Articles on this page are available in 1 other language: Chinese (Simplified) (8) (learn more)

Overview

Brief Summary

Taxonomy

The typical jays of the genus Garrulus number only 3 species. The Eurasian jay is polytypic and has an extensive range, while the other two, Lanceolated jay and Lidth’s jay, have relatively tiny ranges. They are characterized by similar and undoubtedly homologous blue-and-black barred feathers on the wings and/or tail. Also by traces of similar barring on the head feathers in most cases, and a strong resemblance in movements, ecology and voice.They appear most closely related on one hand to the green and blue magpies of the genus Cissa and on the other to the boreal jays of the genus Perisoreus, to which they seem to be linked by the Sooty jay P. internigrans. Over the greater part of their combined ranges the species of Garullus are completely allopatric but the Eurasian jay and the Lanceolated jay overlap in the Western Himalayas.The Eurasian jay has a much more extensive range than either of its congeners. Within its range it shows considerable geographic variation. Some populations now appear to be completely isolated from their nearest relatives by sea or unsuitable terrain. As, however, at least as far as their taxonomic characters are concerned, the most divers forms are connected by intergrades and no instance is known of two forms coming together and not interbreeding to form a mixed population, they seem best all treated as members of a single polytypic species.Within each major group of the more diverse forms, numerous races (or one might better say micro-races) of the jay have been named and recognized. Sometimes, it seems, those who have done so had an ability to recognize geographical variation in inverse relation to their ability to recognize individual variation. However, the numerous races within the species can be divided in five comprehensive major racial groups.

Glandarius group
  • Crown of head streaked or black
  • White patch on secondaries
  • Cheeks white or brownish
  • Irides usually purplish, mauve or bluish but sometimes dark
  • Range: Europe, western Asia and north-western Africa


Brandtii group
  • Crown of head streaked
  • Head and neck rufous, contrasting with the greyish back
  • White patch on secondaries
  • Bill tending to be rather smaller than in glandarius group
  • Range: north-eastern Russia through Siberia to Manchuria, Korea, and northern Japan (Hokkaido)
  • Intergrades (or interbreeds) with glandarius group in the Urals


Japonicus group
  • Loral region black and contiguous with the black malar stripes
  • Edges of crown feathers nearly snow-white, giving a very bright black and white appearance to top head with consequent much greater contrast than in any other jays with streaked crowns
  • Range: Japan (except Hokkaido)


Bispecularis group
  • Crown of head immaculate
  • Blue patch on secondaries
  • Bill rather small
  • Irides dark brown (western races) to greyish (eastern races)
  • Range: western Himalayans to Formosa
  • Intergrades with brandtii group in northern China


Leucotis group
  • Crown of head black
  • Blue patch on secondaries
  • Cheeks white
  • Irides dark brown
  • Range: Burma, Thailand (Siam), Laos, Annam and Cochin China
  • Forms intermediate between the leucotis group and the bispecularis group occur in northern Burma
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Introduction

The jay is one of the most colourful members of the crow-family (Corvidae).Besides their colour their habits and intelligence are very crow-like. Linnaeus already knew that and that’s why he called the jay Corvus glandarius (Corvus is Latin for raven). The Latin word glandarius (from glandis = acorn) refers to the acorn eating and acorn collecting and hiding habits of the jay. Especially this hiding habit shows the jay’s intelligence.Later, the genus name Corvus was changed in Garrulus to distinguish the jay from the all-black ‘true crows’ of the genus Corvus. Its name garrulus is based on its sound and means babbling or chattering. But the jay is still a member of the resourceful crow-family and therefore a very adaptable and successful species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

