Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 17.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Perisoreus infaustus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 13
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Perisoreus infaustus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTGAGTCTCCTTATCCGAGCAGAACTAGGTCAACCCGGCGCCCTATTAGGAGACGACCAAATTTACAATGTAATCGTTACAGCTCACGCTTTTGTCATAATCTTCTTCATAGTTATGCCAATCATAATTGGAGGATTTGGAAACTGACTAGTGCCTCTAATAATCGGAGCCCCAGATATGGCATTCCCCCGAATAAACAACATGAGCTTCTGACTCCTTCCTCCTTCATTCCTCCTCCTTCTAGCCTCCTCCACAGTAGAAGCAGGAGCAGGGACAGGATGAACTGTGTACCCCCCACTAGCCGGCAACCTAGCCCATGCTGGCGCCTCAGTCGACCTGGCCATCTTTTCACTGCACCTAGCAGGTATCTCATCTATCCTAGGGGCAATCAACTTCATTACAACAGCAATCAACATAAAACCTCCAGCTCTATCACAATACCAAACTCCCCTATTTGTTTGATCCGTACTAATCACTGCAGTACTGCTTCTCCTCTCCCTTCCTGTTCTTGCTGCCGGAATTACTATGCTTCTAACAGATCGTAACCTCAACACTACCTTCTTCGACCCAGCAGGTGGAGGAGACCCAGTACTATACCAACACCTATTTTGATTCTTTGGTCACCCAGAAGTCTACATCCTAATTCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 340,000-710,000 breeding pairs, equating to 1,020,000-2,130,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 2,080,000-8,520,000 individuals, although further validation of this estimate is needed. National population sizes have been estimated at c.100-100,000 breeding pairs in China and c.100-100,000 breeding pairs in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Siberian jay

The Siberian jay (Perisoreus infaustus) is a jay found in north Eurasia. The species has a wide range (estimated global Extent of Occurrence 10,000,000 km²) and a large global population (estimated 680,000-1,400,000 in Europe). It is one of three members of the genus Perisoreus, the others being the Sichuan jay, P. internigrans, restricted to the mountains of eastern Tibet and northwestern Sichuan, and the gray jay, P. canadensis, restricted to the boreal forest and western montane regions of North America. All three species store food and live year-round on permanent territories in coniferous forests.

Gallery[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!