Articles on this page are available in 1 other language: Spanish (19) (learn more)

Overview

Distribution

Geographic Range

Cyanolyca cucullata inhabits southeastern Mexico, mainly on the Caribbean slope (Blake 1953). South through east-central Oaxaca and interior Chiapas to Guatemala; Western Panama and Costa Rica. Cyanolyca cucullata is also found in ranges of the tropical forests, in foothills, and in lowlands, but only when these have continuous cloud forest (Goodwin 1986).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Cyanolyca cucullata is similar in size to the Blue Jay, but has a larger body structure to support the amount of flying it must do. The feathers at the crown and nape are light, bright blue. The rest of the head, neck, upper mantle, and upper breast are black, and further down the body the feathers turn into a dark, purplish blue. There is a distinct white band that separates the bright blue head and the dark tones of the rest of the body. This band is a diagnostic feature of Cyanolyca cucullata. Young Cyanolyca cucullata have the same markings as adults, but the coloring is a lot duller, and the feathers are not nearly as shiny. The bright blue coloring makes the bird easy to spot and can make it more susceptible to predators (Goodwin 1986).

Average mass: 1000 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in humid, tropical forests, including mountains.

Terrestrial Biomes: forest ; rainforest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Cyanolyca cucullata is omnivorous, eating seeds, berries, small dead animals, and occasionally steals bait from snares set for small mammals. Cyanolyca cucullata mostly forages in the canopy high above the forest floor(Goodwin 1986).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Mates usually preen each other (one bends down in front of the other and pulls down at the throat feathers). There tends to be a constant movement of the crown feathers that reveals the condition of the mate. Nests are extremely hard to find. Sometimes these jays take over the nests of other birds that have abandoned them. Nesting tends to occur in trees that are at high elevations. Three to four eggs are laid in the nest over a period of time. Once the young hatch, they remain in the nest for around twenty days. The parents will bring the young food and watch over them until it is safe for the offspring to leave. (Winnett-Murray et al. 1988).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyanolyca cucullata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTGGGTACCGCCCTAAGTCTCCTTATTCGAGCAGAACTAGGCCAACCAGGATCTCTCCTAGGGGACGACCAAATCTACAACGTAATTGTTACAGCCCATGCTTTCGTCATAATCTTCTTCATAGTTATACCAATCATAATCGGAGGATTCGGAAATTGACTAGTCCCCCTAATAATTGGTGCCCCAGACATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTTCTGCCCCCTTCATTCCTTCTTCTCCTAGCTTCCTCAACAGTAGAAGCAGGAGTAGGAACAGGATGAACCGTATACCCACCACTAGCTGGAAACCTAGCCCATGCTGGAGCCTCAGTCGACCTAGCCATTTTCTCCCTACATCTAGCAGGTATCTCCTCCATCCTAGGAGCAATTAACTTCATCACGACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACTCCCCTATTCGTATGATCCGTACTAATCACTGCAGTACTTCTCCTCCTATCACTGCCAGTTCTAGCCGCCGGAATCACTATGCTCCTAACAGACCGCAACCTAAACACCACATTCTTCGACCCAGCAGGAGGAGGCGACCCGGTACTGTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cyanolyca cucullata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyanolyca cucullata may be a rare bird like other Cyanolyca species, but it has not been well-studied. The first record of nesting was not published until 1984. Deforestation and other common threats could have an affect on the population of this bird (Winnett-Murray et al. 1988).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimated the population to number fewer than 50,000 individuals (A. Panjabi in litt. 2008), thus it is placed in the band 20,000-49,999 individuals here.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

No specific negative effects are known, but some tropical jays are pests that destroy and eat crops such as pineapples, orchards, cane, vegetables, and potato plantings (Sick 1993).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Seed caching behavior probably results in the spreading of seeds, increasing the distribution and diversity of plant species. (Sick 1993).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Azure-hooded jay

The azure-hooded jay (Cyanolyca cucullata) is a species of bird in the Corvidae family. It is found in Middle America. Its natural habitat is subtropical or tropical moist montane forest. This species is known to have four subspecies. It is 11 to 12 inches (28 to 30 cm) in length and is dark blue with a black head and upper chest. The back of the head and neck are sky blue with a white border.