At three years of age, jays begin to breed. In spring, gatherings known as 'crow marriages' may occur, which allow unpaired birds to find a mate. The nest is built in a tree towards the end of April; it measures up to 30 cm across, and consists of twigs lined with fine roots, grass and hair. The courtship display involves much posturing, with wings and tail outstretched. After mating the female lays between 5 and 7 glossy eggs, and both the male and the female take turns to incubate them for 16 days (5). Following hatching, the chicks are fed by both parents for around 20 days. After the chicks leave the nest, a close bond remains with the parents, who continue to feed them and stay with them throughout the autumn (5). Acorns are the most important component of the diet; these are buried during autumn to provide a cache of food for more harsh times of year, and it is widely believed that jays play a crucial role in the spread of oak woodlands (5). Several thousand acorns are stored by a single bird each autumn (6). They also feed on grains, invertebrates, beech nuts and sweet chestnuts during winter (6), in the spring they feed on caterpillars (5), and eggs are taken during summer (2). Jays attack crows, owls and hawks, mobbing them whilst mimicking their calls as an alarm (5). Anting behaviour has been observed in this species; ants are encouraged to swarm over the bird's body and the jay seems to enjoy this immensely (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The shy jay is a strikingly coloured member of the crow family. It is generally pinkish-brown in colour, with a black tail, whitish throat and rump patch and a blue patch on the wings, barred with black (2). There is a broad black 'moustache' on either side of the bill, and the crown is streaked with black (2). Juvenile jays are a darker reddish than the adults (5). The most common noise produced is a loud scream, which serves as an alarm call (2); this earned the jay the Gaelic name of 'schreachag choille', which means 'screamer of the woods' (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description of Garrulus glandarius

De \'\'gaai\'\' (\'Garrulus glandarius\'), ook wel \'\'Vlaamse gaai\'\' genoemd, is een opvallend gekleurde kraaiachtige. == Verspreiding == Deze vogel komt voor in het cultuurland en de bossen. Hij is over heel Europa verspreid met uitzondering van het hoge noorden. In nieuwbouwwijken zie je in eerste instantie vaak de ekster, naarmate de bomen en struiken in het openbaar groen en in tuinen groter worden, wordt deze langzaam aan verdrongen door de gaai. == Voedsel == De eik is afhankelijk van de gaai voor het verspreiden van eikels.  Gaaien 34 cm. Onmiskenbaar. Verenkleed voornamelijk licht kaneelkleurig-roodbruin, met oprichtbare zwart en wit gestreepte kruinveren, zwarte mondstreep, blauw en zwart gebandeerde vleugeldekveren, witte keel, witte vlek op gesloten vleugels, en witte stuit en anaalstreek scherp contrasterend met donkere staart. Vliegt \'moeizaam\', springt vaak van tak tot tak. Indien opgeschrikt, een luid en schor \'skraaawk\'; verder verschillende klikkende, miauwende en klokkende geluiden. Algemene standvogel in geheel Europa behalve nabij de Poolcirkel.
Creative Commons Attribution 3.0 (CC BY 3.0)

Quest

Source: BioPedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

Garrulus glandarius is widely distributed throughout Europe and Asia. It is a mostly temperate species that lives in forested areas and near human settlements.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution habitat

Distribution
  • North-western Africa
  • Europe
  • North-eastern Russia through Siberia to Manchuria
  • Korea
  • Japan and western Asia
  • Western Himalayans to Formosa Burma
  • Thailand (Siam)
  • Laos
  • Annam
  • Cochin China


Habitat
Inhabits:
  • Woods
  • Copses
  • Spinnies
Also often:
  • Parks
  • Large gardens
  • Towns provided there is plenty of tree cover
Usually its range coincides with that of oaks, Quercus sp.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

In Britain, the jay is common throughout much of England and Wales, and reaches as far north as Perthshire, Argyll and Aberdeenshire (6). Various races of this species occur throughout Europe, North Africa, and Asia, reaching Siberia in the east and the Himalayas in the south (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Eurasian jay plumage is mainly light reddish brown. Their feathers reflect UV light. Their crests, which are frequently raised during communication, are white with black speckles. Their beaks are black, and black moustache stripes extend downward from the ends of their beaks. Their tails are black dorsally with a white patch around the base. Their wings have bright blue spots with black speckles. These blue areas appear like triangles or a band, though their orientation and size changes when the wings are spread (they enlarge when spread). There are white bands on the wings, visible during flight. The rest of the wings are black, except for a red triangle where the wing attaches to the body. They often carry their wings so the tips are both on one side of the tail.

When compared to other corvids, like Corvus and Pica species, Eurasian jays hold their tail rather high. For this reason the tail feathers incur less damage than in the other genera. Unlike other corvids, Eurasian jays have two plumage phases: juvenile and adult. Other corvids can be aged by a sequence of plumages, but ageing is more difficult in Eurasian jays. They lose their juvenile plumage by autumn of the first year, so birds seen in autumn all appear to be adults.

