for as long as five minutes as the bird reaches the zenith of its flight and then slowly descends. The sexes are alike and the birds are streaky brown on the back and buff-white below with dark-brown streaking on the upper breast. The tail is brown with outer-tail feathers of white. There is a small up-turned crest on the back of the head, visible only when raised
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

There is no bird that sings for such a long time and from such a great height as the sky lark. Sky larks breed in open areas with low growth. In the Netherlands, this means grasslands, heath fields, salt marshes and dunes. The breeding season begins in April and ends in July. In this period, they can raise as many as four nests. In the autumn, a percentage of the Dutch breeding birds migrate to southern Europe, while sky larks breeding in more northerly regions spend the winter in the Netherlands. However if it freezes, they too will depart for the south.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

The skylark nests between April and August, and successful pairs may raise up to four broods in one breeding season. Three to five eggs are laid, incubated by the female for 11 days. The nest is always on the ground, and is usually very well concealed within vegetation. The young birds leave the nest when 8 - 10 days old, but remain dependant on their parents for a further 1 - 2 weeks. The male performs his song flights throughout the breeding season. In winter, skylarks move away from upland areas, but large flocks occur on lowland farmland, often in conjunction with other species such as meadow pipits. Stubble fields provide the most important winter food source but set-aside can be useful, particularly if cereal stubbles are in short supply.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur 18-19 cm, envergure 30-36 cm, poids moyen 26-50 g.

Elle habite les terrains ouverts plus ou moins recouverts par la végétation herbacée, en particulier les cultures de céréales, mais aussi les friches, les prairies sèches, les lieux incultes en zone rurale...

L’Alouette des champs se nourrit plutôt d’insectes en été, de graines de céréales et plantes sauvages aux autres saisons.

Elle vit en groupe en dehors de la saison des nids, en général quelques dizaines mais parfois plusieurs centaines d’oiseaux. L’espèce est monogame (rares cas de bigamie) et la fidélité du couple est régulière d’une année sur l’autre. Elle est territoriale et chante depuis le sol, sur un perchoir ou en vol. Le vol nuptial comporte plusieurs phases, la plus longue correspondant à un vol sur place. Le chant émis pendant la phase ascendante caractérise les périodes de formation des couples et de disputes territoriales. La parade aérienne dure en moyenne 2 minutes, mais des temps exceptionnels de 20 minutes sont rapportés.

Le nid est installé à découvert ou au pied d’une touffe. C’est une simple dépression garnie de feuilles et tiges de graminées, parfois protégée par des cailloux. La ponte de 3 à 5 œufs (maximum 7) débute à la fin mars. Il peut y avoir jusqu’à 4 couvées. L’incubation dure 11 jours et les jeunes s’envolent à l’âge de 18-20 jours, ayant quitté le nid 10 jours avant.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Skylarks are native to North Africa, Asia, and Europe. British populations do not migrate, but populations from eastern Asia migrate to southeastern China and populations in the eastern Palearctic migrate to the northern Mediterranean. Skylarks have been introduced to Australia, Canada, Hawaii, and New Zealand.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); australian (Introduced ); oceanic islands (Introduced ); pacific ocean (Introduced )

  • Grzimek, B. 2003. Family: Larks. Pp. 353-354 in M Hutchins, ed. Grzimek's Encyclopedia of Animals, Vol. 2, 2nd Edition. Detroit: Gale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) BREEDING: British Isles, Scandinavia, northern Russia, and northern Siberia south to northwestern Africa, northern Mediterranean, Asia Minor, northern China, Korea, and Japan. NON-BREEDING: from breeding range south to northern Africa, Persian Gulf, and eastern China. INTRODUCED: established in Australia, New Zealand, Hawaii (all main islands; most abundant on Hawaii, Maui, and Lanai), and British Columbia (Vancouver Island). Recently spread to mainland of British Columbia and to San Juan Islands, Washington (AOU 1983)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The skylark's breeding range covers all of Europe and the temperate zone of Asia as far east as Japan and the Kamchatka peninsular. Breeding birds are mainly resident in the UK, although numbers are swelled in winter by visitors from the continent. Although breeding skylarks have declined by more than 50% over the last 25 years, the bird is still widespread in the UK, in both the uplands and lowlands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The sexes are alike in the plumage, but males are slightly larger. Skylarks usually range in size from 18-19 cm. They have a wing-span of 30-36 cm. Females of the species can weight 17-47 g, while males can weigh 27-55 g. Their bills are short but strong. Skylarks generally have streaked black-brown plumage, some have a yellow or grey overall tone. Their underside is a buff-white. Skylarks have brown-streaked crown feathers that can be raised to a small crest.