The jays travel in groups of two to ten individuals and may join mixed-species flocks. It is a secretive species and therefore difficult to observe in the wild. As an omnivore, this jay eats berries, seeds, and small, dead animals. Females lay three to four eggs, and the young fledge after twenty days. This species is listed as Least Concern, meaning it is not threatened with extinction.

Taxonomy[edit]

The species was first described by the American ornithologist Robert Ridgway in 1885. Its specific epithet, cucullata, is the Latin word for "hooded". Its closest relative is the beautiful jay (C. pulchra) of Colombia and Ecuador;[2] in his 1934 study, Hellmayr treated these species as conspecific.[3] Phylogenetic analysis published in 2009 confirmed the close relationship between the two species; Bonaccorso speculates that the geographic (and subsequent genetic) separation between these species and others in the Cyanolyca genus may have been initiated by the formation of the Río Cauca Valley in western Colombia.[4]

The azure-hooded jay has four subspecies.[5] Cyanolyca cucullata mitrata is found in eastern Mexico, from San Luis Potosí to north central Oaxaca. This subspecies was initially treated as a separate species by Ridgway, but it was later merged into the azure-hooded jay.[6] C. c. guatemalae ranges from southern Mexico in Chiapas to central Guatemala.[5] C. c. hondurensis resides in western Honduras.[5] C. c. cucullata, the nominate subspecies, is found in Costa Rica and western Panama.[5]

Description[edit]

In Costa Rica

The azure-hooded jay ranges in length from 11 to 12 inches (28 to 30 cm),[7] and it tends to weigh 35.2 ounces (1,000 g).[8] Its large size and frame help the bird manage the large amount of flying it does.[8] The adult is dark blue with black on the head and upper chest, while the rear of the crown and nape, or back of the neck, are sky blue with a white border.[7] The legs and bill are black and the eyes are dark red.[7][9] Both sexes are similar in appearance.[6] Juveniles are duller than adults and their sky blue hood does not possess the white bordering.[7]

Its voice has been described as a loud and bright eihnk-eihnk that is typically repeated four to five times. It is also known to repeat a nasal ehr-ehn or eh’enk noise twice and give off a low, gruff, hard cheh-r.[7] The alarm and flock-social calls of this species, characterized as a reek! sound, are "nasal, querulous, and upwardly or double inflected."[10]

Distribution and habitat[edit]

Costa Rica's Monteverde cloud forest, which the azure-hooded jay inhabits

This species is known from Costa Rica, Guatemala, Honduras, southeastern Mexico, and western Panama.[11] It lives in humid evergreen forests that are sometimes interspersed with pine trees.[7][8] It can be found at the edges of these forests typically in the middle and higher levels within these trees.[9][11][12] It is also normally found only where cloud forest is uninterrupted.[8]

Ecology and behavior[edit]

This corvid is known to join mixed-species flocks with other species including unicolored jays and emerald toucanets.[7] It is also known to travel in groups with two to ten other azure-hooded jays.[8][11] It is a skulking and secretive species, rarely coming out into the open.[7] Because of this habit, the bird is extremely difficult to observe in the wild and not much is known about its ecology.[8] Mates are known to preen each other, a process which entails one bird bending over in front of the other and tugging on its throat feathers.[8] The feathers of the crown are often moving swiftly, and it is believed that the condition of a mate can be determined by this movement.[8]

Like other jays, this species is likely extremely intelligent. Similar species are known to use ants to keep their feathers clean, store seeds and nuts for later consumption, and use their toes to hold food. However, due to its secretive nature, these characteristics have not yet been observed in the species.[8]

The bird's bright plumage makes it easy for predators to find this species.[8] Whenever the jay feels threatened, it gives off a warning alarm call.[8]

Diet[edit]

The azure-hooded jay is omnivorous, eating berries, seeds, and small, dead animals.[8] This species has been known to steal and eat bait from traps set for small mammals.[8] The bird tends to forage in the forest canopy.[8]

Reproduction[edit]