Eurasian jay average basal metabolic rate is 4.99 kJ per hour.

Average mass: 170 g.

Average length: 34 cm.

Average wingspan: 55 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

  • Veiga, J., V. Polo. 2005. Feathers at nests are potential female signals in the spotless starling. Biology Letters, 1: 334-337.
  • Seel, D. 1976. Moult in five species of Corvidae in Britain. IBIS, 118: 491-536.
  • McNab, B. 2009. Ecological factors affect the level and scaling of avian BMR. Comparative Biochemistry and Physiology, Part A, 152: 22-45.
  • 2009. "BirdGuides" (On-line). Jay Garrulus glandarius. Accessed January 15, 2009 at http://www.birdguides.com/species/species.asp?sp=173037.
  • Goodwin, D. 1956. Further observations on the behavior of the jay Garrulus glandarius . IBIS, 98: 186-219.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eurasian jays prefer dense foliage, with plenty of trees, bushes, and undergrowth. Trees are essential due to their arboreal lifestyles, though they also forage on the ground. High levels of biodiversity are important so they can enjoy varied diets. Eurasian jays store and eat acorns, so oak trees are important features of their habitat. Deciduous oak forests are preferred for foraging, but coniferous forests provide the best nesting places. Eurasian jays do not like open areas and will avoid entering them if possible. They are most vulnerable to predators in open areas.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Other Habitat Features: suburban ; agricultural ; riparian

  • Selva, N., B. Jedrzejewska, W. Jedrzejewski, A. Wajrak. 2005. Factors affecting caracass use by a guild of scavengers in European temperate woodland. Canadian Journal of Zoology, 83: 1590-1601.
  • Hougner, C., J. Golding, T. Soderqvist. 2006. Economic valuation of a seed dispersal service in the Stockholm National Urban Park, Sweden. Ecological Economics, 59: 364-374.
  • Goodwin, D. 1951. Some aspects of the behavior of the jay Garrulus glandarius . IBIS, 93: 414-442, 602-625.
  • Pons, J., J. Pausas. 2008. Modelling jay (Garrulus glandarius) abundance and distribution for oak regeneration assessment in Mediterranean landscapes. Forest Ecology and Management, 256: 578-584.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds in coniferous and broadleaved woodlands, as well as in large wooded parks, preferably where there are oaks (2), as well as in orchards and gardens (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Eurasian jays are omnivores and opportunistic, eating pretty much whatever they can find. Acorns represent the largest part of their diet. They crack the shell by biting it and using their beaks to lever the shell pieces open until they can get the meat out. They collect the acorns of Quercus oaks in the autumn and bury them to eat throughout the year. They rely on stored food the most from May to July, when they are feeding offspring. One bird can hide between 4500 and 11,000 acorns and will use its memory to locate caches up to ten months later. When hiding acorns, they usually hide only one in a spot, but may hide two or three acorns there. The impulse to store acorns for later use is so strong that captive jays without access to a surplus of acorns will store things that look like acorns, including properly shaped stones.

Eurasian jays prefer the acorns of Quercus ilex, Quercus suber, and Quercus faginea, but avoid acorns from Quercus coccifera. Preference is probably linked to relative nutritional value. Quercus ilex acorns have the highest fat content and Quercus coccifera acorns have the highest amount of tannins, at least of the four species studied by Pons and Pausas (2007). Eurasian jays prefer bigger acorns over smaller ones. They usually transport one acorn at a time, but they have been observed carrying up to five at once. Single acorns are carried in the bill. If more than one is carried, the first one or ones are swallowed and carried in the crop while the last, and usually largest, is held in the bill.

In addition to acorns, Eurasian jays eat fruit, grains, and nuts. They also take invertebrates, including worms, snails, slugs, and insects. Eggs are not instinctively recognized as food, but once a bird learns to crack it open and eat the insides, it will continue to do so with other eggs it encounters. They will eat small birds, their young, and their eggs. Reed warblers (Acrocephalus scirpaceus) are an example of a common prey species. Eurasian jays eat plenty of carrion. Researchers studying carrion consumers have found jays will visit about half of available carcasses, especially those in the forest. They use their feet to hold food, but not if the food is sticky. They look everywhere they can for food, including in crevices, loose bark, small holes, under leaves, or any other spot a prey item might be hiding. However, they avoid food that is on open ground instead of covered with foliage. To open something, they insert their beaks and then try to open them. To turn something over, they pull on it with their beaks or put their beaks under the edges and push sideways.