Range mass: 17 to 55 g.

Range length: 18 to 19 cm.

Range wingspan: 30 to 36 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 0.722 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 18 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 36 specimens in 1 taxon.
Water temperature and chemistry ranges based on 28 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.803 - 11.597
  Nitrate (umol/L): 1.227 - 10.807
  Salinity (PPS): 5.715 - 35.226
  Oxygen (ml/l): 6.271 - 8.295
  Phosphate (umol/l): 0.231 - 0.640
  Silicate (umol/l): 2.022 - 12.889

Graphical representation

Temperature range (°C): 7.803 - 11.597

Nitrate (umol/L): 1.227 - 10.807

Salinity (PPS): 5.715 - 35.226

Oxygen (ml/l): 6.271 - 8.295

Phosphate (umol/l): 0.231 - 0.640

Silicate (umol/l): 2.022 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Skylarks live in areas of open country. They are generally found living in extensive croplands, marshes, or meadows. They prefer to live among cereal grasses or low green herbage. Skylarks avoid wooded areas, even areas with isolated trees seem to be unsuitable. Skylarks feed, nest, and do most other activities on the ground.

Range elevation: 1000 (high) m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland

Wetlands: marsh

Other Habitat Features: agricultural

  • Cramp, S. 1988. Alauda arvensis. Pp. 188-205 in S Cramp, ed. Handbook of the birds of Europe, the Middle East, and North Africa:the birds of the Western Palearctic, Vol. V, 1 Edition. Oxford: Oxford University Press.
  • Jonsson, L. 1992. Birds of Europe with North America and the Middle East. London: A & C Black.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Open country, grasslands, tundra, marshy and sandy areas, and wide forest clearings (AOU 1983). BREEDING: Nests in a shallow depression on the ground, lined with roots, grasses, and hair.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 36 specimens in 1 taxon.
Water temperature and chemistry ranges based on 28 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.803 - 11.597
  Nitrate (umol/L): 1.227 - 10.807
  Salinity (PPS): 5.715 - 35.226
  Oxygen (ml/l): 6.271 - 8.295
  Phosphate (umol/l): 0.231 - 0.640
  Silicate (umol/l): 2.022 - 12.889

Graphical representation

Temperature range (°C): 7.803 - 11.597

Nitrate (umol/L): 1.227 - 10.807

Salinity (PPS): 5.715 - 35.226

Oxygen (ml/l): 6.271 - 8.295

Phosphate (umol/l): 0.231 - 0.640

Silicate (umol/l): 2.022 - 12.889
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Skylarks utilise a wide range of open habitats including saltmarsh and coastal grazing land, arable farmland and rough grazing in the uplands. The majority of foraging is carried out in short vegetation and once crops reach a certain height in summer, they become less suitable for skylarks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Skylarks are omnivores that eat seeds and insects. Skylarks are known to eat weed seeds and waste grain. They also eat invertebrates such as beetles, caterpillars, spiders, millipedes, earthworms, and slugs. They forage on the ground, searching for food visually.

Animal Foods: insects; terrestrial non-insect arthropods; mollusks; terrestrial worms

Plant Foods: seeds, grains, and nuts

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Feeds on seeds, grains, and small invertebrates (including: insects, spiders, earthworms, slugs, and millipedes) (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Skylarks eat pests such as caterpillars and weed seeds that are detrimental to crops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Small falcons (Falco) prey on adult skylarks, but these predators are not common. Nestlings and eggs are taken by ground-dwelling predators, such as foxes (Vulpes) and snakes (Serpentes). Humans used to prey upon these birds, capturing them in clap-nets and selling them. This greatly reduced their numbers, but the practice has since been prohibited in England. Skylarks are cryptically colored, helping to camouflage them as they search for prey on the ground.

Known Predators:

  • small falcons (Falco)
  • foxes (Vulpes)
  • snakes (Serpentes)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

During winter, gathers into feeding flocks that may include > 100 individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Male skylarks are more vocal than females. Skylarks are known for the complex songs employed by males. Song flight usually begins with a silent ascent. When they reach an altitude of 50-100 m they begin to hover and circle over territory while continuing to sing. They then begin a spiral descent and cease to sing once 10-20 m are reached. The song itself consists of loud, trli or dji whistles in varying pitch patterns. Frequent repetition occurs as well as trills and tremolos with varying speed, pitch, length, and timbre. Skylarks may also sing on the ground with much the same singing pattern but often quieter, shorter, and consisting of more warbling and pauses.

