Articles on this page are available in 1 other language: Spanish (19) (learn more)

Overview

Distribution

Cyanolyca cucullata inhabits southeastern Mexico, mainly on the Caribbean slope (Blake 1953). South through east-central Oaxaca and interior Chiapas to Guatemala; Western Panama and Costa Rica. Cyanolyca cucullata is also found in ranges of the tropical forests, in foothills, and in lowlands, but only when these have continuous cloud forest (Goodwin 1986).

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Cyanolyca cucullata is similar in size to the Blue Jay, but has a larger body structure to support the amount of flying it must do. The feathers at the crown and nape are light, bright blue. The rest of the head, neck, upper mantle, and upper breast are black, and further down the body the feathers turn into a dark, purplish blue. There is a distinct white band that separates the bright blue head and the dark tones of the rest of the body. This band is a diagnostic feature of Cyanolyca cucullata. Young Cyanolyca cucullata have the same markings as adults, but the coloring is a lot duller, and the feathers are not nearly as shiny. The bright blue coloring makes the bird easy to spot and can make it more susceptible to predators (Goodwin 1986).

Average mass: 1000 g.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in humid, tropical forests, including mountains.

Terrestrial Biomes: forest ; rainforest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Cyanolyca cucullata is omnivorous, eating seeds, berries, small dead animals, and occasionally steals bait from snares set for small mammals. Cyanolyca cucullata mostly forages in the canopy high above the forest floor(Goodwin 1986).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mates usually preen each other (one bends down in front of the other and pulls down at the throat feathers). There tends to be a constant movement of the crown feathers that reveals the condition of the mate. Nests are extremely hard to find. Sometimes these jays take over the nests of other birds that have abandoned them. Nesting tends to occur in trees that are at high elevations. Three to four eggs are laid in the nest over a period of time. Once the young hatch, they remain in the nest for around twenty days. The parents will bring the young food and watch over them until it is safe for the offspring to leave. (Winnett-Murray et al. 1988).

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cyanolyca cucullata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTGGGTACCGCCCTAAGTCTCCTTATTCGAGCAGAACTAGGCCAACCAGGATCTCTCCTAGGGGACGACCAAATCTACAACGTAATTGTTACAGCCCATGCTTTCGTCATAATCTTCTTCATAGTTATACCAATCATAATCGGAGGATTCGGAAATTGACTAGTCCCCCTAATAATTGGTGCCCCAGACATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTTCTGCCCCCTTCATTCCTTCTTCTCCTAGCTTCCTCAACAGTAGAAGCAGGAGTAGGAACAGGATGAACCGTATACCCACCACTAGCTGGAAACCTAGCCCATGCTGGAGCCTCAGTCGACCTAGCCATTTTCTCCCTACATCTAGCAGGTATCTCCTCCATCCTAGGAGCAATTAACTTCATCACGACAGCAATCAACATAAAACCCCCTGCCCTATCACAATACCAAACTCCCCTATTCGTATGATCCGTACTAATCACTGCAGTACTTCTCCTCCTATCACTGCCAGTTCTAGCCGCCGGAATCACTATGCTCCTAACAGACCGCAACCTAAACACCACATTCTTCGACCCAGCAGGAGGAGGCGACCCGGTACTGTATCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cyanolyca cucullata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5