Animal Foods: birds; mammals; eggs; carrion ; insects; terrestrial non-insect arthropods; terrestrial worms

Plant Foods: seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Primary Diet: herbivore (Granivore ); omnivore

  • Davies, N., S. Butchart, T. Burke, N. Chaline, I. Stewart. 2003. Reed warblers guard against cuckoos and cuckoldry. Animal Behavior, 65: 285-295.
  • Clayton, N., D. Griffiths, A. Bennett. 1994. Storage of stones by Jays (Garrulus glandarius). IBIS, 136: 331-334.
  • Clayton, N., R. Mellor, A. Jackson. 1996. Seasonal patterns of food storing in the Jay Garrulus glandarius . IBIS, 138: 250-255.
  • Pons, J., J. Pausas. 2007. Not only size matters: Acorn selection by the European jay (Garrulus glandarius). Acta Oecologica, 31: 353-360.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Eurasian jays perform many functions which benefit the ecosystems they inhabit. Their alarm calls alert other species, including red squirrels (Sciurus vulgaris), to the presence of predators. They consume carrion, removing potential disease sources and helping in making nutrients available in the ecosystem.

One of their most important ecosystem roles is the dispersal of acorns from Quercus trees. Eurasian jays eat most of the acorns they take, but they also bury acorns and forget about them, leading to oak regeneration. Eurasian jay prefer collecting and burying viable acorns over infertile, dead, or damaged acorns, making them excellent dispersal agents. They preferentially store acorns on the edges of clear spaces, which is the best place for seedlings to get the right amount of light for germination. Oak trees, including Quercus robur and Quercus petrea, are keystone species in their habitats, providing homes and food for many species of animals, plants, fungi, and lichen. About 80% of all insects on the IUCN Red List need oak trees as part of their life cycle.

Ecosystem Impact: disperses seeds; creates habitat; biodegradation

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Eurasian jays are preyed on by many animals, including cats, birds of prey, and small terrestrial predators. Eggs and young are taken by martens (Martes) and cats (Felis). Adults and fledglings are largely taken by birds of prey.

Eurasian jays exhibit a variety of responses to predators, depending on the species and the circumstances. When they see a hawk flying above, they freeze, watch it flying, and emit a low moan in alarm. Mobbing is a common defense mechanism, and they use it against nearly all species of predators. Sometimes a threatened bird will emit the calls of more powerful birds, like tawny owls (Strix aluco), perhaps in an effort to frighten the attacker. Another use of mimicry in predation defense is when Eurasian jays fly out of sight of a threatening bird and then call it using its own species’ call notes. For instance, they have been observed to fly away from their nest in the presence of a carrion crow (Corvus corone, a nest predator) and mimic the crow’s own calls. Eurasian jays sitting on a nest can also sit quietly or sneak away rather than draw attention to their nest. A valuable defense measure is to simply avoid open spaces, where they are more vulnerable to avian predators.

Known Predators:

Anti-predator Adaptations: mimic

  • Palma, L., P. Beja, M. Pais, L. Cancela da Fonseca. 2006. Why do raptors take domestic prey? The case of Bonelli's eagles and pigeons. Journal of Applied Ecology, 43: 1075-1086.
  • Toyne, E. 1998. Breeding season diet of the Goshawk Accipiter gentilis in Wales. IBIS, 140: 569-579.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Eurasian jays use a variety of visual displays to communicate. Displays involve changing body positions, raising feathers on certain parts of their bodies, and movements when necessary. Each display can be given in intense versions or simpler versions. For example, a very submissive bird will extend her wings completely during display, while a less submissive bird will only extend them partway. The displays are undoubtedly more colorful to the bird than to a human observer because their feathers reflect UV light, which we cannot see. Displays are accompanied by vocalizations in some cases, like when the bird is expressing friendliness or alarm.

Males and females have different sexual displays, both of which involve spreading their wings, lifting their feathers, and making a call. The female’s sexual display is similar to the submissive display. The submissive display can be used in a variety of settings, from admitting defeat in a fight to reacting to a human owner, if the bird is tame. They use an aggressive posture to threaten enemies. Jerky alarm movements are performed in silence when the bird does not feel too threatened, serious threats are signaled with the same movements accompanied by alarm screeches. Anxiety is expressed by exaggerated bill wiping and anger is expressed by overzealous feeding movements which only involve actual swallowing if the anger is vented on something edible.