Skylarks also communicate through a dry chirrup, prriee and prreet call.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The annual mortality rate for adult skylarks was measured as 33.5% in England. One skylark was documented as living to 8 years 5 months old.

Range lifespan

Status: wild:
10.2 (high) years.

Average lifespan

Status: captivity:
10.1 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Male skylarks sing throughout the day, starting in the dawn hours. The song is mostly heard February through July, but a more faint song can be heard throughout the rest of the year. They usually begin their song after flying into the air 10-20 m. They then progress to flying 50-100 m up, then slowly spiral down with periods of hovering in the air. This can proceed for 10-15 minutes. The song itself usually consists of singing trills and cadenzas along with babbling and mimicry. It is used as a display to attract females.

Skylarks pair early in the year between April and July. Courting may include high-speed chases in the air and their renowned singing behaviors. The birds are monogamous but only about half of mating pairs remain together after a year.

Mating System: monogamous ; cooperative breeder

Skylark nests are often found near short vegetation and consist of a shallow depression in the ground. The depression is lined with stems and leaves, and the inner part is lined with finer materials like hair. The nest is built primarily by the female, although the male may help to form the depression in the ground. Skylarks lay 3-4, sometimes 5, eggs.

Breeding interval: Skylarks breed once yearly.

Breeding season: Skylarks breed from April to July.

Range eggs per season: 3 to 5.

Range time to hatching: 11 to 15 days.

Average time to hatching: 11 days.

Range fledging age: 8 to 10 days.

Average time to independence: 25 days.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 3.

Females build the nest with little help from males. Once the young are hatched both parents care for them. Adults gather food for the young by making a pile of insects on the ground. When enough insects are collected, they are carried away to young and the soft parts are fed to them. Females incubate eggs for a period of 11-14 days. Both males and females protect the nest. Hatchlings leave the nest between 8-10 days after they hatch. Skylarks often have two, and sometimes three, broods each season.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Protecting: Male, Female)

  • Bannerman, D. 1953. Skylark. Pp. 33-40 in The Birds of the British Isles, Vol. 11. Edinburgh: Oliver and Boyd.
  • Bruun, B., H. Delin, L. Svensson. 1992. Birds of Britain and Europe. London: Hamlyn.
  • Cramp, S. 1988. Alauda arvensis. Pp. 188-205 in S Cramp, ed. Handbook of the birds of Europe, the Middle East, and North Africa:the birds of the Western Palearctic, Vol. V, 1 Edition. Oxford: Oxford University Press.
  • Grzimek, B. 2003. Family: Larks. Pp. 353-354 in M Hutchins, ed. Grzimek's Encyclopedia of Animals, Vol. 2, 2nd Edition. Detroit: Gale.
  • Jonsson, L. 1992. Birds of Europe with North America and the Middle East. London: A & C Black.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clutch size 3-4. Incubation 11-12 days, by female. Nestlings altricial and downy, tended by both adults, leave nest about 9-10 days after hatching, may not fly until about 21 days old (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Alauda arvensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTCTCCAACCCACAAAGACATTGGCACACTCTACCTAATCTTCGGCGCATGAGCCGGAATGGTGGGTACTGCCCTAAGCCTTCTCATCCGAGCAGAGCTGGGCCAACCCGGCGCCCTGCTGGGAGACGACCAAATTTATAACGTAGTCGTTACAGCCCATGCCTTCGTAATAATCTTCTTTATAGTCATGCCGATTATGATCGGAGGTTTCGGAAACTGACTAGTTCCCCTAATAATCGGTGCACCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTACCACCATCCTTCCTTCTCCTACTAGCCTCCTCCACAGTAGAAACAGGCGCAGGAACAGGCTGAACAGTCTACCCCCCACTGGCCGGCAATCTAGCCCACGCCGGAGCCTCAGTCGACCTGGCCATCTTCTCCCTACATCTAGCAGGTATTTCATCAATCCTGGGGGCTATCAATTTCATCACCACAGCCATCAACATAAAACCACCTGCCCTCTCCCAATACCAAACGCCCCTGTTCGTATGATCAGTCCTGATCACTGCCGTTCTCCTACTCCTCTCCCTCCCCGTCTTAGCTGCTGGTATTACCATGCTTCTCACCGATCGCAACCTTAATACCACTTTCTTCGACCCCGCAGGCGGAGGAGACCCAGTACTCTACCAACACCTATTCTGATTCTTCGGCCACCCAGAGGTCTACATCCTAATCCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Alauda arvensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 43
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5