The jay’s nest is typically built 16.4 to 23 feet (5 to 7 m) above the ground next to a tree trunk.[12] The base of the azure-hooded jay's first studied nest was coarsely made out of twigs that were 0.08 to 0.12 inches (2 to 3 mm) long. That nest was about 4.3 inches (11 cm) wide inside and 7.4 to 13 inches (19 to 33 cm) wide overall depending on the length of the exterior twigs.[12] The nest is 2 inches (5 cm) deep and has an interior constructed with woven thin fibrils and twigs, and no feathers or other softening devices are used in the nest’s construction.[12] In addition to building its own nest, this jay is known to reuse old, abandoned nests made by other species.[8] Three to four eggs are normally laid.[8] The young are typically raised in the nest between April and June and they take at least 20 days to fledge. Both parents care for the young and feed them a variety of insects, including katydids.[12] After the young fledge, they stay close to their parents.[12]

Conservation[edit]

This jay is treated as a species of Least Concern, or not threatened with extinction, by BirdLife International due to its large geographical range of about 42,500 square miles (110,000 km2), population which, while unsurveyed, is believed to be above 10,000 individuals, and lack of a 30% population decline over the last ten years.[13] However, the azure-hooded jay is uncommon in some parts of its range.[13] It is also believed that deforestation may have an effect on this bird.[8]

Relationship with humans[edit]

Although this species has not been observed doing this, closely related jays are known to destroy and eat human-planted crops such as orchards, cane, pineapples, and potatoes.[8] The azure-hooded jay has appeared on one stamp in Mexico in 1996.[14]

References[edit]

  1. ^ BirdLife International (2012). "Cyanolyca cucullata". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Goodwin, p. 258
  3. ^ Hellmayr, Carl Eduard (1934). Catalogue of the Birds of the Americas and the Adjacent Islands. Chicago: Field Museum of Natural History. 
  4. ^ Bonaccorso E (March 2009). "Historical biogeography and speciation in the neotropical highlands: molecular phylogenetics of the jay genus Cyanolyca". Molecular Phylogenetics and Evolution 50 (3): 618–632. doi:10.1016/j.ympev.2008.12.012. PMID 19135159. 
  5. ^ a b c d Clements, James F (2007). The Clements Checklist of Birds of the World Sixth Edition. Ithaca, NY: Comstock Publishing Associates. p. 589. ISBN 978-0-8014-4501-9. 
  6. ^ a b Ridgway, Robert (1904). The Birds of North and Middle America: A Descriptive Catalogue of the Higher Groups’ Genera, Species, and Subspecies of Birds Known to Occur in North America, from the Arctic Lands to the Isthmus of Panama, the West Indies and Other Islands of the Caribbean Sea, and the Galapagos Archipelago Part III. Washington: United States National Museum. p. 322. 
  7. ^ a b c d e f g h Howell, Steve N.G.; Sophie Webb (1995). A Guide to the Birds of Mexico and Northern Central America. New York: Oxford University Press. p. 542. ISBN 0-19-854012-4. 
  8. ^ a b c d e f g h i j k l m n o p q r Kieltyka, Zachary (2007). "Cyanolyca cucullata". Animal Diversity Web. Retrieved 2009-04-19. 
  9. ^ a b "Azure-hooded Jay". Discovery Travel World. 2009. Retrieved 2009-04-17. 
  10. ^ Hardy, John William (1967). "The puzzling vocal repertoire of the South American Collared Jay, Cyanolyca viridicyana merida". The Condor (Cooper Ornithological Society) 69 (5): 513–521. doi:10.2307/1366150. JSTOR 1366150. 
  11. ^ a b c Ridgely, Robert S; Gwynne, Jr., John A. (1989). A Guide to the Birds of Panama with Costa Rica, Nicaragua, and Honduras (Second ed.). Princeton, NJ: Princeton University Press. pp. 337–338. ISBN 0-691-02512-6. 
  12. ^ a b c d e f Winnett-Murray, Kathy; Murray, K. Greg and Busby, William (March 1988). "Two nests of the Azure-hooded Jay with notes on nest attendance". The Wilson Bulletin 100 (1): 134–135. 
  13. ^ a b "Species factsheet: Cyanolyca cucullata". BirdLife International. 2008. Retrieved 2009-04-16. 
  14. ^ "Azure-hooded Jay Stamps". Bird Stamps. Retrieved 2009-04-16. 

Cited texts[edit]

  • Goodwin D. (1983). Crows of the World. Queensland University Press, St Lucia, Qld. ISBN 0-7022-1015-3. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!