Eurasian jays possess a range of jay-specific calls. One of these, the “appeal note,” is used by birds of all ages when they want something. In young birds, the call is directed to the parents as a request for food, but adults have been heard to utter the same notes while foraging on their own, as if talking to themselves. They use alarm calls to signal the presence of predators. The alarm call is a loud screech emitted once or twice. They also vocalize to express anger, playfulness, affection, warnings about predators, and a myriad of other emotions, intentions, or observations.

Eurasian jays are accomplished mimics and will sing songs composed of all sorts of sounds they have heard. They may mimic crying babies, passerine songs, water dropping from a tap, lawn mowers, and even the alarm calls of their predators. Goodwin (1951) supposes they repeat sounds according to the emotional state they experienced when they originally heard the sound. Thus, when threatened or mobbing they copy alarm notes from blackbirds, magpies, and tawny owls, but at more relaxed times may emulate woodpeckers, sparrows, and human whistling. Young birds spend a great deal of time practicing their mimicry until they can perfectly replicate the original sound.

Communication Channels: visual ; tactile ; acoustic

Other Communication Modes: mimicry

Perception Channels: ultraviolet

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Nesting social behaviour

The jay nests mostly in trees or shrubs. Typical nest sites in Britain are:
  • a main fork of a hawthorn or crab apple
  • a clump of honeysuckle
  • the forking branches near the summit of a birch sapling
  • against the trunk of a birch or conifer, supported by outgrowing branches
They are built usually from 3 to 6 metres above the ground.Both sexes build at all stages of the nest, each putting in place the material it has brought. The male tends to take the initiative in nest site selection. The nest is made of twigs, small sticks, and sometimes woody stems, with an inner lining of fine roots or root like fibres. Sometimes a little horsehair or any other fine wiry materials are used as well for the lining.The eggs, usually 4 to 6, are light bluish green to dull light yellowish green, with speckles and small flecks of light brown or greenish brown. These markings are usually so dense that they partly obscure the ground colour.The eggs are laid daily, in the early morning. The female may roost on the nest the night before laying the first egg but does not always do so. Incubation and brooding is done by the female only. However, some males will cover young for short periods.The incubation period is 16 to 18 days. True incubation appears usually to begin with the second or third egg.The sitting female is fed by the male who brings food in his gullet. Female leaves nest about once in three hours, for periods of 5 to 15 minutes.After the young are hatched the female eats the hatched eggshells. Both sexes feed the young, at first mostly with food brought by the male. The young jays leave the nest at about 21 to 23 days, but will jump out as early as 17 days if badly frightened. When the young are fledged they appear to be recognized as individuals. A parent will often give some food to a young one then leave it, still begging eagerly, in order to seek out and feed another of the brood. The flying young appear to start following the parents at the stage when the latter begin to neglect them.Young that have recently left the nest may rest or sleep in contact but adults maintain an individual distance of, usually, a metre or so. Even the members of a pair seldom come to within about a metre of each other without showing appeasing or threatening behaviour. The preludes to courtship feeding and copulation fall, of course, within these categories.Only one brood is reared a year but repeat attempts are often made if eggs or young are destroyed. The eggs are usually laid in late April and the first half of May but quite often in late May and early June as well. The later nests are probably often repeats after loss of the first clutch, and the occasional clutches laid in mid or late June almost certainly are. Carrion crows Corvus corone and Magpies Pica pica are known at times to take eggs and young from jays’ nests and the Tawny owl Strix aluco sometimes catches incubating jays at night.The typical ‘play’ or ‘frolicking’ of the jay consists of dashing from bough to bough within a rather small area, ducking, dodging and sometimes uttering low intensity variants of the grating call. It is seen most often in young jays among which it seems often infectious. The movements are those which are used in earnest when trying to escape from the attacks of a Goshawk Accipiter gentiles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding general habits

The jay feeds both in trees and shrubs and on the ground. Acorns are usually a staple food. Insects are also taken in quantity and form the principle food given to nestlings. However, in fact jays are omnivorous, and berries, fruits, eggs, young birds, mice and other small mammals are eaten as well.Hunting and killing of recently-fledged young small birds is usually, and perhaps only, practised by adult jays that are feeding well-grown young. Many distasteful or poisonous insects are habitually ignored by jays. This is almost certainly due to learning. Walter Rothschild proved that a jay was able to distinguish which of two insects, one poisonous, one innocuous, the former eaten shortly before the latter, had caused its discomfort even although both were vomited up together.In towns and suburbs, jays readily learn to eat bread and other human food and become very fond of peanuts.When seeking food the jay will dig in the likes of dead leaves or loose soil with side-to-side swings of head and bill and try to open crevices, rolled-up leaves or any other seam or small hole by inserting and then opening the bill.Just like other crows, food that needs breaking up is held under their feet. Usually it’s held under both feet, less often under one foot. The jay dislikes holding anything at all sticky under foot and food of this description, if it needs further breaking up, is usually held in the bill and rubbed about on the perch or on the ground. To eat an acorn the jay holds it between its feet on the perch. They seldom, if ever, hammer at an acorn but bites and levers with its bill till the shell is pierced, when it is soon removed.The jay habitually hides food, mostly acorns and usually in the ground, but sometimes in trees as well. When an acorn is being hidden the bird usually gives it a few hard blows with the bill after inserting it and before covering it up. Jays in the London parks hide bits of meat and cheese above the ground more often than they do nuts and acorns, perhaps through learning that such foods are not improved by being buried.Intensive storing of acorns takes place as soon as they are ripe and while they are still on the trees. They are, at any rate, by resident adult pairs, carried back to the birds’ living areas. This is very apparent in times of widespread failure of acorn crop when jays may fly miles to obtain acorns. In places, such as inner London, where the oaks tend to be scarce and scattered, but much less so under other conditions as, naturally, the jay collects acorns as near home as it can.Acorns are habitually recovered. Observations suggest that, at least in south-eastern England, most of the many acorns eaten by Jays in winter and spring have been previously hidden by them. Hidden acorns may be regularly recovered from under a foot or more of snow. The bird retrieves hidden food by flying or hopping straight to the spot.Jays may learn to correlate baby oaklings with the presence of a hidden acorn, through finding the former when they return for an acorn they have buried or possibly by chance. Comparable learning is apparently shown in relation to birds-nesting. Many jays, presumably as a result of experience, will at once begin to search for a nest if a passerine starts to mob or attack them. It is at first astonishing to see the way in which the jay, which may be high in a bare tree or on a garden fence when for example a blackbird begins to mob it, immediately flies to the nearest bush, hedge or other likely nesting place and determinedly searches there.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Partner Web Site: Natural History Museum

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The oldest bird recorded in Britain was 16 years, 9 months of age.

Average lifespan

Status: wild:
16.75 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17.9 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eurasian jays are monogamous and breed once a year in the spring. At the beginning of spring, usually in March and April, unpaired birds spontaneously form gatherings where they choose their mates. In these gatherings, birds pair up and display to each other. They use a wide range of vocalizations, one of which is named the “flight appeal” and is an invitation to fly. Males display more than females and they also chase them. Mating gatherings appear random and may be started by already paired birds chasing and displaying to each other, which excites nearby unpaired birds and encourages them to join in. The gatherings may be as small as three or four birds, but are often as large as thirty or more. These gatherings also sometimes happen later in the season, like in June, though those gatherings are most likely the result of a paired bird losing its mate or nest rather than new birds finding their first mates.

Males offer their mates food as part of courtship. He crushes or tears portions off a food source and offers it to her. If she acts too nervous to accept, he may try approaching her from below, as this is a less threatening way to approach a jay. The birds may call affectionately to each other and engage in a tug-of-war during the ritual. If the female brings the food to her mate, they may pass the food back and forth until one or the other eats it. The ritual appears to strengthen their bond. Later, when the female is busy with the nest, the male will continue to supply her with food.

Mating System: monogamous

Both parents build and line the nest. Their nests are cup shaped and built in bushes or trees. They are constructed of sticks, freshly broken off of branches, and lined with fine roots, hairs, and the birds’ own feathers. Egg-laying commences around the end of March, and usually only one brood is raised per season, 4 to 5 eggs are laid, each weighing about 8.5 grams, 6% of which is the shell’s weight. Both parents incubate. The young hatch in 18 days and are naked and blind. They fledge and first leave the nest when they are 20 to 23 days old, but they remain dependent on their parents. The parents begin to wean them when they are around 40 days old, and they are independent around two months of age, though they continue to rob food from their parents for a few days. Eurasian jays reach breeding age at 2 years.

Breeding interval: Eurasian jays breed once a year.

Breeding season: Eurasian jays breed from March through June.

Range eggs per season: 4 to 5.

Average time to hatching: 18 days.

Range fledging age: 20 to 23 days.

Average time to independence: 2 months.

Average age at sexual or reproductive maturity (female): 2 years.

Average age at sexual or reproductive maturity (male): 2 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Sometimes only the females incubates, though in many pairs it is both parents. Incubating females clean the nest of parasites by eating them. This behavior seems to be caused by a need to eat anything she finds in the nest that isn’t an egg, lining, or young. Sometimes her need to clean the nest can be exaggerated if she is stressed by the presence of a predator or other stimulus, and she may eat her eggs or young.

When a predator approaches, the incubating bird will react according to the situation. If the intruder is far away and may not have noticed the bird, the parent will simply sneak away from the nest or fly off altogether, sometimes making alarm cries as he or she leaves. If the predator approaches, the parent will crouch lower in the nest, facing the threat, with her bill open. An even closer predator will warrant a defensive threat posture, which involves spreading the wings and crouching down. If the parent decides the only course of action is to attack, she will fly at the predator, attacking it with her claws and beak and crying out using any number of alarm calls, either her own jay calls, the predator’s own calls, or the alarm calls of an entirely different animal.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Garrulus glandarius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACAAAGACATTGGCACCCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTATTCCGAGCAGAACTAGGCCAGCCCGGCGCTCTTCTAGGAGACGATCAAATCTACAATGTCATTGTTACAGCCCATGCCTTCGTCATGATTTTCTTCATAGTAATGCCAATCATAATCGGGGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGCGCCCCGGACATAGCATTCCCACGAATAAACAACATAAGCTTTTGACTTCTCCCTCCCTCATTCCTCCTTCTTCTAGCCTCTTCCACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTTTACCCCCCACTAGCCGGTAACCTAGCCCATGCTGGAGCATCAGTCGACCTGGCTATTTTCTCACTACATCTGGCAGGTATTTCATCCATCCTAGGGGCAATTAATTTCATCACTACCGCAATTAACATAAAACCTCCAGCTCTATCACAATACCAAACCCCTCTGTTCGTATGATCAGTTCTAATCACTGCAGTACTCCTCCTCCTATCCCTTCCCGTCCTTGCCGCAGGAATCACTATGCTCCTAACAGATCGCAACCTCAACACCACATTCTTCGACCCAGCAGGAGGAGGAGACCCAATTCTATACCAACACCTATTCTGATTCTTCGGGCACCCAGAAGTTTACATCCTAATTCTACCAGGATTTGGAATTATCTCCCACGTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Garrulus glandarius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 19
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eurasian jays have an extensive range, populations are estimated in the millions of individuals, and there are no detected declining population trends. As a result, the IUCN Red List has determined they are "Least Concern."

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Receives general protection under the Wildlife and Countryside Act 1981 (3). May be killed or taken under the terms of General Licences (9). Included in the Birds of Conservation Concern Green List (low conservation concern) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 6,000,000-13,000,000 breeding pairs, equating to 18,000,000-39,000,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 36,700,000-156,000,000 individuals, although further validation of this estimate is needed. National population estimates include: c.10,000-100,000 breeding pairs and c.50-1,000 individuals on migration in China; c.100-100,000 breeding pairs in Taiwan; c.10,000-100,000 breeding pairs in Korea; c.10,000-100,000 breeding pairs and c.50-1,000 individuals on migration in Japan and c.10,000-100,000 breeding pairs and c.50-1,000 individuals on migration in Russia (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

This common species is not threatened in Britain.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

No specific conservation action is targeted at this species (8)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Eurasian jays on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Eurasian jays are important in the regeneration of oak forests through acorn dispersal. Oaks are important to people because of their wood, beauty, and ability to enhance biodiversity. One study from a park in Sweden estimated how much money it would cost for humans to do the same job as Eurasian jays. The researchers determined it would cost between 1 and 6 million kroners (about 125,000 to 751,000 U.S. dollars) to replace Eurasian jays with people planting acorns in the 2700 hectare park.

A study in Germany found oaks regenerated in pine forests at a rate of 2,000 to 4,000 trees per hectare. Since mother oak trees were largely unavailable, they attributed this regeneration to Eurasian jays. The area was clearcut about 30 years before the study was performed and mostly pines regenerated. Oak trees were not recruited into the regenerating forest until Eurasian jays moved into the pine forest and began caching acorns.

  • Mosandl, R., A. Kleinert. 1998. Development of oaks (Quercus petraea (Matt.) Liebl.) emerged from bird-dispersed seeds under old-growth pine (Pinus silvetris L.) stands. Forest Ecology and Management, 106: 35-44.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eurasian jay

The Eurasian jay (Garrulus glandarius) is a species of bird occurring over a vast region from Western Europe and north-west Africa to the Indian Subcontinent and further to the eastern seaboard of Asia and down into south-east Asia. Across its vast range, several very distinct racial forms have evolved to look very different from each other, especially when forms at the extremes of its range are compared.

The bird is called jay, without any epithets, by English speakers in Great Britain and Ireland. It is the original 'jay' after which all others are named.

Taxonomy and systematics[edit]

The Eurasian jay was one of the many species originally described by Linnaeus in his 18th century work Systema Naturae. He recognised its affinity with other corvids, naming it Corvus glandarius.[2]

A typical example of the atricapillus group in Israel

Eight racial groups (33 subspecies in total) are recognised by Madge & Burn (1994):[3]

  • the nominate group (nine European races), with a streaked crown.
  • the cervicalis group (three races in North Africa), with a rufous nape, grey mantle, very pale head sides, and a streaked or black crown.
  • the atricapillus group (four races in Middle East, Crimea & Turkey), with a uniform mantle & nape, black crown and very pale face.
  • the race hyrcanus (Caspian Hyrcanian mixed forests of Iran), small with black forecrown and broadly-streaked hindcrown.
  • the brandtii group (four races in Siberia and northern Japan), with a streaked crown, reddish head, dark iris and grey mantle.
  • the leucotis group (two races in south-east Asia), with no white in the wing, a white forecrown, black hindcrown and much white on the sides of the head.
  • the bispecularis group (six races in the Himalayan region), with an unstreaked rufous crown, and no white wing-patch.
  • the japonicus group (four races in the southern Japanese islands), with a large white wing-patch, blackish face and scaled crown.

Distribution and habitat[edit]

A member of the widespread jay group, and about the size of the jackdaw, it inhabits mixed woodland, particularly with oaks, and is an habitual acorn hoarder. In recent years, the bird has begun to migrate into urban areas, possibly as a result of continued erosion of its woodland habitat.

Behaviour and ecology[edit]

Calls of Eurasian jay, Crimea

Its usual call is the alarm call which is a harsh, rasping screech and is used upon sighting various predatory animals, but the jay is well known for its mimicry, often sounding so like a different species that it is virtually impossible to distinguish its true identity unless the jay is seen. It will even imitate the sound of the bird it is attacking, such as a tawny owl, which it does mercilessly if attacking during the day. However, the jay is a potential prey item for owls at night and other birds of prey such as goshawks and peregrines during the day.

Diet[edit]

Feeding in both trees and on the ground, it takes a wide range of invertebrates including many pest insects, acorns (oak seeds, which it buries for use during winter),[4] beech mast and other seeds, fruits such as blackberries and rowan berries, young birds and eggs, bats, and small rodents.

Breeding[edit]

Garrulus glandarius's egg,

It nests in trees or large shrubs laying usually 4–6 eggs that hatch after 16–19 days and are fledged generally after 21–23 days. Both sexes typically feed the young.

Notes[edit]

  1. ^ BirdLife International (2012). "Garrulus glandarius". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ (Latin) Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata.. Holmiae. (Laurentii Salvii). p. 824. 
  3. ^ Madge, Steve and Hilary Burn Crows and Jays Helm Identification Guides ISBN 0-7136-3999-7 (although the text accompanying plate 11 states "some 35 races", the species account on page 95 states that 33 are recognised, and the sum of the numbers of races listed for each group is 33, indicating that the figure accompanying the plate is an error)
  4. ^ Burton and Burton 2002, p. 2457.

References[edit]

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!